| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Life Sciences Division,*
Ernest Orlando
Lawrence Berkeley National Laboratory, Berkeley, and Department of
Anatomy,
University of California, San
Francisco, California
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Matrix metalloproteinases (MMPs) are extracellular matrix (ECM)-degrading enzymes involved in mammary gland morphogenesis and involution.10-13 During late pregnancy and lactation, when the gland becomes fully functional, the expression of MMPs is low;11 however, during involution, when the gland loses function and is remodeled, synthesis of ECM-degrading proteinases increases dramatically.11 Disturbance of the balance between MMPs and MMP inhibitors leads to either unscheduled involution or prolonged lactation.9,12 Mammary glands of virgin mice expressing an autoactivating stromelysin-1 (SL-1) transgene display supernumerary branches and precocious alveolar development, accompanied by the synthesis of ß-casein at levels found normally only during early pregnancy.14,15 During late pregnancy, increased expression of the SL-1 transgene leads to a reduction in expression of pregnancy-specific genes.14 Later in life, some SL-1 transgenic mice develop hyperplastic, dysplastic, and ductal carcinoma in situ-like lesions, as well as malignant tumors.16
Little is known about the sequence of changes that occurs before formation of an overt reactive stroma in breast cancer. In the present study, we address the question of whether and how the stromal compartment is altered as a consequence of inappropriate SL-1 transgene expression in the epithelium.
| Materials and Methods |
|---|
|
|
|---|
Mammary tissue was obtained from normal CD-1 mice (Charles River, Wilmington, MA) and their transgenic counterparts. Transgenic mice expressing an autoactivating Val92-to-Gly92 mutation of the rat SL-1 gene under the control of a whey acidic protein promoter were generated previously.14 Mammary glands from two different transgenic lines (M2-5 and M2-21) were used interchangeably. The inguinal and abdominal mammary glands were surgically excised from female mice at various stages of development and immediately frozen in liquid nitrogen for RNA extraction. A small portion of the gland was fixed in 4% paraformaldehyde for in situ hybridization analysis. All experiments were performed under protocols approved by the Animal Welfare and Research Committee, Lawrence Berkeley National Laboratory, and the Committee on Animal Research, University of California, San Francisco.
Northern Blot Analysis
RNA was prepared by the technique of Chomczynski and Sacchi.17 Total RNA (15 µg) was separated on denaturing formaldehyde agarose gels, transferred to Hybond N+ membranes (Amersham, Arlington Heights, IL), and hybridized at high stringency with a riboprobe generated with T7 polymerase (New England Biolabs, Beverly, MA) from the mouse SL-1 cDNA pmTRM1118 that was radiolabeled with 32P-UTP (Amersham) to a specific activity of 1 x 108 cpm/µg. Sequences corresponding to the 3' untranslated region of the rat SL-1 cDNA (nucleotides 1514 to 1772)19 were used to identify rat SL-1 transgene mRNA. Sequences corresponding to nucleotides 83 to 2069 of the full-length mouse tenascin-C cDNA20 were used to identify tenascin-C mRNA. The cDNA probes for platelet endothelial cell adhesion molecule-1 (PECAM-1)21 and tenascin-C were radiolabeled by random priming (Rediprime kit, Amersham) according to the manufacturer's instructions. For normalization, blots were boiled in water and reprobed with a cDNA probe for ribosomal 28S RNA.
Reverse Transcription-Polymerase Chain Reaction and Southern Hybridization
Total RNA was resuspended in diethyl pyrocarbonate-pretreated water and reverse transcribed with 10 U/µl Moloney murine leukemia virus reverse transcriptase (Life Technologies, Gaithersburg, MD) in 50 mmol/L Tris-HCl (pH 8.3), 75 mmol/L KCl, 3 mmol/L MgCl2, 10 mmol/L dithiothreitol, 0.5 mmol/L dATP, 0.5 mmol/L dCTP, 0.5 mmol/L dTTP, 0.5 mmol/L dGTP, and 12.5 mg/µl oligo(dT)1218 (Life Technologies) for 30 minutes at 37°C. Polymerase chain reaction (PCR) amplification was performed with 2 ng/µl reverse-transcribed RNA, 0.025 U/µl Taq DNA polymerase (Life Technologies), 1 µmol/L 5' primer, 1 µmol/L 3' primer, 20 mmol/L Tris-HCl (pH 8.4), 50 mmol/L KCl, 2 mmol/L MgCl2, 0.2 mmol/L dATP, 0.2 mmol/L dCTP, 0.2 mmol/L dGTP, and 0.2 mmol/L dTTP with cycle numbers indicated in the figure legends. Each PCR cycle was performed at 94°C for 1 minute, 55°C for 1 minute, and 72°C for 1 minute. Reverse-transcribed RNA (100 ng) was amplified with the following primer pairs (all from Biosynthesis, Lewisville, TX): GCAGCCATTTCTTTAAAGGC as 5' primer and CCACTTCAGTGCGCCAAGTT as 3' primer for amplification of rat SL-1; CTATGCCTACTTCCTTCGTGGC as 5' primer and ATCTCATTACCAACACCACTCC as 3' primer for mouse stromelysin-3 (SL-3); TTGAGAAGGATGGCAAGTATGG as 5' primer and ACACCTTGCCATCGTTGC as 3' primer for mouse gelatinase A; TTGAAGGATGGCAAGTATGG as 5' primer and CGAAGGCATGACCTAGAGTGT as 3' primer for mouse matrilysin. PCR amplification products were resolved on 1.5% agarose gels. To verify the identity of the amplified sequences, Southern hybridizations were performed according to published procedures22 with oligonucleotides complementary to the mRNA sequence of the gene examined. The following oligonucleotides were used: GAAACCCAAATGCTTCAAAGACAGCATCCA for rat SL-1, TATGGCTGGGTCTCTTACATGATCTAAG for SL-3, GTCCATCAGCATTGCCACCCATGGTAAACA for gelatinase A, and TGTCTCCATGATCTCTCCTTGCGAAGCCAA for matrilysin.
In Situ Hybridization
Deparaffinized sections (5 µm) were treated with proteinase K (5 µg/ml) and hybridized overnight with 35S-labeled transcripts from a mouse SL-1 cDNA18 subcloned in Bluescript KS (+) (Strategene, La Jolla, CA). For antisense probe, pmTRM12 fragment (3115 to 4051) was used, and for sense probe pmTRM12 fragment (2205 to 2918) was used. After hybridization at 47°C, sections were treated with RNase A (20 µg/ml; Boehringer Mannheim, Indianapolis, IN) and RNase T1 (2 U/ml; Boehringer Mannheim) for 10 minutes at 37°C, followed by washes in 2x standard saline citrate, 50% formamide at 50°C for 2 hours and in 0.1x standard saline citrate at 25°C for 30 minutes, before autoradiography with NTB2 emulsion (Kodak, Rochester, NY). Slides were exposed for 10 days and counterstained with hematoxylin after developing.
Histochemistry
Paraffin-embedded tissue sections (5 µm) were deparaffinized in xylene, treated with ethanol, rinsed in phosphate-buffered saline, and incubated for 10 minutes at 37°C with 0.1% trypsin in 0.05 mol/L Tris-HCl and 0.1% CaCl2, pH 7.4. Sections were then incubated with antibodies against von Willebrand factor (vWF) (A 0082, 1:200 dilution; DAKO, Carpinteria, CA) in blocking buffer (phosphate-buffered saline with 2% bovine serum albumin) overnight at 4°C. After washing with phosphate-buffered saline, the specimens were incubated with biotinylated goat anti-F(ab') mouse antibody (1:100 dilution; Amersham) for 30 minutes at ambient temperature. The specimens were then washed and incubated for 30 minutes at ambient temperature with Texas Red-conjugated streptavidin (1:100 dilution; Amersham). Nuclei were visualized by brief incubation of sections with 4',6'-diamidino-2-phenyl indole (DAPI, 0.5 µg/ml) (Sigma Chemical Co., St. Louis, MO) before mounting with Vectashield (Vector Laboratories, Burlingame, CA).
For the detection of tenascin-C, frozen tissue sections (5 µm) were fixed in 2% paraformaldehyde for 20 minutes, washed with 0.1 mol/L glycine in phosphate-buffered saline for 15 minutes, and incubated with a rabbit polyclonal antiserum to mouse tenascin-C (1:500 dilution, pK7, gift from Dr. Melitta Schachner). Indirect immunofluorescence was performed as described previously.23
Gomori's trichrome staining was used to stain total collagens.24
| Results |
|---|
|
|
|---|
In a previous study, we showed that the mammary glands of virgin SL-1 transgenic animals resembled those of glands from early pregnant normal mice and that during lactation the mammary glands of transgenic mice had smaller alveoli than wild-type mice and exhibited reduced milk expression.13,14 Thus, the transition to loss of function in these animals must have begun during pregnancy or even earlier, rather than during lactation. To gain insight into the underlying mechanism of this phenomenon, we analyzed when and how expression of the SL-1 transgene led to alteration of gene expression in the developing mammary gland.
Endogenous SL-1 is the major MMP expressed in the stroma of mammary
glands from virgin, early pregnant, and involuting
mice.9,12,15,25,26
We therefore examined expression of
endogenous SL-1 as a function of the expression of the rat transgene.
Reverse transcription-PCR amplification suggested that endogenous SL-1
mRNA was up-regulated as a consequence of SL-1 transgene expression
(Figure 1A)
. As a more quantitative
measure of endogenous SL-1 mRNA, total RNA from mammary glands of
normal and transgenic mice was analyzed by Northern hybridization.
Endogenous SL-1 mRNA was up-regulated in mammary glands from 70-day
virgin and 10- and 15-day pregnant transgenic mice, relative to their
normal counterparts (Figure 1
, B and C). However, the difference in the
expression of endogenous SL-1 in glands from transgenic and normal mice
at 6 or 18 days of pregnancy was not statistically significant, and
there was no difference during lactation and involution. Three other
MMPs that have characteristic expression patterns during mammary gland
development, matrilysin, gelatinase A, and SL-3,9-15
were
also examined by reverse transcription-PCR. The levels of these enzymes
are too low to be detected by northern blots. Matrilysin, which is
expressed only by epithelial cells, was expressed in glands from 70-day
virgin transgenic mice, but was not found in glands from normal mice at
the same developmental stage (Figure 1A)
. SL-3, which is restricted to
the mammary stroma, and gelatinase A were detected in glands from
lactating transgenic, but not normal, mice (Figure 1A)
.
|
|
During normal mammary gland involution, BM disruption is
paralleled by increased expression of a number of MMPs in the stromal
compartment. In our previous study, we documented loss of BM around
epithelial components of the mammary glands from lactating transgenic
mice.14
When mammary glands from virgin (data not shown)
and 6-day pregnant (Figure 3)
transgenic
animals were examined by immunostaining for laminin and type IV
collagen, BMs appeared intact, despite the observed increase in
endogenous SL-1 mRNA in the virgin animals. However, BM fragmentation
was obvious in glands from 15-day pregnant mice (Figure 3)
.
Interestingly, not only the BMs around alveoli, but also those around
adipocytes were affected (Figure 3
, d and f), whereas the BMs of blood
vessels remained intact (Figure 3d)
, indicating the significance of
locally secreted SL-1, as opposed to systemic changes.
|
|
|
Tenascin-C is up-regulated in the mammary gland when
epithelial-mesenchymal communications are altered, such as in
involution or in the stromal reaction in response to breast
cancer.23,28,29
Thus, we would expect inappropriate
tenascin-C expression if the microenvironment of the mammary stroma
were altered to resemble the involuting and/or the tumor stroma.
Tenascin-C mRNA was not expressed in glands from virgin, pregnant, or
lactating normal mice, but was abundant during involution (Figure 5A)
. There was no tenascin-C expression
in glands from virgin transgenic mice, consistent with the observation
that BM was not degraded. During pregnancy and lactation, however,
tenascin-C was expressed in transgenic mammary tissue (Figure 5A)
.
Interestingly, two tenascin-C mRNA species were found, with the larger
transcript predominating in pregnancy and involution. In contrast, only
the smaller mRNA was present during lactation in transgenic mice
(Figure 5A)
. Furthermore, the amount was very small, underscoring again
the dominance of the lactational phenotype mentioned above. Mammary
glands from normal mice expressed both tenascin-C transcripts at
similar levels only during involution, although in contrast to
transgenic animals, expression was much lower at day 2 than at day 4 of
involution. Tenascin-C protein was localized to the proximity of the BM
surrounding the alveoli and ducts in glands from lactating transgenic
mice (Figure 5B)
.
|
The results described above suggest that in glands from pregnant
transgenic mice, both stromal and epithelial compartments express
characteristics usually found only during involution in normal mice,
and in the stroma from breast cancer patients.9,28
To
further explore this possibility, we stained for collagen content
throughout mammary gland development using Gomori's trichrome method.
There was a considerable increase in collagen deposition around the
ducts and alveoli as well as in the adipose compartment, in both virgin
and pregnant transgenic animals (Figure 6)
. Collagen deposition increased
approximately 8-fold in virgin and 2-fold in 6-day pregnant glands from
transgenic mice compared with normal mice (Table 2)
. At day 15 of pregnancy and during
lactation, the number of ducts and alveoli were no longer significantly
different in normal and transgenic mice; however, there was still a
statistically significant increase in collagen content at day 15 of
pregnancy, because of increased deposition around the ducts.
|
|
|
| Discussion |
|---|
|
|
|---|
SL-1 degrades many ECM substrates, including fibronectin, types III, IV and V collagen, laminin, and proteoglycans.13,31 Thus, the BM and other ECM constituents of the mammary ducts32 could be targets for proteolytic activity of SL-1. This suggests that the activity of endogenous MMPs was highly regulated during normal mammary gland development, as well as in the precocious development of the glands from virgin transgenic mice. Although endogenous SL-1 and matrilysin were increased in addition to SL-1 transgene expression, laminin and type IV collagen-containing BM appeared intact in virgin and 6-day pregnant transgenic mice. Despite the apparent continuity of BM, the epithelium of the glands of virgin and early pregnant transgenic mice resembled the early pregnant state, both morphologically and functionally. Fibroblasts may participate in mammary gland branching morphogenesis and lobuloalveolar development by focal activation of MMPs, or by simply altering the proteinase-to-inhibitor ratio in favor of MMPs, as was suggested for collagenase in salivary gland development.33 The stroma in the glands of transgenic animals had already acquired a highly reactive phenotype, even before pregnancy, as indicated by an increase in collagen content, vascularization, and augmented levels of stromal cell-derived endogenous SL-1. The altered stroma can progressively modify epithelial-mesenchymal interactions as evidenced by expression of tenascin-C at 6 days of pregnancy in transgenic mice. During embryogenesis and mammary gland involution, tenascin-C is induced in the stroma when the epithelia and the surrounding mesenchymal tissues are in contact, but it is absent from the glands of postnatal virgin, pregnant, and lactating mice.34,35 Thus, tenascin-C expression in pregnant transgenic mice may be a direct consequence of BM disruption and increased physical contact between epithelium and mesenchyme.28,35 Significantly, tenascin-C has been shown to inhibit the functional differentiation of mammary cells23,36 and may thus contribute to the loss of function phenotype observed in pregnant transgenic mice. The observation that the larger tenascin-C transcript was more highly expressed in transgenic glands may be significant: in other systems, the larger mRNA species encodes the 220-kd tenascin-C isoform made only by proliferating cells34 and in neoplastic human breast tissues.37 The progressively altered stroma in transgenic mice appears to trigger a maximum of discordance in epithelial-mesenchymal communications with disruption of BM and apoptosis by day 15 of pregnancy. Apoptosis in vivo was directly correlated with the disruption of BM as Boudreau et al27 have shown for cultured mammary cells. These observations indicate that inappropriate reciprocal communication took place between the two compartments in virgin and early pregnant transgenic glands.
Whereas the BM in glands of virgin mice were intact, the glands of mid-pregnant transgenic mice displayed dramatically reduced levels of type IV collagen and laminin around alveoli compared with normal glands. This diminution could be the direct effect of SL-1 transgene activity and/or a consequence of the induced expression of endogenous MMPs.
Stromal ECM is dramatically altered not only during involution, but also in mammary tumors.12,28 In tumors, this fibrosis (desmoplasia) is characterized by both qualitative and quantitative changes in collagen production.1,38 Barsky et al39 have proposed that tumor cells induce the stromal fibroblasts to synthesize the surplus collagen. In the present study, the collagen content in virgin glands from transgenic animals was increased very early and persisted through all developmental stages long before any tumors were detected. Physical constraints imposed on cells by the surrounding ECM have been shown to be powerful modulators of cell function.40-42 Thus, release from this organization/orientation by an increase in collagen content may be sufficient to stimulate endothelial cell migration and may account for the increased vascularization observed in virgin glands from transgenic mice. The dramatic disruption of BM observed in glands from mid-pregnant and lactating transgenic mice could also facilitate neovascularization by liberating ECM-bound angiogenic factors such as basic fibroblast growth factor or vascular endothelial growth factor.43 Focal dissolution of ECM proteins such as laminin and type IV collagen may also promote endothelial cell attachment, migration, proliferation, and/or organization.44-46 Similar factors may contribute to the formation of a reactive stroma and increased angiogenesis characteristic of breast cancer.47,48
Our study shows that the expression of an autoactivating rat SL-1 transgene in epithelial cells triggers dynamic and progressive stromal modifications during development of the mammary glands of transgenic mice, beginning with an increase of endogenous SL-1 expression in glands from virgin mice. At this stage of development, increased SL-1 expression leads to a gain of function not only for epithelial branching and alveolar development,14 but also for endothelial morphogenesis. This, in turn, disrupts the normal stromal-epithelial homeostasis, promoting a reactive stroma normally found only during involution and in mammary gland tumors. Disturbances in the microenvironment and communication between epithelial and mesenchymal cells leads to altered functional differentiation and onset of inappropriate apoptosis. These changes may then become the basis for the prevalence of mammary gland pathologies, including hyperplasia and neoplasia, subsequently found in these animals as they age (manuscript in preparation). SL-1 displays increased expression in breast tumors and has been cloned a number of times as a metastasis-specific gene.49 Ectopic expression of an autoactivating rat SL-1 transgene in the mammary gland of control mice leads to formation of preneoplastic lesions and invasive breast tumors later in the life of the animal.16 Inhibition of SL-1 prevents ECM invasion of mammary tumor cells,22 and its overexpression in functionally normal mammary epithelial cells in culture causes a premalignant phenotype.50 The details of molecular mechanism(s) by which the SL-1 transgene induces such dramatic changes in stromal-epithelial interactions, and the implications that this may have for tumor progression, remain to be determined.
| Acknowledgements |
|---|
| Footnotes |
|---|
Supported by the Office of Health and Environmental Research, U.S. Department of Energy (under contracts DE-AC03-76-SF00098 and DE-AC03-76-SF01012); by funds from the National Cancer Institute (CA 57621 and CA 64786), the Danish Cancer Society, and the Institut National de la Santé et de la Recherche Médicale; and by fellowships from NATO (to NT), the European Molecular Biology Organisation (to AL), and the California Breast Cancer Research Program (to AL).
Nicole Thomasset's present address is INSERM U 433, Faculté Laennec, Lyon, France.
André Lochter's present address is Center for Clinical and Basic Research, Ballerup, Denmark.
Carolyn J. Sympson's present address is Immunology Department, Searle Research and Development, Monsanto Company, Chesterfield, MO.
Leif R. Lund's present address is Finsen Laboratory, Rigshospitalet, Copenhagen, Denmark.
Accepted for publication May 9, 1998.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
D. C. Radisky and J. A. Przybylo Matrix Metalloproteinase-induced Fibrosis and Malignancy in Breast and Lung Proceedings of the ATS, April 15, 2008; 5(3): 316 - 322. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Azare, K. Leslie, H. Al-Ahmadie, W. Gerald, P. H. Weinreb, S. M. Violette, and J. Bromberg Constitutively Activated Stat3 Induces Tumorigenesis and Enhances Cell Motility of Prostate Epithelial Cells through Integrin {beta}6 Mol. Cell. Biol., June 15, 2007; 27(12): 4444 - 4453. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Bergman, J. R. Teerlink, R. Mahimkar, L. Li, B.-Q. Zhu, A. Nguyen, S. Dahi, J. S. Karliner, and D. H. Lovett Cardiac matrix metalloproteinase-2 expression independently induces marked ventricular remodeling and systolic dysfunction Am J Physiol Heart Circ Physiol, April 1, 2007; 292(4): H1847 - H1860. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Chapados, K. Abe, K. Ihida-Stansbury, D. McKean, A. T. Gates, M. Kern, S. Merklinger, J. Elliott, A. Plant, H. Shimokawa, et al. ROCK Controls Matrix Synthesis in Vascular Smooth Muscle Cells: Coupling Vasoconstriction to Vascular Remodeling Circ. Res., October 13, 2006; 99(8): 837 - 844. [Abstract] [Full Text] [PDF] |
||||
![]() |
D J Flint, M Boutinaud, C B A Whitelaw, G J Allan, and A F Kolb Prolactin inhibits cell loss and decreases matrix metalloproteinase expression in the involuting mouse mammary gland but fails to prevent cell loss in the mammary glands of mice expressing IGFBP-5 as a mammary transgene. J. Mol. Endocrinol., June 1, 2006; 36(3): 435 - 448. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. McDaniel, K. K. Rumer, S. L. Biroc, R. P. Metz, M. Singh, W. Porter, and P. Schedin Remodeling of the Mammary Microenvironment after Lactation Promotes Breast Tumor Cell Metastasis Am. J. Pathol., February 1, 2006; 168(2): 608 - 620. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. G. Gallagher, Y. Bao, A. Prorock, P. Zigrino, R. Nischt, V. Politi, C. Mauch, B. Dragulev, and J. W. Fox Gene Expression Profiling Reveals Cross-talk between Melanoma and Fibroblasts: Implications for Host-Tumor Interactions in Metastasis Cancer Res., May 15, 2005; 65(10): 4134 - 4146. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Bissell Breast cancer, MMPs, and inflammatory signals AACR Meeting Abstracts, April 1, 2005; 2005(1): 1461 - 1462. [Abstract] |
||||
![]() |
B. S. Wiseman, M. D. Sternlicht, L. R. Lund, C. M. Alexander, J. Mott, M. J. Bissell, P. Soloway, S. Itohara, and Z. Werb Site-specific inductive and inhibitory activities of MMP-2 and MMP-3 orchestrate mammary gland branching morphogenesis J. Cell Biol., September 15, 2003; 162(6): 1123 - 1133. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Solberg, J. Rinkenberger, K. Dano, Z. Werb, and L. R. Lund A functional overlap of plasminogen and MMPs regulates vascularization during placental development Development, September 15, 2003; 130(18): 4439 - 4450. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Mazzoni, A. Adam, E. Bal de Kier Joffe, and J. A. Aguirre-Ghiso Immortalized Mammary Epithelial Cells Overexpressing Protein Kinase C {gamma} Acquire a Malignant Phenotype and Become Tumorigenic in Vivo Mol. Cancer Res., August 1, 2003; 1(10): 776 - 787. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Visse and H. Nagase Matrix Metalloproteinases and Tissue Inhibitors of Metalloproteinases: Structure, Function, and Biochemistry Circ. Res., May 2, 2003; 92(8): 827 - 839. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Huang, R. Chiquet-Ehrismann, J. V. Moyano, A. Garcia-Pardo, and G. Orend Interference of Tenascin-C with Syndecan-4 Binding to Fibronectin Blocks Cell Adhesion and Stimulates Tumor Cell Proliferation Cancer Res., December 1, 2001; 61(23): 8586 - 8594. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Simian, Y. Hirai, M. Navre, Z. Werb, A. Lochter, and M. J. Bissell The interplay of matrix metalloproteinases, morphogens and growth factors is necessary for branching of mammary epithelial cells Development, August 15, 2001; 128(16): 3117 - 3131. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Bagnard, C. Vaillant, S.-T. Khuth, N. Dufay, M. Lohrum, A. W. Puschel, M.-F. Belin, J. Bolz, and N. Thomasset Semaphorin 3A-Vascular Endothelial Growth Factor-165 Balance Mediates Migration and Apoptosis of Neural Progenitor Cells by the Recruitment of Shared Receptor J. Neurosci., May 15, 2001; 21(10): 3332 - 3341. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Alexander, S. Selvarajan, J. Mudgett, and Z. Werb Stromelysin-1 Regulates Adipogenesis during Mammary Gland Involution J. Cell Biol., February 12, 2001; 152(4): 693 - 703. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-Y. Ha, H.-B. Moon, M.-S. Nam, J.-W. Lee, Z.-Y. Ryoo, T.-H. Lee, K.-K. Lee, B.-J. So, H. Sato, M. Seiki, et al. Overexpression of Membrane-type Matrix Metalloproteinase-1 Gene Induces Mammary Gland Abnormalities and Adenocarcinoma in Transgenic Mice Cancer Res., February 1, 2001; 61(3): 984 - 990. [Abstract] [Full Text] |
||||
![]() |
D. Wolf, R. Hallmann, G. Sass, M. Sixt, S. Kusters, B. Fregien, C. Trautwein, and G. Tiegs TNF-{{alpha}}-Induced Expression of Adhesion Molecules in the Liver Is Under the Control of TNFR1--Relevance for Concanavalin A-Induced Hepatitis J. Immunol., January 15, 2001; 166(2): 1300 - 1307. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Forni, P. L. Lollini, P. Musiani, and M. P. Colombo Immunoprevention of Cancer: Is the Time Ripe? Cancer Res., May 1, 2000; 60(10): 2571 - 2575. [Abstract] [Full Text] |
||||
![]() |
H.-M. Chen, K. L. Schmeichel, I. S. Mian, S. Lelièvre, O. W. Petersen, and M. J. Bissell AZU-1: A Candidate Breast Tumor Suppressor and Biomarker for Tumor Progression Mol. Biol. Cell, April 1, 2000; 11(4): 1357 - 1367. [Abstract] [Full Text] |
||||
![]() |
L. Lund, S. Bjorn, M. Sternlicht, B. Nielsen, H Solberg, P. Usher, R Osterby, I. Christensen, R. Stephens, T. Bugge, et al. Lactational competence and involution of the mouse mammary gland require plasminogen Development, January 10, 2000; 127(20): 4481 - 4492. [Abstract] [PDF] |
||||
![]() |
P Pujuguet, M Simian, J Liaw, R Timpl, Z Werb, and M. Bissell Nidogen-1 regulates laminin-1-dependent mammary-specific gene expression J. Cell Sci., January 3, 2000; 113(5): 849 - 858. [Abstract] [PDF] |
||||
![]() |
Y. S. Kanwar, K. Ota, Q. Yang, J. Wada, N. Kashihara, Y. Tian, and E. I. Wallner Role of membrane-type matrix metalloproteinase 1 (MT-1-MMP), MMP-2, and its inhibitor in nephrogenesis Am J Physiol Renal Physiol, December 1, 1999; 277(6): F934 - F947. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Vaillant, M. Didier-Bazes, A. Hutter, M.-F. Belin, and N. Thomasset Spatiotemporal Expression Patterns of Metalloproteinases and Their Inhibitors in the Postnatal Developing Rat Cerebellum J. Neurosci., June 15, 1999; 19(12): 4994 - 5004. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |