| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Department of Obstetrics and Gynecology,*
Northwestern University Medical School, Department of Medicine,
Division of Infectious Diseases, Northwestern University Medical
School, Chicago, Illinois; Department of
Immunology/Microbiology,
Rush Medical College,
Chicago, Illinois; Department of Immunology, Microbiology,
Pathology, and Infectious Diseases,
Karolinska Institute, Huddinge University Hospital, Huddinge, Sweden;
and Department of Medicine,§
Division of
Infectious Diseases, Northwestern University Medical School,
Chicago, Illinois
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Specific variants of HIV-1, non-syncytium-inducing, macrophage-tropic isolates, have been postulated to be the major sexually transmitted variants.7 The second requirement for infection involves the expression of specific co-receptors on host cell types that express CD4.8-13 The chemokine receptor CCR5 is the predominant receptor for macrophage-tropic isolates. It has previously been shown that the regulation of CCR5 expression is influenced by type 1 cytokine (eg, interleukin (IL)-2) activity and inflammatory responses in general. In addition, cells infiltrating inflammatory sites maintain the capacity to express other types of chemokine receptors (eg, CXCR4, CCR3, or CCR2b) that may serve as HIV co-receptors.
Thus, susceptibility to sexual transmission of HIV-1 undoubtedly involves features associated with both the virus and the local state of immune activation. Because of the invasive procedures involved, studying the female genital tract mucosa has been difficult in humans. Animal studies involving macaques have yielded abundant information on the early events of simian immunodeficiency virus (SIV) transmission, including the elucidation of Langerhans' cells as the major infectable cell type immediately after inoculation.14 Studies in macaques have also shown that progesterone increases susceptibility to intravaginal SIV challenge by undetermined mechanisms.15 Because infection with SIV may be mediated by receptors other than CCR5 and CXCR4,16 the purpose of this study was to examine factors influencing the expression and regulation of HIV-1 co-receptors in human tissue.
Here, using immunological and extremely sensitive molecular methods, we report on the expression and localization of macrophage-tropic8-10 (CCR5 and CCR3), dual-tropic11,12 (CCR2b and US28), and T-cell-tropic13 (CXCR4) HIV co-receptors in the female genital tract. Our findings show distinct patterns of chemokine receptor expression in the cervix compared with peripheral blood. The pattern of chemokine receptor expression in the cervix is influenced by infiltrates of cells expressing various chemokine receptors and microbial as well as hormonal factors that affect the local state of immune activation.
| Materials and Methods |
|---|
|
|
|---|
Patients were enrolled in this study from the Northwestern
Memorial Hospital Outpatient Clinic and the Prentice Women's Hospital
Ambulatory Care Clinic. All women were in the preovulatory phase of
their menstrual cycles at the time of biopsy, except one woman, who was
postmenopausal. Informed consent was obtained from all patients.
Cervical biopsies were obtained from the superior portion of the
ectocervix using biopsy forceps. Peripheral blood (16 ml) was drawn in
acid citrate dextrose tubes. Patients 1 to 4 and 6 were undergoing
routine examinations, patients 5 and 8 to 12 were undergoing diagnostic
procedures, and patient 7 was undergoing a hysterectomy. The clinical
history of all patients in this study is shown in Table 1
.
|
Peripheral blood mononuclear cells (PBMCs) from homozygous wild-type (wt) CCR5 volunteers were isolated on a Ficoll-Hypaque gradient. PBMCs (2 x 106 cells) were immediately placed in TriReagent (Molecular Research Center, Cincinnati, OH) for RNA extraction as per the manufacturer's protocol or cultured in RPMI 1640 supplemented with 2 mmol/L L-glutamine 10% fetal bovine serum, 10 mmol/L HEPES, and penicillin/streptomycin. PBMCs were incubated with 50 ng/ml progesterone (Sigma Chemical Co., St. Louis, MO) for up to 6 days.
Tissue and Cell Preparation
Tissue samples from uterine ectocervix were trisected and either homogenized for RNA extraction, snap frozen in ornithine carbamoyltransferase embedding compound or fixed in Streck Tissue Fixative17-19 (Streck Laboratories, Omaha, NE). RNA was extracted from biopsy specimens by homogenizing fresh biopsies of 5 mm3 in 500 µl TriReagent using diethyl pyrocarbonate-treated, autoclaved, disposable homogenizers. After homogenization, RNA was purified as per the manufacturer's protocol. RNA pellets were resuspended in 1x transcription buffer (Promega, Madison, WI) with 2 units RQ1 RNase-free DNase (Promega, Madison, WI) and incubated for 30 minutes at 37°C to remove contaminating DNA. The mixture was extracted once with phenol:chloroform:isoamyl alcohol and once with chloroform:isoamyl alcohol. The aqueous layer was removed, and the RNA was precipitated in 3 volumes ethanol and 1/40 volume 3 mol/L sodium acetate overnight at -20°C.
Immunohistochemistry/Image Analysis
Tissue sections were cut to 5 µm, adhered to silanized slides, and deparaffinized through xylenes and graded alcohols. After peroxidase quenching and blocking with mouse serum in phosphate-buffered saline, pH 7.4, with 5% nonfat dry skim milk, immunohistochemistry was performed using the Vectastain ABC-HP kit (Vector Laboratories, Burlingame, CA) as per the manufacturer's recommendations. Diaminobenzidine was used as substrate with hematoxylin counterstain. Frozen tissue sections for quantitative image analysis were allowed to air dry for 5 minutes, followed by postfixation in cold acetone for 20 minutes or 2% formaldehyde for 15 minutes. Sections were washed in phosphate-buffered saline, and an optimized dilution of primary antibody was applied. Cytokine and chemokine expression was quantified using assisted computerized image analysis as previously described.20 IL-2-producing cells were identified by a juxtanuclear focal staining pattern surrounded by extracellular immune reactivity caused by adherence of cytokines to matrix proteins. Commercially available antibodies to CD4, CD45RO, CD68, S-100, IL-2, IL-4, and IL-10 (PharMingen, San Diego, CA) were used at concentrations optimized on control tissues.
Immunofluorescence/Flow Cytometry
After the appropriate incubation with progesterone, cells were pretreated with 0.5 mmol/L EDTA three times for 10 minutes each to remove adherent cells. Cells were washed three times with phosphate-buffered saline, pH 7.4/0.5% bovine serum albumin. Cells were then treated with 1 µg human immunoglobulin IgG/1 x 105 cells for 15 minutes at room temperature. Cells were stained with anti-CD4-fluorescein isothiocyanate or anti-CD14-fluorescein isothiocyanate (Becton Dickinson Immunochemistry Systems, San Jose, CA) and anti-CCR5-phycoerythrin or anti-CXCR4-phycoerythrin (PharMingen, San Diego, CA) for 30 minutes at room temperature, washed in phosphate-buffered saline, pH 7.4/0.5% bovine serum albumin, and fixed in 2% formaldehyde. Analysis was performed on a FACSCalibur flow cytometer using Cell Quest software.
CCR5 Genotyping
Total DNA was prepared by adding 400 µl of cell lysis buffer/200 µg/ml proteinase K to 1 x 106 cells from peripheral blood. The mixture was incubated at 58°C for 2 hours followed by extraction in 25:24:1 phenol:chloroform:isoamyl alcohol. The aqueous layer was recovered, and DNA was precipitated by the addition of 3 volumes of ethanol and 1/40 volume sodium acetate. DNA polymerase chain reaction (PCR) was performed by adding 45 µl reaction mix (1x PCR buffer (PEG> Applied Biosystems, Foster City, CA), 4.0 mmol/L MgCl2, 200 µmol/L dATP, 200 µmol/L dCTP, 200 µmol/L dGTP, 200 µmol/L dTTP, 200 nmol/L upstream CCR5 primer (TGTTTGCGTCTCTCCCAGGA), and 200 nmol/L CCR5 downstream primer (TGAAGATAAGCCTCACAGCCCT)) to approximately 500 ng DNA. The amplified product was resolved on a 2% metephor gel (FMC Bioproducts, Rockland, ME).
Chemokine Receptor mRNA Quantification
Quantitative kinetic reverse transcription-PCR was performed by
adding 45 µl of reaction mix (1x RT Taqman EZ buffer (PE Applied
Biosystems, Foster City, CA), 4.0 mmol/L Mn(O)Ac2, 300
µmol/L dATP, 300 µmol/L dCTP, 300 µmol/L dGTP, 300 µmol/L dTTP,
200 nmol/L upstream primer, 200 nmol/L downstream primer, 200 nmol/L
internally conserved fluorogenic probes, and 10 units
rTth polymerase) directly to 100 ng of total RNA in
5 µl RNase, DNase free water (Ambion, Austin, TX). Input RNA
was normalized using glyceraldehyde-3-phosphate dehydrogenase mRNA
quantification (PE Applied Biosystems). Reverse transcription and
thermal amplification were performed using the following linked
profile: reverse transcription, 30 minutes at 60°C; cDNA
denaturation, 5 minutes at 95°C; 40 cycles of denaturation (95°C
for 15 seconds); and annealing/extension (60°C for 1 minute) in a
7700 sequence detection system (PE Applied Biosystems). Duplicate
standard curves with copy number controls ranging from 10 to
105 copies were run with each optical 96-well plate (PE
Applied Biosystems). In addition, no template controls were included
with each plate. We assessed the efficiency of amplification and the
linearity of the assay by plotting the threshold cycle number, the
cycle number at which the fluorescence signal exceeds background,
versus the log target copy number (Figure 1)
. To exclude potential signal due to
plasmid DNA in the copy number standards, or to genomic DNA in the
patient samples, we performed duplicate experiments with Taq
polymerase rather than rTth polymerase. These experiments
revealed a lack of amplification signal due to contaminating chemokine
receptor DNA (data not shown). Amplification of heterologous
transcripts or squamous cell RNA known to be negative for chemokine
receptors revealed a lack of amplification signal. Amplification of RNA
from a homozygous
32 CCR5 individual also revealed a lack of wt CCR5
amplification signal.
|
The primers and their respective probes used were as follows: wt CCR5, 5'-TGTTTGCGTCTCTCCCAGGA-3' and 5'-TGAAGATAAGCCTCACAGCCCT-3' (probe, 5'-FAM-CAGTCAGTATCAATTCTGGAAGAATTTCCAGACAT-TAMRA-3'); CXCR4, 5'-TATGACTCCATGAAGGAACCCTGT-3' and 5'-AGCCTGTACTTGTCCGTCATGC-3' (probe, 5'-FAM-TCC TGCCCACCATCTACTCCATCATC-TAMRA-3'); CCR3, 5'-AAAGCTGATACCAGAGCACTGATGG-3' and 5'-GTTGGTCATAATTCGGAGCCTCC-3' (probe, 5'-FAM-TTCACTGTGGGCCTCTTGGGCAAT-TAMRA-3'); CCR2b, 5'-CCTGTAAAGCAGGTGCCCAA-3' and 5'-AGAGTCAAAGTCTCTACCCACAGTTTTT-3' (probe, 5'-FAM-CCAATGCATATCCAACATGTGCTCAG-TAMRA-3'); US28, 5'-GACTCCCTGTGTCCTCACCG-3' and 5'-CCAAGAAGTTGCCGATGGAA-3' (probe, 5'-FAM-ACGTTGTTTCTGTACGGCGTTGTCTTTC-TAMRA-3'); IL-2, 5'-CCACAATATGCTATTCACATGTTCAGT-3' and 5'-CAATTAACGCCTTCTGTATGAAACAG-3' (probe, 5'-FAM-TTTCTGAGTTACTTTTGTATCCCCACCC-TAMRA-3'); IL-4, 5'-CTGTTCCCTGTGAGCTGCCT-3' and 5'-GTATAGTTATCCGCACTGACCACG-3' (probe, 5'-FAM-AGCTGGTTTTTCTGCTCTCCGAAGCC-TAMRA-3'); and IL-10, 5'-CCCAAGTATAGCTGAACCTTCCAA-3' and 5'-TGTGGATGCCTGCTGTGTG-3' (probe, 5'- FAM-CACGTAGGGTTGCAGGTTTCCTAGTGAG-TAMRA-3').
Statistical Analysis
Comparisons between samples were performed using the Student's t-test. Comparisons yielding a P < 0.05 were considered significant.
| Results |
|---|
|
|
|---|
To quantify the expression of chemokine receptor mRNA in
peripheral blood and biopsies from the female genital tract, we
extracted and purified RNA and DNA from 12 women. Seven
HIV-seronegative and five HIV-seropositive women with or without STDs,
GUD, and progesterone predominance were evaluated using these
techniques (Table 1)
. To control for variable levels of wt and
32
CCR5 allelic expression in heterozygotes relative to homozygous wt
individuals (manuscript in preparation), we selected women with a
homozygous wt CCR5 genotype. Using 10,000 copies of
glyceraldehyde-3-phosphate dehydrogenase mRNA (~100 cells) in each
replicate, at least duplicate determinations of chemokine receptor mRNA
levels were performed (Table 2)
. The
level of CCR5 mRNA in the cervix was significantly greater than CXCR4,
CCR3, CCR2b, and US28 (P < 0.001) regardless of
the clinical state of the patient (Table 2
, Figure 2
). Levels of CCR5 mRNA in biopsies with
increased inflammation (Table 2
, patients 5 to 12) were significantly
increased compared with levels in biopsies without increased
inflammation (Table 2
, patients 1 to 4) (P <
0.02). Levels of CCR5 were also increased in biopsies from
progesterone-predominant women (Table 2
, patients 6 and 7) relative to
premenopausal, exogenous progesterone-naïve women (Table 2
,
patients 1 to 4). Immunohistochemistry using monoclonal antibodies was
performed to localize and quantify CXCR4 and CCR5 protein-expressing
cells and to confirm the relative expression levels of CXCR4 and CCR5
determined by quantitative reverse transcription-PCR (Figure 3)
. We found an 8-fold greater CCR5
protein expression level compared with CXCR4 (P
< 0.02). The 8-fold difference in protein expression approximates the
10-fold difference in mRNA expression. Double-label immunofluorescence
staining revealed that all cells expressing CCR5 or CXCR4 co-expressed
CD4 in the biopsies studied (Figure 4)
.
|
|
|
|
Quantification of Immune Cells in the Cervical Mucosa
Increases in chemokine receptor expression in a particular tissue can be attributed to an increase in the number of cells expressing a particular chemokine receptor, up-regulation of chemokine receptors in cells present in a particular tissue, or both. To determine whether increases in the number of cells known to express specific chemokine receptors contributed to the repertoire of chemokine receptor expression, we characterized the immune cells present in the ectocervix of women with normal, proinflammatory, and progesterone-predominant conditions.
Using immunohistochemistry and assisted computerized image
analysis,20
we quantified the number of cells known to
express CCR5 (CD4+ and CD45RO+ T cells,
CD68+ macrophages, and S-100+ Langerhans'
cells), CXCR4 (CD4+ and CD45RA+ T cells and
CD68+ macrophages), CCR3 (CD4+ T cells,
CD68+ macrophages, eosinophils, and basophils), CCR2b
(CD68+ macrophages, natural killer cells), or US28
(CD4+ T cells and monocytes/macrophages) (Table 3)
. Langerhans' cells, macrophages, and
lymphocytes were evenly distributed in low quantities throughout the
submucosa in four healthy controls such as patient 1 (Table 3
, Figure 5
) and were rarely found in the
epithelium. Dramatic yet heterogeneous increases in cellular
infiltrates were seen in biopsies from women with GUD, progesterone
predominance, or genital tract infections. The woman with noninfectious
GUD (patient 5, Table 3
, Figure 5
) had a moderate increase in
macrophages and CD45RO+ T cells with a CD4/CD8 ratio of
4.9. In patients 6 and 7, an increase in CD45RO+ T cells
and macrophages was observed in the progesterone-predominant biopsies.
Women with human papillomavirus (HPV) or herpes simplex virus and HIV,
such as patient 8 (Table 3
, Figure 5
), had profound increases in
CD45RO+ T cells and macrophages. Despite the presence of
inflammatory conditions, neither the intensity of CD4 cell surface
staining nor the number of Langerhans' cells changed in the women
studied.
|
|
To determine whether increased expression of cytokines involved in
the mucosal immune response contributed to the pattern of chemokine
receptor expression in our biopsies, we quantified the expression
levels of IL-2, IL-4, and IL-10 using quantitative, kinetic reverse
transcription-PCR and immunohistochemistry/assisted computerized image
analysis. The type 1 cytokine IL-2 mRNA was up-regulated, whereas the
type 2 cytokines IL-4 and IL-10 were below the limits of detection (10
mRNA copies) in biopsies from patients with STDs (Table 4
, Figure 6
). To confirm the quantification and to
localize the source of IL-2 up-regulation, we stained tissue sections
with monoclonal antibodies against IL-2, IL-4, and IL-10. As might be
expected, biopsies (Table 3
, patients 1 to 4) devoid of increased
inflammatory cell infiltrates were negative for IL-2, as well as IL-4
and IL-10. Biopsies from women such as patients 8 and 9 (Figure 6)
with
the most inflammation and the highest level of CCR5 mRNA expression
(Table 3
, patients 8 to 12) exhibited numerous cells in the epithelium
and submucosa expressing IL-2 but lacked cells expressing IL-4 and
IL-10. Biopsies from patients 6 and 7 revealed high levels of CCR5
expression in the absence of up-regulated IL-2.
|
|
To determine the direct effects of progesterone on chemokine
receptor expression at the cellular level, we incubated PBMCs with 50
ng/ml progesterone for 6 days. At time 0, 3 days, and 6 days of
culture, we extracted total RNA for CCR5, CXCR4, CCR3, and CCR2b mRNA
quantification (Figure 7A)
. In addition,
we performed flow cytometry on PBMCs from the same time points to
localize increases of CCR5 and CXCR4 to specific cell types. Molecular
and immunophenotypic analysis revealed 5- to 10-fold increases in CCR5,
CXCR4, and CCR3 expression that peaked after 3 days of culture. Levels
of CCR2b mRNA in PBMCs decreased after progesterone treatment. The
increase in CCR5 after progesterone treatment was detected exclusively
in CD14+ monocytes (Figure 7B)
, whereas increased CXCR4
expression was detected equally in lymphocytes (CD4+ or
CD8+) and CD14+ monocytes. The increase in
CCR5/CXCR4 expression peaked at 3 days and remained elevated or
slightly diminished by day 6 (data not shown).
|
| Discussion |
|---|
|
|
|---|
Significant increases in CD4+ and CD45RO+ T lymphocytes were found in all biopsies with increased CCR5 expression. With one exception, the increase of CCR5 expression was also associated with increased numbers of CD68+ macrophages. Our data support previous animal studies on lymphocyte recirculation that demonstrated memory T cells (CD45RO+ and CCR5+) migrating to peripheral tissues, whereas naïve T cells (CD45RA+ and CXCR4+) use a recirculation pathway that bypasses tissues.25 The significant difference in CCR5 and CXCR4 expression in these cervical biopsies must be due to either increases in CD4+ and CD45RO+ T cells that differentially express more CCR5 than CXCR4,26 or factors that preferentially up-regulate CCR5 expression. Monocytes and Langerhans' cells express both CCR5 and CXCR4, so increases in these cell types would be expected to increase both CCR5 and CXCR4, although blocks in CXCR4 cell surface expression have been shown in Langerhans' cells.27 Langerhans' cells, however, were not increased in any of the biopsies, raising the issue of their role in the increased HIV-1 susceptibility in women with STDs.
The first line of defense against HIV transmission in the female genital tract is the vaginal fluid and the cervical mucus.22 A recent study has identified increased levels of HIV-1 env-specific immunoglobulin A in cervicovaginal fluid from HIV-exposed, uninfected partners of HIV-infected men.28 Cervical mucus itself has been proposed to provide a physical barrier preventing HIV-1 from contacting the mucosal surface.22 The second layer of defense is the vaginal and cervical epithelium. Breaches in this physical barrier have been suggested to increase the risk of HIV transmission.15 This is not surprising in view of our data from the patient with noninfectious GUD. The base of the ulcer was lined by CD4+ and CD45RO+ T lymphocytes and macrophages, cell types that co-express CD4 and CCR5. The impact of oral contraceptives on genital-tract CCR5 expression in this patient, however, was not examined.
Studies have demonstrated an increased rate of HIV infection in women
>45 years of age.29
Progesterone, the predominant hormone
in menopause, has been shown to enhance SIV transmission presumably by
allowing more virions to move through the thinned
epithelium.15
In our study, a significantly increased level
of CCR5 expression was found in cervical biopsies from
progesterone-predominant women. In addition to epithelium only five to
seven cells thick, immunohistochemical analysis revealed increased
CD4+ and CD45RO+ T cells and macrophages
localized to the epithelial-submucosa junction in cervical samples with
immune activation (see Figure 3
). In vitro stimulation of
peripheral blood mononuclear cells with concentrations of progesterone
known to increase female genital tract transmission of SIV in macaques
revealed a 5- to 10-fold up-regulation of CCR5 in CD14+
monocytes/macrophages and 5-fold increase of CXCR4 expression in
CD4+ lymphocytes and CD14+
monocytes/macrophages. The lack of CD4+ and
CD45RA+ T cells, which predominantly express CXCR4, in
tissue may explain why CXCR4 mRNA was higher in PBMCs when compared
with cervical tissue (Table 2)
. These data also suggest that CCR5 and
CXCR4 have promoter regulatory elements responsive to the
glucocorticoid/progesterone receptor pathway.30
Progesterone-containing oral contraceptives have been shown, depending
on the study, to either increase or decrease the risk of sexual
transmission.15,31
Further study is necessary to determine
whether estrogen enhances or diminishes the effects of progesterone on
chemokine receptor expression.
The last defense against HIV transmission in the female genital tract
is the mucosal immune system. The immune system in the female genital
tract consists of an inductive arm and an effector arm.31
Pathogens encounter the inductive arm, during which time phagocytosis
occurs and antigen is processed. During an immune response in the
female genital tract, antigen is presented by mucosal macrophages and
Langerhans' cells.32
These antigen-presenting cells
migrate via afferent lymphatics to draining lymph nodes, where they
stimulate B and T lymphocytes. Activated lymphocytes reenter peripheral
blood and migrate to the female genital tract, functioning in the
effector arm of the immune response.31
We demonstrate that
CCR5 mRNA is significantly increased when the effector arm of the
cellular immune response is engaged in response to infectious and
noninfectious inflammatory conditions. Local cytokine production is a
critical correlate of an effective immune response. Preliminary data
from our laboratory34
have shown that type 1 cytokines,
such as those would predominate in cellular immune responses (IL-2,
interferon-
, and IL-12), up-regulate CCR5 and to a lessor
extent CXCR4. Type 2 cytokines (IL-4, IL-5, and IL-10), active in
humoral immune responses, up-regulate CXCR4 but not CCR5.33
In the present study, we determined that IL-2, a cytokine known to
up-regulate CCR5, is increased in biopsies from women with STDs,
whereas expression of IL-10, a cytokine known to decrease CCR5 mRNA
expression in vitro, is low in all biopsies.33
Although the contribution of genital HIV infection to this cytokine
profile is unknown, HPV infection has been associated with an increase
in IL-2 production.34
These data support at the tissue
level previous studies relating strong type 1 cytokine production and
weak type 2 cytokine production, as defined by the IL-2/IL-10 ratio,
with the presence of non-syncytium-inducing HIV-1
isolates.35
The one-log range of CCR5 expression in the genital tract of homozygous wt CCR5 women may explain the wide variation in HIV infection rates and the increase of HIV sexual transmission in women with STDs. Here, we demonstrate that chemokine receptor expression was compartmentalized in the genital tract relative to peripheral blood; therefore, therapy directed at decreasing sexual transmission through modulating or blocking chemokine receptors should be locally targeted.
| Acknowledgements |
|---|
| Footnotes |
|---|
Supported by grants from the National Cancer Institute (grant 2490), the Swedish Medical Research Council (grant 10850), the Women's Interagency HIV Study (grant 5 UO1 AI 34993-03), and the Northwestern Comprehensive AIDS Center.
Accepted for publication May 20, 1998.
| References |
|---|
|
|
|---|
, MIP-1ß receptor as a fusion cofactor for macrophage-tropic HIV-1. Science 1996, 272:1955-1958[Abstract]
This article has been cited by other articles:
![]() |
B. Etemad, A. Fellows, B. Kwambana, A. Kamat, Y. Feng, S. Lee, and M. Sagar Human Immunodeficiency Virus Type 1 V1-to-V5 Envelope Variants from the Chronic Phase of Infection Use CCR5 and Fuse More Efficiently than Those from Early after Infection J. Virol., October 1, 2009; 83(19): 9694 - 9708. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Isaacman-Beck, E. A. Hermann, Y. Yi, S. J. Ratcliffe, J. Mulenga, S. Allen, E. Hunter, C. A. Derdeyn, and R. G. Collman Heterosexual Transmission of Human Immunodeficiency Virus Type 1 Subtype C: Macrophage Tropism, Alternative Coreceptor Use, and the Molecular Anatomy of CCR5 Utilization J. Virol., August 15, 2009; 83(16): 8208 - 8220. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Sheffield, G. D. Wendel Jr, D. D. McIntire, and M. V. Norgard The Effect of Progesterone Levels and Pregnancy on HIV-1 Coreceptor Expression Reproductive Sciences, January 1, 2009; 16(1): 20 - 31. [Abstract] [PDF] |
||||
![]() |
L.A. Bergmeier and T. Lehner Innate and Adaptive Mucosal Immunity in Protection against HIV Infection Advances in Dental Research, April 1, 2006; 19(1): 21 - 28. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.C. Herzberg, A. Weinberg, and S.M. Wahl (C3) The Oral Epithelial Cell and First Encounters with HIV-1 Advances in Dental Research, April 1, 2006; 19(1): 158 - 166. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Venkataraman, A. L. Cole, P. Svoboda, J. Pohl, and A. M. Cole Cationic Polypeptides Are Required for Anti-HIV-1 Activity of Human Vaginal Fluid J. Immunol., December 1, 2005; 175(11): 7560 - 7567. [Abstract] [Full Text] [PDF] |
||||
![]() |
A M Minnis and N S Padian Effectiveness of female controlled barrier methods in preventing sexually transmitted infections and HIV: current evidence and future research directions Sex Transm Inf, June 1, 2005; 81(3): 193 - 200. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Laverdiere, B. H. Hoang, R. Yang, R. Sowers, J. Qin, P. A. Meyers, A. G. Huvos, J. H. Healey, and R. Gorlick Messenger RNA Expression Levels of CXCR4 Correlate with Metastatic Behavior and Outcome in Patients with Osteosarcoma Clin. Cancer Res., April 1, 2005; 11(7): 2561 - 2567. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Philpott, H. Burger, C. Tsoukas, B. Foley, K. Anastos, C. Kitchen, and B. Weiser Human Immunodeficiency Virus Type 1 Genomic RNA Sequences in the Female Genital Tract and Blood: Compartmentalization and Intrapatient Recombination J. Virol., January 1, 2005; 79(1): 353 - 363. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Barassi, A. Lazzarin, and L. Lopalco CCR5-specific mucosal IgA in saliva and genital fluids of HIV-exposed seronegative subjects Blood, October 1, 2004; 104(7): 2205 - 2206. [Full Text] [PDF] |
||||
![]() |
Q. Hu, I. Frank, V. Williams, J. J. Santos, P. Watts, G. E. Griffin, J. P. Moore, M. Pope, and R. J. Shattock Blockade of Attachment and Fusion Receptors Inhibits HIV-1 Infection of Human Cervical Tissue J. Exp. Med., April 19, 2004; 199(8): 1065 - 1075. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Kemal, B. Foley, H. Burger, K. Anastos, H. Minkoff, C. Kitchen, S. M. Philpott, W. Gao, E. Robison, S. Holman, et al. HIV-1 in genital tract and plasma of women: Compartmentalization of viral sequences, coreceptor usage, and glycosylation PNAS, October 28, 2003; 100(22): 12972 - 12977. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kawamura, F. O. Gulden, M. Sugaya, D. T. McNamara, D. L. Borris, M. M. Lederman, J. M. Orenstein, P. A. Zimmerman, and A. Blauvelt R5 HIV productively infects Langerhans cells, and infection levels are regulated by compound CCR5 polymorphisms PNAS, July 8, 2003; 100(14): 8401 - 8406. [Abstract] [Full Text] [PDF] |
||||
![]() |
R J DiClemente, G M Wingood, C Del Rio, and R A Crosby Prevention interventions for HIV positive individuals Sex Transm Inf, December 1, 2002; 78(6): 393 - 395. [Full Text] [PDF] |
||||
![]() |
B. K. Patterson, A. Landay, J. N. Siegel, Z. Flener, D. Pessis, A. Chaviano, and R. C. Bailey Susceptibility to Human Immunodeficiency Virus-1 Infection of Human Foreskin and Cervical Tissue Grown in Explant Culture Am. J. Pathol., September 1, 2002; 161(3): 867 - 873. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Nagase, M. Miyamasu, M. Yamaguchi, M. Imanishi, N. H. Tsuno, K. Matsushima, K. Yamamoto, Y. Morita, and K. Hirai Cytokine-mediated regulation of CXCR4 expression in human neutrophils J. Leukoc. Biol., April 1, 2002; 71(4): 711 - 717. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Clerici, S. Declich, and G. Rizzardini African Enigma: Key Player in Human Immunodeficiency Virus Pathogenesis in Developing Countries? Clin. Vaccine Immunol., September 1, 2001; 8(5): 864 - 866. [Full Text] [PDF] |
||||
![]() |
P. S. Beisser, L. Laurent, J.-L. Virelizier, and S. Michelson Human Cytomegalovirus Chemokine Receptor Gene US28 Is Transcribed in Latently Infected THP-1 Monocytes J. Virol., July 1, 2001; 75(13): 5949 - 5957. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Behbahani, E. Popek, P. Garcia, J. Andersson, A.-L. Spetz, A. Landay, Z. Flener, and B. K. Patterson Up-Regulation of CCR5 Expression in the Placenta Is Associated with Human Immunodeficiency Virus-1 Vertical Transmission Am. J. Pathol., December 1, 2000; 157(6): 1811 - 1818. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Maier, M. M. Bartolome-Rodriguez, C. Moulon, H. U. Weltzien, and A. Meyerhans Kinetics of CXCR4 and CCR5 up-regulation and human immunodeficiency virus expansion after antigenic stimulation of primary CD4+ T lymphocytes Blood, September 1, 2000; 96(5): 1853 - 1856. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Greenhead, P. Hayes, P. S. Watts, K. G. Laing, G. E. Griffin, and R. J. Shattock Parameters of Human Immunodeficiency Virus Infection of Human Cervical Tissue and Inhibition by Vaginal Virucides J. Virol., June 15, 2000; 74(12): 5577 - 5586. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Mackewicz, B. K. Patterson, S. A. Lee, and J. A. Levy CD8+ cell noncytotoxic anti-human immunodeficiency virus response inhibits expression of viral RNA but not reverse transcription or provirus integration J. Gen. Virol., May 1, 2000; 81(5): 1261 - 1264. [Abstract] [Full Text] |
||||
![]() |
R. Kaul, F. A. Plummer, J. Kimani, T. Dong, P. Kiama, T. Rostron, E. Njagi, K. S. MacDonald, J. J. Bwayo, A. J. McMichael, et al. HIV-1-Specific Mucosal CD8+ Lymphocyte Responses in the Cervix of HIV-1-Resistant Prostitutes in Nairobi J. Immunol., February 1, 2000; 164(3): 1602 - 1611. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Schramm, M. L. Penn, R. F. Speck, S. Y. Chan, E. De Clercq, D. Schols, R. I. Connor, and M. A. Goldsmith Viral Entry through CXCR4 Is a Pathogenic Factor and Therapeutic Target in Human Immunodeficiency Virus Type 1 Disease J. Virol., January 1, 2000; 74(1): 184 - 192. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. G. Kostrikis, A. U. Neumann, B. Thomson, B. T. Korber, P. McHardy, R. Karanicolas, L. Deutsch, Y. Huang, J. F. Lew, K. McIntosh, et al. A Polymorphism in the Regulatory Region of the CC-Chemokine Receptor 5 Gene Influences Perinatal Transmission of Human Immunodeficiency Virus Type 1 to African-American Infants J. Virol., December 1, 1999; 73(12): 10264 - 10271. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. B. Urnovitz, J. C. Sturge, T. D. Gottfried, and W. H. Murphy Urine Antibody Tests: New Insights into the Dynamics of HIV-1 Infection Clin. Chem., September 1, 1999; 45(9): 1602 - 1613. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-L. Spetz, B. K. Patterson, K. Lore, J. Andersson, and L. Holmgren Functional Gene Transfer of HIV DNA by an HIV Receptor-Independent Mechanism J. Immunol., July 15, 1999; 163(2): 736 - 742. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Vassiliadou, L. Tucker, and D. J. Anderson Progesterone-Induced Inhibition of Chemokine Receptor Expression on Peripheral Blood Mononuclear Cells Correlates with Reduced HIV-1 Infectability In Vitro J. Immunol., June 15, 1999; 162(12): 7510 - 7518. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-j. Zhang and J. P. Moore Will Multiple Coreceptors Need To Be Targeted by Inhibitors of Human Immunodeficiency Virus Type 1 Entry? J. Virol., April 1, 1999; 73(4): 3443 - 3448. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |