(American Journal of Pathology. 1998;153:183-190.)
© 1998 American Society for Investigative Pathology
CD44 Isoform Expression Follows Two Alternative Splicing Pathways in Breast Tissue
Xavier Roca*
,
José L. Mate*
,
Aurelio Ariza*
,
Ana M. Muñoz-Mármol
,
Claudia von Uexküll-Güldeband
,
Inmaculada Pellicer*
,
José J. Navas-Palacios*
and
Marcos Isamat
From the Servei d'Anatomia Patològica,*
Hospital
Universitari Germans Trias i Pujol, and the Fundación
Echevarne,
Barcelona, Spain
 |
Abstract
|
|---|
The repertoire of distinct CD44 protein isoforms is generated by
means of alternative pre-mRNA splicing of 10 variable exons located in
the central region of the CD44 gene. We have used human breast ductal
carcinoma as a model to identify two alternative splicing pathways of
the CD44 pre-mRNA variable region that account for the generation of
all of the CD44 isoforms described in breast tissue. An alternative
splicing pathway that reflects inclusion of variable exons in a gradual
3'-to-5' fashion is evidenced in breast ductal carcinoma and its lymph
node metastases. This pathway is compatible with a mechanism that
generates the standard form of CD44 (devoid of variable exons) and is
distinguishable from an alternative splicing pathway that involves
exclusively variant exon 3 and is observable in both normal and
carcinoma breast tissue. We show that both pathways are detectable in
the same cell type in the breast and provide a speculative model by
which these splicing routes could take place.
 |
Introduction
|
|---|
Regulation of cell-cell and cell-matrix interactions via cell
adhesion molecules is a critical step during the metastatic spread of
tumors.1,2
CD44, a family of cell-surface glycoproteins,
has been reported to play a role in cell adhesion and tumor
dissemination, but the precise nature of the involvement of CD44 in
these processes is still under investigation. The CD44 gene consists of
20 exons from which at least 12 can be alternatively spliced from the
pre-mRNA.3,4
CD44 exons are compartmentalized in the gene
according to splicing behavior into four regions (Figure 1)
: two constant regions consisting of
exons 1 to 5 and exons 15 to 17, which are subject to general
constitutive splicing; a region composed of exons 18 and 19, which show
an alternate use of a short or long cytoplasmic tail, respectively; and
a central region that spans exons 6a to 14, also known as variable
exons (v-exons) v1 to v10. Complex alternative splicing applies to this
central region, which is responsible for the incorporation of the
variable domains into the extracellular portion of the final CD44
protein product. The category of complex alternative splicing has been
arbitrarily applied to a variety of genes that have multiple v-exons
that appear to be included in or excluded from the processed mRNA in a
complex manner to produce multiple mRNA isoforms from the same gene
(for review see Ref. 5
). Complex alternatively spliced CD44 messages
are being described as the result of a cellular response to particular
stimuli612. These stimuli are themselves
effectors of physiologically or developmentally regulated phenomena,
which suggests that these complex alternative splicing mechanisms are
subject to specific factors acting in trans together with
the spliceosome and/or in cis for, supposedly, every
possible variable exon. The role of specific alternative splice
trans-factors that drive the choice of 5' splice sites has
been the subject of recent studies.11,13
Interestingly, a
positive trans-acting factor(s) has been suggested to
recruit variant exon sequences in a 3' to 5' direction during CD44
splicing, and other dominant trans-factors are thought to
select distinct CD44 variable exons for inclusion in a
cell-type-specific manner.14
The expression of certain,
such generated CD44 isoforms has been implicated in important
physiological and pathological conditions, including lymphocyte
activation, leukocyte-endothelial transmigration, lymphopoiesis,
embryonal development, and the metastatic spread of tumors (for review
see 15-18
).

View larger version (10K):
[in this window]
[in a new window]
|
Figure 1. Schematic representation of the CD44 gene structure showing the central
variable region. The variable exon nomenclature used in this work is
shown above each variable exon (shaded
boxes). TM, transmembrane domain. Human exon v1
is crossed out to indicate that it contains a stop codon and has not
been found to be expressed in human tissues.40
|
|
Several functions have been ascribed to some CD44 isoforms. The
standard form of CD44 (CD44H), devoid of variable exons, acts as a
receptor that binds the extracellular matrix, mostly via hyaluronic
acid,19-24
with an activity dependent on
post-translational modifications, such as keratan sulfate substitution
and O-linked glycosylation.25,26
The epithelial form of
CD44 (CD44E), which includes v8 to v10, is involved in recognition of a
common determinant in CD44H and CD44E promoting homotypic cellular
aggregation.27
The protein domain coded by exon v3 has been
shown to bind growth factors via its heparan sulfate
modifications,28,29
and a metastatic activity has been
attributed to v6-containing isoforms after transfection studies in rat
tumors.30
The expression of particular CD44 isoforms is
well established in neoplasms such as non-Hodgkin's lymphomas, some
gastric carcinomas, colorectal carcinomas, and sarcomas as well as in
some cell line models.31-35
Human breast cancer has been
shown to express CD44 isoforms, but the definition and significance of
this expression has been controversial.36-39
We have used
different techniques, including reverse transcription polymerase chain
reaction (RT-PCR), immunohistochemistry, PCR library cloning, and DNA
sequencing, to study the nature of the CD44 isoforms expressed in
normal breast tissue, breast ductal carcinoma, and axillary lymph node
metastases. The CD44 isoforms characterized in this study reveal two
pathways of alternative splicing of CD44 v-exons in breast tissue.
These pathways are not mutually exclusive and can be easily integrated
into a single hypothetical model of CD44 complex alternative splicing.
The description of such alternative splicing routes will help in the
eventual identification of their underlying alternative splicing
mechanisms and, consequently, in our understanding of the role of CD44
in physiological and pathological processes.
 |
Materials and Methods
|
|---|
Materials
Cryopreserved (-80°C) human tissue from normal breast and
invasive ductal carcinoma of the breast (including axillary lymph nodes
when these were involved and available) from 43 females, diagnosed
between 1993 and 1995, were randomly selected from the frozen tissue
bank of the Department of Pathology at the Hospital Universitari
Germans Trias i Pujol, Badalona, Spain.
CD44 RT-PCR
RT-PCR was performed from 5 µg of total RNA extracted from
cryopreserved breast biopsy samples with the Ultraspec RNA solution
(Biotecx Laboratories, Houston, TX). The first-strand reaction was
performed with the first-strand synthesis kit (Pharmacia, Uppsala,
Sweden) followed by PCR using oligonucleotide primers FHCD44 in exon 5
(5'CCTGAAGAGATCTACCCCAGCAACCCT-ACTG3') and RHCD44 in exon 19
(5'TGGTGCGGCCGTTACACCCCAATCTTCATGTCC3'). PCR cycling conditions were
94°C for 1 minute, 55°C for 1 minute, and 72°C for 2.5 minutes
for 30 cycles using Taq polymerase Eurobiotaq (Eurobio, Les
Ulis, France). Starting amounts of cDNA template were adjusted in all
samples by PCR amplification of ß-actin as an internal control (data
not shown). CD44-specific PCR products were separated by
electrophoresis in a 1% agarose gel, visualized by ethidium bromide
staining, denatured in 0.5 N NaOH, 1.5 mol/L NaCl, and transferred
overnight in the same solution to a nylon membrane (Schleicher &
Schüell, Dassel, Germany) by standard methods. Filters were
prehybridized in 7% SDS, 0.5 mol/L phosphate buffer, 1% bovine serum
albumin and hybridized overnight in the same solution at 42°C with 5
pmol of digoxigenin-labeled oligonucleotide, processed, and stripped
using the DIG-oligonucleotide labeling and luminescent detection kit
(Boehringer Mannheim, Mannheim, Germany) according to the
manufacturer's protocol. The oligonucleotide probes used were (5'-3')
CD44STD probe in exon 15: CATCTGATTCAGATCCATGAGT and the following CD44
variable exon probes: CD44V2, CAGCCATTTGTGTTGTTGTGTGAAG; CD44V3,
TGGTGCTGGAGATAAAATCTTCAT; CD44V4, CAGTCATCCTTGTGGTTGTCTGAAGT;
CD44V5, TTGTGCTTGTAGAATGTGGGGTCTCT; CD44V6,
CAGCTGTCCCTGTTGTCGAATGGGA; CD44V7, CCATCCTTCTTCCTGCTTGATGAC; CD44V8,
GCGTTGTCATTGAAAGAGGTC; CD44V9, TGCTTGATGTCAGAGTAGAAG-TTGTTG; and
CD44V10, CTGATAAGGAACGATTGACATT-AGAGT.
CD44v PCR Libraries
Variable CD44 isoform PCR products were purified using the
Geneclean kit (Bio101, La Jolla, CA) from 1% TAE/agarose gels and
cloned by blunt-end ligation into pUC18 vector with the SureClone
ligation kit (Pharmacia, Uppsala, Sweden). Resulting positive colonies
were replica plated onto nylon filters and hybridized as explained
above. Plasmid minipreps were prepared by standard methods, and the
insert size of each clone was determined by an
EcoRI-BamHI digestion (New England Biolabs,
Beverly, MA) before DNA sequencing with the T7 sequencing kit
(Pharmacia).
CD44 Immunohistochemistry
Immunohistochemical detection of CD44 was performed with
anti-CD44s, clone 2C5; anti-CD44v3, clone 3G5; and anti-CD44v6, clone
2F10 (all from R&D Systems, Abingdon, UK). Five-micron-thick sections
were cut from paraffin-embedded biopsy samples, deparaffinized,
hydrated, heated in buffered citrate (citric acid and sodium citrate,
pH 6) in a microwave oven twice for 3 minutes with a 2-minute interval,
and incubated for 30 minutes with rabbit serum. Incubations with the
anti-CD44 monoclonal antibodies (MAbs) were carried out at a 1:1000
dilution for 22 hours at room temperature. Slides were washed and
incubated with biotinylated rabbit anti-mouse Ig antibodies at a 1:700
dilution and then incubated in PBS/6% hydrogen peroxide for 15 minutes
at room temperature before the avidin-biotin-peroxidase complex
addition (Dakopatts, Glostrup, Denmark). The chromogen
3,3'-diaminobenzidine tetrachloride (Serva, Heidelberg, Germany) was
used, and counterstaining was performed with Harris hematoxylin. A
nonimmune mouse serum was used as a negative control in this protocol.
 |
Results
|
|---|
Complex CD44 Isoform Expression Patterns in Breast Ductal Carcinoma
Samples
To establish the extent and the complexity of the CD44 isoform
pattern expressed by normal breast tissue and breast ductal carcinoma
we have used a protocol consisting of RT-PCR followed by Southern blot
hybridization with the CD44STD probe (in CD44 constant exon 5), which
hybridizes to all of the possible CD44 isoforms described to date. The
type of CD44 pattern complexity obtained is exemplified in Figure 2
. Eighty-one percent (34 of 42) of the
carcinoma samples studied showed complex patterns that included
detection of CD44v210 (as summarized in the histogram shown in Figure 2
).

View larger version (43K):
[in this window]
[in a new window]
|
Figure 2. CD44 RT-PCR patterns obtained from duct carcinoma
(C), lymph node
(L), and normal
(N) breast tissue,
visualized by hybridization of the RT-PCR product with probe CD44STD.
Examples of the CD44 isoform pattern complexity were obtained from
biopsies 43, 42, and 41. The histogram shows the summary of CD44
isoform pattern complexity found by RT-PCR in biopsy samples from 43
patients. Pattern complexity was arbitrarily established as high when
detection of a CD44v2-v10 (1730
bp) was detected, medium when a CD44v6-v10
(1244 bp) was detected as
the top band of a particular pattern, and low when only CD44E
(983 bp) and CD44H
(587 bp) were detected.
|
|
The Complexity of the CD44 Isoform Expression Pattern in Breast
Carcinomas Follows a Directional 3' to 5' Preference for Variable
Exon Inclusion
The precise exonic content of each of the patterns obtained above
was characterized by serial hybridization using variable exon-specific
probes from CD44v10 to CD44v2 (lanes v10 to v2 in Figure 3
). Three representative samples from
breast ductal carcinoma, its lymph node metastases, and normal breast
tissue are shown in Figure 3
. The hybridization patterns of the
carcinoma and lymph node metastases are very similar, and both present
a step-wise inclusion of variable exons, starting with the 3'-most
variable exons (eg, v10 and v9) in low Mr
isoforms and gradually moving toward 5' variable exons (eg, toward v2)
with a concomitant increase in isoform Mr. A
band at 1730 bp represents the CD44v2-v10 isoform and the band below it
is compatible by Mr with CD44v3-v10. Lanes v2 in
the carcinoma and lymph node metastases show that the relative signal
intensity between bands CD44v2-v10 and CD44v3-v10 is inverted when
compared with all of the other lanes. The differential signal in these
two bands suggests that the CD44v3-v10 band also results from different
combinations of isoforms, including all but one variable exon that
would form a polyisoform band at approximately 1600 bp, reactive to all
v-exon probes. The two highest Mr bands shown in
Figure 3
(*1) hybridize with all CD44 probes used and may correspond to
inclusion of intron or other v-exon sequences not as yet identified.
The nature of these bands is currently under investigation.

View larger version (33K):
[in this window]
[in a new window]
|
Figure 3. CD44 RT-PCR patterns visualized by hybridization of the RT-PCR product
with probe CD44STD and variable exon-specific serial Southern
hybridization of breast ductal carcinoma
(C), lymph node
metastasis (L), and
normal breast tissue (N).
The probes used appear at the bottom of each lane. Lanes labeled v10 to
v2 correspond to the pattern observed in lanes STD after
rehybridization with each variable exon probe. The exonic content of
the CD44 isoforms derived from this serial hybridization appears on the
right. *1 corresponds to the highest band-doublet in complex CD44
isoform patterns that is not compatible by
Mr with known CD44 isoforms
(see text).
|
|
Variable Exon-3 Can Be Alternatively Spliced through a Different
Pathway That Is Functional in Normal and Carcinoma Tissue
Exon v3 is subject to the 3'-to-5' exon inclusion preference
described above but is also clearly detectable by itself in a low
Mr isoform that corresponds to CD44v3 alone
(lanes v3, Figure 3
). This strict v3-cassette splicing route becomes
differentiated from the 3'-to-5' v-exon inclusion preference as the
former is unaltered between normal breast tissue and breast ductal
carcinoma or its lymph node metastases.
CD44 cDNA Isoform Cloning from Breast Carcinoma Reveals Atypical or
Minor Isoforms
A CD44-variable isoform RT-PCR library constructed after gel
purification omitting CD44H from the carcinoma sample shown in Figure 3
allowed screening of up to 150 CD44 variable clones by v-exon-specific
colony hybridization and DNA sequencing. We can infer the relative
levels of expression of each isoform characterized by classifying these
into two categories: major isoforms that are reproducibly detected in
most samples by hybridization and rare isoforms that have been cloned
and characterized from breast carcinoma but are not detectable by
hybridization. All major isoforms have been cloned and follow the two
alternative splicing trends described, with the exception of the
previously described CD44v6,35
which we detect by
hybridization although its resulting band is clearly detectable only in
the case shown on lane v6 of the lymph node metastases in Figure 3
.
Other exceptions include the expression of rare isoforms obtained from
the CD44v RT-PCR library, such as CD44v9 and CD44v6/v8-v10. These
isoforms may represent inaccurate splicing by either of the two
pathways proposed or may be the result of other underlying alternative
splicing mechanisms (a likely case for CD44v6) of low activity in the
breast tissue analyzed. However, the low profile of these minor
isoforms does not mask the conditioned v-exon position effect seen in
the samples studied.
The CD44v3 exon is reproducibly seen by itself in a CD44H context as
well as in the context of major isoforms such as CD44E and CD44v7v10,
yielding CD44v3, CD44v3/v8-v10, and CD44v3/v7-v10, respectively. This
combination of v3-containing isoforms would be expected from either an
overlap or an integration of the two alternative splicing pathways
proposed.
Both Alternative Splicing Routes Co-Localize to the Same Cell Type
in Breast Tissue
To find out whether these two alternative routes are
differentially used by certain cells in breast tissue, we have analyzed
5-µm-thick tissue sections of the breast samples represented above by
immunohistochemistry using MAbs anti-CD44H, anti-CD44v3, and
anti-CD44v6 (respectively, clone 2C5, clone 3G5, and clone 2F10 from
R&D Systems, Abingdon, UK; Figure 4
). A
positive immunoreaction for all three MAbs is present in carcinoma
cells, whereas normal tissue was unreactive to anti-CD44v6, as expected
from the variable exon-specific Southern hybridizations. Infiltrating
lymphocytes, negative for v3 and v6 but reactive to anti-CD44H, were
used as internal controls (see arrows on Figure 4
). CD44H expression in
normal breast tissue is restricted to the cell membranes of the
myoepithelial cell layer, located on the duct basal portion next to the
basal lamina. Immunostaining with anti-v3 presented the same pattern in
normal tissue, suggesting that the same pool of cells is capable of
expressing CD44H- and CD44v3-containing isoforms and that our RT-PCR
analyses were not affected by the presence of inflammatory or stromal
cells, which are CD44v negative. Likewise, parallel staining on defined
nests of infiltrating carcinoma cells showed expression of CD44H-,
CD44v3-, and CD44v6-containing isoforms in all cells. These results,
compatible with previously published data36
in that
expression of CD44H and CD44v isoforms is restricted to the same cell
type, suggest that both splicing pathways can coexist in the same cell.

View larger version (160K):
[in this window]
[in a new window]
|
Figure 4. Representative immunohistochemical findings
(x400) of normal breast
tissue (N) and invasive
ductal carcinoma of the breast
(C) using MAbs
anti-CD44H, anti-CD44v3, and anti-CD44v6. Infiltrating lymphocytes,
which stain with anti-CD44H but are nonreactive to anti-CD44v3 and
anti-CD44v6, are used as internal controls
(arrows). Positivity in normal
breast tissue is restricted to the cell membrane of myoepithelial
cells. Invasive carcinoma nests, reactive to all three MAbs, show
positivity mainly on their cell membranes.
|
|
 |
Discussion
|
|---|
The 3'-to-5' v-exon inclusion preference observed during the
expression of CD44 in the breast carcinoma tissues studied appears to
respond to a mechanism that ascribes a positional value to each
variable exon. This means that variable exon inclusion starts with the
3'-most variable exons and gradually moves toward 5' variable exons
with a concomitant increase in isoform Mr. The
existence of such a mechanism had been previously
suggested,40
and a positive trans-acting factor
responsible for directional v-exon inclusion has recently been
postulated after a dominant effect was observed in cell fusion
experiments.14
The variable exon composition of the major
isoforms reported herein reveals an inclusion gradient driven by the
3'-most v-exon that is included in the message, such that if a given
isoform includes v9, the probability that the same isoform has v10 is
100%. In the same manner, inclusion of v9 is always seen in isoforms
containing v8. This trend is true for all variable exons with the
exception of v3. Exon v3 can escape this inclusion trend as only 50%
of all of the different v3-containing isoforms described also include
v4. By parsimony, and as an alternative to the idea of one positive
trans-acting factor that actively recruits
v-exons,14
we speculate that in breast carcinoma exon v3 in
the CD44 pre-mRNA can be somehow tagged for inclusion before undergoing
the 3'-to-5' v-exon inclusion preference route. This route would then
be aimed at effectively hiding the untagged v-exons on the CD44
pre-mRNA variable region from the active constitutive spliceosome, as
sketched in Figure 5
. The directional
v-exon inclusion would result from enabling gradual splicing of the
variable region by the spliceosome in a 3'-to-5' needle-pulling-thread
action. This would ensure production of CD44H and/or CD44v3 when
exon-v3 was tagged, and subsequently, gradual directional v-exon
inclusion would account for the scope of CD44 isoforms expressed by a
single cell. Furthermore, this pathway might well be altered by
pathological processes such as tumorigenesis or by physiological
signals. In both cases, however, the broadening of the CD44 isoform
pattern may be induced or reversed by changes in environmental or
intracellular signals. A situation that can be envisaged without a need
for genetic mutations causing impairment of the alternative splicing of
CD44.

View larger version (39K):
[in this window]
[in a new window]
|
Figure 5. A hypothetical model to represent the concept of integration of the
3'-to-5' v-exon inclusion preference and the strict v3-cassette
inclusion splicing routes found in breast carcinoma tissue. The CD44
pre-mRNA is shown at the top. Constant exons and CD44 variable exons
are represented by black and white boxes, respectively. Gradual
directional inclusion is represented by occlusion of the v-exons in a
hypothetical loop or trans-acting factor enclosed within a box to
illustrate the needle-pulling-thread effect during the unmasking of the
variable region to the active spliceosome. Resulting CD44 isoforms are
shown next to each hypothetical pre-mRNA splicing intermediate. The
extent of the variability of the CD44 isoforms observed in normal and
carcinoma breast tissue is exemplified by the two vertical arrows on
the right. We postulate that this 3'-to-5' v-exon inclusion preference
is aimed at generating CD44H. This splicing route appears to be rigidly
controlled in normal tissue, where expression of CD44v9-v10 and CD44E
probably represents legitimate leakage while splicing out the complete
variable region. Gradual relaxation of the stringency of this control
and its metastases would enable the orderly expression of a much
broader set of variable isoforms ranging from low to high
Mr.
|
|
This observation, plus the fact that total impairment of CD44H
production is not seen in carcinoma cells, implies that the different
degree of the 3'-to-5' v-exon inclusion preference pathway is not the
result of a clonal somatic change in the cell. Instead, this difference
may respond to an epigenetic alteration brought about by the new
environment or different architecture of the carcinoma tissue.
Interestingly, expression of at least CD44H and CD44E has been involved
in different forms of cellular aggregation.27
Consequently,
the question of whether newly developing neoplastic architectural
arrangements can signal changes to the basal CD44 splicing patterns of
the tissue of origin becomes an important one. In these terms, CD44
isoform expression cannot be categorically considered as a tumorigenic
or metastatic marker, as it is not distinguishable from either a marker
of cell clonality or from a marker of a particular form of tissue
architecture. This point will need clarification, as previous works
have addressed the prognostic value of CD44 isoform expression in
breast carcinoma with conflicting conclusions. Expression of CD44
variant exon 6 epitope and overexpression of CD44H and CD44E have been
claimed to be markers of poor prognosis in breast
cancers.37-39
Contrary to this claim, another
report36
has shown that expression of the above mentioned
CD44 forms can be detected in normal breast epithelium, thus
invalidating their potential as indicators of malignant disease. We
have not observed significant correlation between the expression of the
CD44 isoforms detected in the samples studied and any particular
disease outcome (data not shown). Instead, the molecular dissection of
the CD44 expression patterns detected in 81% of the ductal carcinomas
studied has pointed to two active pathways of alternative splicing.
Understanding the mechanisms underlying these splicing routes will
inevitably help to answer the question of whether certain CD44 isoforms
act as bona fide metastogenes or whether CD44 isoform expression
provides only a window to the deregulation of alternative splicing
processes that affect pleiotropically the splicing of other genes that
can act synergistically or independently of CD44 to promote the
dissemination of this type of tumor.
The finding of a strict v3-cassette alternative splicing route gains
particular interest in the light of the recently described role for
v3-containing CD44 isoforms. These have been shown to act as presenting
molecules for some growth factors, particularly the family of
heparan-binding growth factors, such as basic fibroblast growth factor
and heparan-binding epidermal growth factor.28,29
CD44
expression in normal breast tissue is confined to the myoepithelial
cell layer, located on the duct basal portion next to the basal lamina
(Figure 3)
. As these are mature cells that regulate breast duct
contraction, it will be interesting to study whether the v3-containing
CD44 isoforms ensured by the strict v3-cassette inclusion splicing play
an active role in this process. Previous observations on the regulation
of the growth state and contractile phenotype of blood-vessel-lining
cells by heparan sulfate proteoglycans set a precedent for a role for
CD44v3-containing isoforms in this type of function. The contractile
status of smooth muscle fibers results from a balance between the
internalization and external degradation of the heparan sulfate
proteoglycans of the basal lamina.41
These proteoglycans
are known to alter muscle cell shape and cytoskeletal organization
leading to cell growth inhibition.42
Furthermore, mutations
in the Caenorhabditis elegans equivalent of perlecan, the
mammalian basement membrane heparan sulfate proteoglycan, affect the
organization of all contractile tissues in the developing
nematode.43
Thus, given the confined expression of CD44v3
isoforms found in the breast, it seems likely that modification (via
down-regulation, degradation, or internalization) of CD44v3 isoforms
associated with heparan sulfate glycosaminoglycans may contribute to
regulate breast duct contraction during the secretory phase of
lactation.
In brief, our observations reveal the presence of two CD44 alternative
splicing pathways within the myoepithelial cell layer of the breast
duct and in carcinoma derived from ductal epithelial cells. Whether
these mechanisms are also used by other tissues, or whether there are
other preferred routes of alternative splicing that result in the
expression of particular CD44 isoforms not found in the breast, remains
to be seen. Better understanding of the mechanisms used by
CD44 to generate the spectrum of isoforms described so far will help to
explain the functional involvement of CD44 in physiological and
pathological processes, as well as reveal the routes and maneuvers used
by a cell to handle very large pre-mRNAs in a purposeful manner.
 |
Acknowledgements
|
|---|
We are grateful to Ms. A. Fernandez-Vasalo and Ms. M. J.
Zujar (Hospital Universitari Germans Trias i Pujol) for assistance with
immunohistochemistry and to Dr. J. de Monserrat (Fundación
Echevarne) for help with figure editing. We thank Dr. C. Lopez-Otin and
Dr. M. V. Bell for critical discussion of the work and helpful
suggestions.
 |
Footnotes
|
|---|
Address reprint requests to Dr. Marcos Isamat, Fundación Echevarne, Provença 312, 08037 Barcelona, Spain. E-mail:
biomol{at}ns.hugtip.scs.es
Supported by grants FIS 95/1345 and CICYT SAF97/0227 from the Spanish Ministries of Health and of Education and Culture, respectively, and Fundación Pi i Sunyer (Marato'94 TV3). X. Roca is the recipient of a CIRIT-FI predoctoral fellowship. C. von Uexküll-Güldeband and A. Muñoz-Mármol are recipients of Fundación Echevarne postdoctoral fellowships. I. Pellicer is the recipient of a postdoctoral fellowship from the Spanish Ministry of Education and Culture.
Accepted for publication April 7, 1998.
 |
References
|
|---|
-
Liotta LA, Stetler-Stevenson WG: Tumor invasion and metastasis: an imbalance of positive and negative regulation. Cancer Res 1991, 51:5054s-5059s
-
Liotta LA, Steeg PS, Stetler-Stevenson WG: Cancer metastasis and angiogenesis: an imbalance of positive and negative regulation. Cell 1991, 64:327-336[Medline]
-
Stamenkovic I, Amiot M, Pesando JM, Seed B: A lymphocyte molecule implicated in lymph node homing is a member of the cartilage link protein family. Cell 1989, 56:1057-1062[Medline]
-
Screaton G, Bell M, Jackson D, Cornelis F, Gerth U: Genomic structure of DNA encoding the lymphocyte homing receptor CD44 reveals at least 12 alternatively spliced exons. Proc Natl Acad Sci USA 1992, 89:12160-12164[Abstract/Free Full Text]
-
Breitbart RE, Andreadis A, Nadal-Ginard B: Alternative splicing: a ubiquitous mechanism for the generation of multiple protein isoforms from single genes. Annu Rev Biochem 1987, 56:467-495[Medline]
-
Underhill CB: Hyaluronan is inversely correlated with the expression of CD44 in the dermal condensation of the embryonic hair follicle. J Invest Dermatol 1993, 101:820-826[Medline]
-
Mackay CR, Terpe HJ, Stauder R, Marston WL, Stark H, Günthert U: Expression and modulation of CD44 variant isoforms in humans. J Cell Biol 1994, 124:71-82[Abstract/Free Full Text]
-
Delfino DV, Patrene KD, DeLeo AB, DeLeo R, Herberman RB, Boggs SS: Role of CD44 in the development of natural killer cells from precursors in long-term cultures of mouse bone marrow. J Immunol 1994, 152:5171-5179[Abstract]
-
Haegel H, Tölg C, Hofmann M, Cederig R: Activated mouse astrocytes and T cells express similar CD44 variants. Role of CD44 in astrocyte/T cell binding. J Cell Biol 1993, 122:1067-1077[Abstract/Free Full Text]
-
Arch R, Wirth K, Hofmann M, Ponta H, Matzku S, Herrlich P, Zöller M: Participation in normal immune responses of a splice variant of CD44 that encodes a metastasis-inducing domain. Science 1992, 257:682-685[Abstract/Free Full Text]
-
Screaton R, Càceres J, Mayeda A, Bell M, Plebanski M, Jackson D, Bell J, Krainer A: Identification and characterization of three members of the human SR family of pre-mRNA splicing factors. EMBO J 1995, 14.17:4336-4349[Medline]
-
Jackson DG, Screaton GR, Martyn VB, Dickinson R, Timans J, Shiels J, Whittle N, Collins I, Fawcett J, Simmons D, Bell JI: Structure of the CD44 gene and its expression during leucocyte activation. Schlossman EF eds. Fifth International Human Leukocyte Differentiation Antigen Workshop Handbook. 1995, :pp 1727-1729 UK, Oxford University Press, Oxford
-
Càceres J, Stamm FS, Helfman DM, Krainer AR: Regulation of alternative splicing in vivo by overexpression of antagonistic splicing factors. Science 1994, 265:1706-1709[Abstract/Free Full Text]
-
König H, Moll J, Ponta H, Herrlich P: Trans-acting factors regulate the expression of CD44 splice-variants. EMBO J 1996, 15:4030-4039[Medline]
-
Herrlich P, Zöller M, Pals S, Ponta H: CD44 splice variants: metastases meet lymphocytes. Immunol Today 1993, 14.8:395-399[Medline]
-
Lesley J, Hyman R, Kinkade PW: CD44 and its interaction with extracellular matrix. Adv Immunol 1993, 54:271-335[Medline]
-
Günthert U, Stauder R, Mayer B, Terpe H-J, Finke L, Friedrichs K: Are CD44 variant isoforms involved in human tumour progression? Cancer Surv 1995, 24:19-42[Medline]
-
Ruiz P, Schwärzler C, Günthert U: CD44 isoforms during differentiation and development. BioEssays 1995, 917:17-24
-
Aruffo A, Stamenkovic I, Melnick M, Underhill CB, Seed B: CD44 is the principal cell surface receptor for hyaluronate. Cell 1990, 61:1303-1313[Medline]
-
Stamenkovic I, Aruffo A, Amiot M, Seed B: The hematopoietic and epithelial forms of CD44 are distinct polypeptides with different adhesion potentials for hyaluronate-bearing cells. EMBO J 1991, 10:1057-1062
-
He Q, Lesley J, Hyman R, Ishihara K, Kincade PW: Molecular isoforms of murine CD44 and evidence that the membrane proximal domain is not critical for hyaluronate recognition. J Cell Biol 1992, 119:1711-1719[Abstract/Free Full Text]
-
Peach JP, Hollenbaugh D, Stamenkovic I, Aruffo A: Identification of hyaluronic acid binding sites in the extracellular domain of CD44. J Cell Biol 1993, 122:257-264[Abstract/Free Full Text]
-
Hamann KJ, Dowling TL, Neely SP, Grant JA, Leff AR: Hyaluronic acid enhances cell proliferation during eosinopoiesis through the CD44 surface antigen. J Immunol 1995, 154:4073-4080[Abstract]
-
Perschl A, Lesley J, English N, Trowbridge I, Hyman R: Role of CD44 cytoplasmic domain in hyaluronan binding. Eur J Immunol 1995, 25:495-501[Medline]
-
Takahashi K, Stamenkovic I, Cutler M, Dasgupta A, Tanabe KK: Keratan sulfate modification of CD44 modulates adhesion to hyaluronate. J Biol Chem 1996, 271:9490-9496[Abstract/Free Full Text]
-
Dasgupta A, Takahashi K, Cutler M, Tanabe KK: O-linked glycosylation modifies CD44 adhesion to hyaluronate in colon carcinoma cells. Biochem Biophys Res Commun 1996, 227:110-117[Medline]
-
Droll A, Dougherty ST, Chiu RK, Dirks JF, McBride WH, Cooper DL, Dougherty GJ: Adhesive interactions between alternatively spliced CD44 isoforms. J Biol Chem 1995, 270:11567-11573[Abstract/Free Full Text]
-
Jackson D, Bell J, Dickinson R, Timans J, Shields J: Proteoglycan forms of the lymphocyte homing receptor CD44 are alternatively spliced variants containing the v3 exon. J Cell Biol 1995, 128:673-685[Abstract/Free Full Text]
-
Bennet KL, Jackson DG, Simon JC, Tanczos E, Peach R, Modrell B, Stamenkovic I, Plowman G, Aruffo A: CD44 isoforms containing exon V3 are responsible for the presentation of heparin-binding growth factor. J Cell Biol 1995, 128:687-698[Abstract/Free Full Text]
-
Günthert U, Hofmann M, Rudy W, Reber S, Zöller M, Haubmann I, Matzku S, Wenzel A, Ponta H, Herrlich P: A new variant of glycoprotein CD44 confers metastatic potential to rat carcinoma cells. Cell 1991, 65:13-24[Medline]
-
Koopman G, Heider KH, Horst E, Adolf GR, van den Berg F, Ponta H, Herrlich P, Pals ST: Activated human lymphocytes and aggressive non-Hodgkin's lymphomas express a homologue of the rat metastasis-associated variant of CD44. J Exp Med 1993, 177:897-904[Abstract/Free Full Text]
-
Heider K-H, Dämmrich J, Skroch-Angel P, Müller-Hermelink H-K, Vollmers HP, Herrlich P, Ponta H: Differential expression of CD44 splice variants in intestinal and diffuse-type human gastric carcinomas and normal gastric mucosa. Cancer Res 1993, 53:4197-4203[Abstract/Free Full Text]
-
Heider K-H, Hofmann M, Hors E, van den Berg F, Ponta H, Herrlich P, Pals ST: A human homologue of the rat metastasis-associated variant of CD44 is expressed in colorectal carcinomas and adenomatous polyps. J Cell Biol 1993, 120:227-233[Abstract/Free Full Text]
-
Salmi M, Grön-Virta K, Sointu P, Grenman R, Kalimo H, Jalkanen S: Regulated expression of exon v6 containing isoforms of CD44 in man: downregulation during malignant transformation of tumors of squamocellular origin. J Cell Biol 1993, 122:431-442[Abstract/Free Full Text]
-
Woodman AC, Sugiyama M, Yoshida K, Sugino T, Borgya A, Goodison S, Matsumumura Y, Tarin D: Analysis of anomalous CD44 gene expression in human breast, bladder, and colon cancer and correlation of observed mRNA and protein isoforms. Am J Pathol 1996, 149:1519-1530[Abstract]
-
Friedrichs K, Franke F, Lisboa B-W, Kügler G, Gille I, Terpe H-J, Hölzel F, Maass H, Günthert U: CD44 isoforms correlate with cellular differentiation but not with prognosis in human breast cancer. Cancer Res 1995, 55:5424-5433[Abstract/Free Full Text]
-
Kaufmann M, Heider KH, Sinn HP, von Minckwitz G, Ponta H, Herrlich P: CD44 variant exon epitopes in primary breast cancer and length of survival. Lancet 1995, 345:615-619[Medline]
-
Iida N, Bourguignon LYW: New CD44 splice variants associated with human breast cancers. J Cell Physiol 1995, 162:127-133[Medline]
-
Joensuu H, Klemi PJ, Toikkanen S, Jalkanen S: Glycoprotein CD44 expression and its association with survival in breast cancer. Am J Pathol 1993, 143:867-874[Abstract]
-
Screaton GR, Bell MV, Bell JI, Jackson DG: The identification of a new alternative exon with highly restricted tissue expression in transcripts encoding the mouse Pgp-1 (CD44) homing receptor. J Biol Chem 1993, 268:12235-12238[Abstract/Free Full Text]
-
Campbell JH, Campbell GR: The macrophage as an initiator of atherosclerosis. Clin Exp Pharmacol Physiol 1991, 18:81-84[Medline]
-
Herman IM: Endothelial cell matrices modulate smooth muscle cell growth, contractile phenotype and sensitivity to heparin. Homeostasis 1990, 20:166-177
-
Rogalski TM, Williams BD, Mullen GP, Moerman DG: Products of the unc-52 gene in Caenorhabditis elegans are homologous to the core protein of the mammalian basement membrane heparan sulfate proteoglycan. Genes Dev 1993, 7:1471-1484[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
E. Vela, J. M. Hilari, X. Roca, A. M. Munoz-Marmol, A. Ariza, and M. Isamat
Multisite and bidirectional exonic splicing enhancer in CD44 alternative exon v3
RNA,
December 1, 2007;
13(12):
2312 - 2323.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Huang, S. V. Fernandez, S. Goodwin, P. A. Russo, I. H. Russo, T. R. Sutter, and J. Russo
Epithelial to Mesenchymal Transition in Human Breast Epithelial Cells Transformed by 17 -Estradiol
Cancer Res.,
December 1, 2007;
67(23):
11147 - 11157.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Zhu, J. Shendure, R. D. Mitra, and G. M. Church
Single Molecule Profiling of Alternative Pre-mRNA Splicing
Science,
August 8, 2003;
301(5634):
836 - 838.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W.-H. Yu, J. F. Woessner Jr., J. D. McNeish, and I. Stamenkovic
CD44 anchors the assembly of matrilysin/MMP-7 with heparin-binding epidermal growth factor precursor and ErbB4 and regulates female reproductive organ remodeling
Genes & Dev.,
February 1, 2002;
16(3):
307 - 323.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Mummidi, G. Catano, L. Lam, A. Hoefle, V. Telles, K. Begum, F. Jimenez, S. S. Ahuja, and S. K. Ahuja
Extensive Repertoire of Membrane-bound and Soluble Dendritic Cell-specific ICAM-3-grabbing Nonintegrin 1 (DC-SIGN1) and DC-SIGN2 Isoforms. INTER-INDIVIDUAL VARIATION IN EXPRESSION OF DC-SIGN TRANSCRIPTS
J. Biol. Chem.,
August 24, 2001;
276(35):
33196 - 33212.
[Abstract]
[Full Text]
[PDF]
|
 |
|