help button home button Am J Pathol R & D Systems
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Patterson, B. K.
Right arrow Articles by Garcia, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Patterson, B. K.
Right arrow Articles by Garcia, P.
(American Journal of Pathology. 1998;153:481-490.)
© 1998 American Society for Investigative Pathology


Regular Articles

Repertoire of Chemokine Receptor Expression in the Female Genital Tract

Implications for Human Immunodeficiency Virus Transmission

Bruce K. Patterson* , Alan Landay{dagger} , Jan Andersson{ddagger} , Clark Brown§ , Homira Behbahani{ddagger} , Dan Jiyamapa* , Zareefa Burki* , Donna Stanislawski* , Mary Ann Czerniewski{dagger} and Patricia Garcia*

From the Department of Obstetrics and Gynecology,* Northwestern University Medical School, Department of Medicine, Division of Infectious Diseases, Northwestern University Medical School, Chicago, Illinois; Department of Immunology/Microbiology,{dagger} Rush Medical College, Chicago, Illinois; Department of Immunology, Microbiology, Pathology, and Infectious Diseases,{ddagger} Karolinska Institute, Huddinge University Hospital, Huddinge, Sweden; and Department of Medicine,§ Division of Infectious Diseases, Northwestern University Medical School, Chicago, Illinois


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Sexually transmitted diseases, genital ulcer disease, and progesterone therapy increase susceptibility to lentivirus transmission. Infection of cells by human immunodeficiency virus (HIV) is dependent on expression of specific chemokine receptors known to function as HIV co-receptors. Quantitative kinetic reverse transcription-polymerase chain reaction was developed to determine the in vivo expression levels of CCR5, CXCR4, CCR3, CCR2b, and the cytomegalovirus-encoded US28 in peripheral blood mononuclear cells and cervical biopsies from 12 women with and without sexually transmitted diseases, genital ulcer disease, and progesterone-predominant conditions. Our data indicate that CCR5 is the major HIV co-receptor expressed in the female genital tract, and CXCR4 is the predominantly expressed HIV co-receptor in peripheral blood. CCR5 mRNA expression in the ectocervix was 10-fold greater than CXCR4, 20-fold greater than CCR2b, and 100-fold greater than CCR3. In peripheral blood, CXCR4 expression was 1.5-fold greater than CCR5, 10-fold greater than CCR2b, and 15-fold greater than CCR3. US28 was not expressed in cervical tissue despite expression in peripheral blood mononuclear cells from five individuals. CCR5 was significantly increased (p < 0.02) in biopsies from women with sexually transmitted diseases and others who were progesterone predominant. In vitro studies demonstrate that progesterone increases CCR5, CXCR4, and CCR3 expression and decreases CCR2b expression in lymphocytes and monocytes/macrophages. Characterization of chemokine receptors at the tissue level provides important information in identifying host determinants of HIV-1 transmission.



    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The susceptibility to sexual transmission of human immunodeficiency virus (HIV)-1 is extremely variable as infection by HIV-1 may occur after a single or a few exposures,1 or not at all, even after multiple high-risk exposures.2 In addition, many studies have noted a gender imbalance for heterosexual HIV transmission that places women at greater risk for acquisition from infected male partners.3,4 Aside from gender, other factors may increase susceptibility to HIV-1 infection. The most convincing factors associated with enhancing HIV-1 transmission are co-infection with sexually transmitted diseases (STDs) or genital ulcer disease (GUD). The synergy between STDs, GUD, and HIV-1 has been described from an epidemiological and behavioral perspective.5,6 The cellular mechanism by which STDs and GUD facilitate HIV-1 transmission, however, has not been well characterized. Similarly, the role of endogenous or exogenous hormonal influences in increasing or decreasing susceptibility to HIV infection has not been determined. STDs, GUD, and hormonal influences may increase the number of target cells present, increase immune activation, or increase expression of cell type-specific chemokine receptors, co-receptors that are necessary for HIV-1 infection.

Specific variants of HIV-1, non-syncytium-inducing, macrophage-tropic isolates, have been postulated to be the major sexually transmitted variants.7 The second requirement for infection involves the expression of specific co-receptors on host cell types that express CD4.8-13 The chemokine receptor CCR5 is the predominant receptor for macrophage-tropic isolates. It has previously been shown that the regulation of CCR5 expression is influenced by type 1 cytokine (eg, interleukin (IL)-2) activity and inflammatory responses in general. In addition, cells infiltrating inflammatory sites maintain the capacity to express other types of chemokine receptors (eg, CXCR4, CCR3, or CCR2b) that may serve as HIV co-receptors.

Thus, susceptibility to sexual transmission of HIV-1 undoubtedly involves features associated with both the virus and the local state of immune activation. Because of the invasive procedures involved, studying the female genital tract mucosa has been difficult in humans. Animal studies involving macaques have yielded abundant information on the early events of simian immunodeficiency virus (SIV) transmission, including the elucidation of Langerhans' cells as the major infectable cell type immediately after inoculation.14 Studies in macaques have also shown that progesterone increases susceptibility to intravaginal SIV challenge by undetermined mechanisms.15 Because infection with SIV may be mediated by receptors other than CCR5 and CXCR4,16 the purpose of this study was to examine factors influencing the expression and regulation of HIV-1 co-receptors in human tissue.

Here, using immunological and extremely sensitive molecular methods, we report on the expression and localization of macrophage-tropic8-10 (CCR5 and CCR3), dual-tropic11,12 (CCR2b and US28), and T-cell-tropic13 (CXCR4) HIV co-receptors in the female genital tract. Our findings show distinct patterns of chemokine receptor expression in the cervix compared with peripheral blood. The pattern of chemokine receptor expression in the cervix is influenced by infiltrates of cells expressing various chemokine receptors and microbial as well as hormonal factors that affect the local state of immune activation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Patients

Patients were enrolled in this study from the Northwestern Memorial Hospital Outpatient Clinic and the Prentice Women's Hospital Ambulatory Care Clinic. All women were in the preovulatory phase of their menstrual cycles at the time of biopsy, except one woman, who was postmenopausal. Informed consent was obtained from all patients. Cervical biopsies were obtained from the superior portion of the ectocervix using biopsy forceps. Peripheral blood (16 ml) was drawn in acid citrate dextrose tubes. Patients 1 to 4 and 6 were undergoing routine examinations, patients 5 and 8 to 12 were undergoing diagnostic procedures, and patient 7 was undergoing a hysterectomy. The clinical history of all patients in this study is shown in Table 1 .


View this table:
[in this window]
[in a new window]
 
Table 1. Clinical History of Patients in the Study

 
Blood Processing and Cell Culture

Peripheral blood mononuclear cells (PBMCs) from homozygous wild-type (wt) CCR5 volunteers were isolated on a Ficoll-Hypaque gradient. PBMCs (2 x 106 cells) were immediately placed in TriReagent (Molecular Research Center, Cincinnati, OH) for RNA extraction as per the manufacturer's protocol or cultured in RPMI 1640 supplemented with 2 mmol/L L-glutamine 10% fetal bovine serum, 10 mmol/L HEPES, and penicillin/streptomycin. PBMCs were incubated with 50 ng/ml progesterone (Sigma Chemical Co., St. Louis, MO) for up to 6 days.

Tissue and Cell Preparation

Tissue samples from uterine ectocervix were trisected and either homogenized for RNA extraction, snap frozen in ornithine carbamoyltransferase embedding compound or fixed in Streck Tissue Fixative17-19 (Streck Laboratories, Omaha, NE). RNA was extracted from biopsy specimens by homogenizing fresh biopsies of 5 mm3 in 500 µl TriReagent using diethyl pyrocarbonate-treated, autoclaved, disposable homogenizers. After homogenization, RNA was purified as per the manufacturer's protocol. RNA pellets were resuspended in 1x transcription buffer (Promega, Madison, WI) with 2 units RQ1 RNase-free DNase (Promega, Madison, WI) and incubated for 30 minutes at 37°C to remove contaminating DNA. The mixture was extracted once with phenol:chloroform:isoamyl alcohol and once with chloroform:isoamyl alcohol. The aqueous layer was removed, and the RNA was precipitated in 3 volumes ethanol and 1/40 volume 3 mol/L sodium acetate overnight at -20°C.

Immunohistochemistry/Image Analysis

Tissue sections were cut to 5 µm, adhered to silanized slides, and deparaffinized through xylenes and graded alcohols. After peroxidase quenching and blocking with mouse serum in phosphate-buffered saline, pH 7.4, with 5% nonfat dry skim milk, immunohistochemistry was performed using the Vectastain ABC-HP kit (Vector Laboratories, Burlingame, CA) as per the manufacturer's recommendations. Diaminobenzidine was used as substrate with hematoxylin counterstain. Frozen tissue sections for quantitative image analysis were allowed to air dry for 5 minutes, followed by postfixation in cold acetone for 20 minutes or 2% formaldehyde for 15 minutes. Sections were washed in phosphate-buffered saline, and an optimized dilution of primary antibody was applied. Cytokine and chemokine expression was quantified using assisted computerized image analysis as previously described.20 IL-2-producing cells were identified by a juxtanuclear focal staining pattern surrounded by extracellular immune reactivity caused by adherence of cytokines to matrix proteins. Commercially available antibodies to CD4, CD45RO, CD68, S-100, IL-2, IL-4, and IL-10 (PharMingen, San Diego, CA) were used at concentrations optimized on control tissues.

Immunofluorescence/Flow Cytometry

After the appropriate incubation with progesterone, cells were pretreated with 0.5 mmol/L EDTA three times for 10 minutes each to remove adherent cells. Cells were washed three times with phosphate-buffered saline, pH 7.4/0.5% bovine serum albumin. Cells were then treated with 1 µg human immunoglobulin IgG/1 x 105 cells for 15 minutes at room temperature. Cells were stained with anti-CD4-fluorescein isothiocyanate or anti-CD14-fluorescein isothiocyanate (Becton Dickinson Immunochemistry Systems, San Jose, CA) and anti-CCR5-phycoerythrin or anti-CXCR4-phycoerythrin (PharMingen, San Diego, CA) for 30 minutes at room temperature, washed in phosphate-buffered saline, pH 7.4/0.5% bovine serum albumin, and fixed in 2% formaldehyde. Analysis was performed on a FACSCalibur flow cytometer using Cell Quest software.

CCR5 Genotyping

Total DNA was prepared by adding 400 µl of cell lysis buffer/200 µg/ml proteinase K to 1 x 106 cells from peripheral blood. The mixture was incubated at 58°C for 2 hours followed by extraction in 25:24:1 phenol:chloroform:isoamyl alcohol. The aqueous layer was recovered, and DNA was precipitated by the addition of 3 volumes of ethanol and 1/40 volume sodium acetate. DNA polymerase chain reaction (PCR) was performed by adding 45 µl reaction mix (1x PCR buffer (PEG> Applied Biosystems, Foster City, CA), 4.0 mmol/L MgCl2, 200 µmol/L dATP, 200 µmol/L dCTP, 200 µmol/L dGTP, 200 µmol/L dTTP, 200 nmol/L upstream CCR5 primer (TGTTTGCGTCTCTCCCAGGA), and 200 nmol/L CCR5 downstream primer (TGAAGATAAGCCTCACAGCCCT)) to approximately 500 ng DNA. The amplified product was resolved on a 2% metephor gel (FMC Bioproducts, Rockland, ME).

Chemokine Receptor mRNA Quantification

Quantitative kinetic reverse transcription-PCR was performed by adding 45 µl of reaction mix (1x RT Taqman EZ buffer (PE Applied Biosystems, Foster City, CA), 4.0 mmol/L Mn(O)Ac2, 300 µmol/L dATP, 300 µmol/L dCTP, 300 µmol/L dGTP, 300 µmol/L dTTP, 200 nmol/L upstream primer, 200 nmol/L downstream primer, 200 nmol/L internally conserved fluorogenic probes, and 10 units rTth polymerase) directly to 100 ng of total RNA in 5 µl RNase, DNase free water (Ambion, Austin, TX). Input RNA was normalized using glyceraldehyde-3-phosphate dehydrogenase mRNA quantification (PE Applied Biosystems). Reverse transcription and thermal amplification were performed using the following linked profile: reverse transcription, 30 minutes at 60°C; cDNA denaturation, 5 minutes at 95°C; 40 cycles of denaturation (95°C for 15 seconds); and annealing/extension (60°C for 1 minute) in a 7700 sequence detection system (PE Applied Biosystems). Duplicate standard curves with copy number controls ranging from 10 to 105 copies were run with each optical 96-well plate (PE Applied Biosystems). In addition, no template controls were included with each plate. We assessed the efficiency of amplification and the linearity of the assay by plotting the threshold cycle number, the cycle number at which the fluorescence signal exceeds background, versus the log target copy number (Figure 1) . To exclude potential signal due to plasmid DNA in the copy number standards, or to genomic DNA in the patient samples, we performed duplicate experiments with Taq polymerase rather than rTth polymerase. These experiments revealed a lack of amplification signal due to contaminating chemokine receptor DNA (data not shown). Amplification of heterologous transcripts or squamous cell RNA known to be negative for chemokine receptors revealed a lack of amplification signal. Amplification of RNA from a homozygous {Delta}32 CCR5 individual also revealed a lack of wt CCR5 amplification signal.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 1. Chemokine receptor mRNA quantification is linear over a range of at least 105 copies. Threshold cycle number (Ct) refers to the cycle number at which the reporter signal exceeds background. Results were based on triplicate determinations. The correlation coefficient for all curves was 0.99.

 
Primers and Probes

The primers and their respective probes used were as follows: wt CCR5, 5'-TGTTTGCGTCTCTCCCAGGA-3' and 5'-TGAAGATAAGCCTCACAGCCCT-3' (probe, 5'-FAM-CAGTCAGTATCAATTCTGGAAGAATTTCCAGACAT-TAMRA-3'); CXCR4, 5'-TATGACTCCATGAAGGAACCCTGT-3' and 5'-AGCCTGTACTTGTCCGTCATGC-3' (probe, 5'-FAM-TCC TGCCCACCATCTACTCCATCATC-TAMRA-3'); CCR3, 5'-AAAGCTGATACCAGAGCACTGATGG-3' and 5'-GTTGGTCATAATTCGGAGCCTCC-3' (probe, 5'-FAM-TTCACTGTGGGCCTCTTGGGCAAT-TAMRA-3'); CCR2b, 5'-CCTGTAAAGCAGGTGCCCAA-3' and 5'-AGAGTCAAAGTCTCTACCCACAGTTTTT-3' (probe, 5'-FAM-CCAATGCATATCCAACATGTGCTCAG-TAMRA-3'); US28, 5'-GACTCCCTGTGTCCTCACCG-3' and 5'-CCAAGAAGTTGCCGATGGAA-3' (probe, 5'-FAM-ACGTTGTTTCTGTACGGCGTTGTCTTTC-TAMRA-3'); IL-2, 5'-CCACAATATGCTATTCACATGTTCAGT-3' and 5'-CAATTAACGCCTTCTGTATGAAACAG-3' (probe, 5'-FAM-TTTCTGAGTTACTTTTGTATCCCCACCC-TAMRA-3'); IL-4, 5'-CTGTTCCCTGTGAGCTGCCT-3' and 5'-GTATAGTTATCCGCACTGACCACG-3' (probe, 5'-FAM-AGCTGGTTTTTCTGCTCTCCGAAGCC-TAMRA-3'); and IL-10, 5'-CCCAAGTATAGCTGAACCTTCCAA-3' and 5'-TGTGGATGCCTGCTGTGTG-3' (probe, 5'- FAM-CACGTAGGGTTGCAGGTTTCCTAGTGAG-TAMRA-3').

Statistical Analysis

Comparisons between samples were performed using the Student's t-test. Comparisons yielding a P < 0.05 were considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Quantification of the Chemokine Receptor Repertoire in Cervical Biopsies and Peripheral Blood

To quantify the expression of chemokine receptor mRNA in peripheral blood and biopsies from the female genital tract, we extracted and purified RNA and DNA from 12 women. Seven HIV-seronegative and five HIV-seropositive women with or without STDs, GUD, and progesterone predominance were evaluated using these techniques (Table 1) . To control for variable levels of wt and {Delta}32 CCR5 allelic expression in heterozygotes relative to homozygous wt individuals (manuscript in preparation), we selected women with a homozygous wt CCR5 genotype. Using 10,000 copies of glyceraldehyde-3-phosphate dehydrogenase mRNA (~100 cells) in each replicate, at least duplicate determinations of chemokine receptor mRNA levels were performed (Table 2) . The level of CCR5 mRNA in the cervix was significantly greater than CXCR4, CCR3, CCR2b, and US28 (P < 0.001) regardless of the clinical state of the patient (Table 2 , Figure 2 ). Levels of CCR5 mRNA in biopsies with increased inflammation (Table 2 , patients 5 to 12) were significantly increased compared with levels in biopsies without increased inflammation (Table 2 , patients 1 to 4) (P < 0.02). Levels of CCR5 were also increased in biopsies from progesterone-predominant women (Table 2 , patients 6 and 7) relative to premenopausal, exogenous progesterone-naïve women (Table 2 , patients 1 to 4). Immunohistochemistry using monoclonal antibodies was performed to localize and quantify CXCR4 and CCR5 protein-expressing cells and to confirm the relative expression levels of CXCR4 and CCR5 determined by quantitative reverse transcription-PCR (Figure 3) . We found an 8-fold greater CCR5 protein expression level compared with CXCR4 (P < 0.02). The 8-fold difference in protein expression approximates the 10-fold difference in mRNA expression. Double-label immunofluorescence staining revealed that all cells expressing CCR5 or CXCR4 co-expressed CD4 in the biopsies studied (Figure 4) .


View this table:
[in this window]
[in a new window]
 
Table 2. Quantification of Chemokine Receptor mRNA in Blood and Cervical Biopsies

 


View larger version (24K):
[in this window]
[in a new window]
 
Figure 2. Comparison of chemokine receptor expression in PBMCs and uterine cervix. CCR5 mRNA expression in the cervix was 10-fold greater than CXCR4, 20-fold greater than CCR2b, and 100-fold greater than CCR3. In PBMCs, CXCR4 expression was 1.5-fold greater than CCR5, 10-fold greater than CCR2b, and 15-fold greater than CCR3. US28 was not expressed in any of the cervical biopsies despite expression in PBMCs from five individuals.

 


View larger version (80K):
[in this window]
[in a new window]
 
Figure 3. Digital microscopic images of chemokine receptor expression in an immunohistochemically stained cervical biopsy from HIV-1-seropositive patient 12 (Tables 1 and 2) . Chemokine receptor-expressing cells appear brown (arrows) in sections counterstained with hematoxylin (blue). A: CCR5-expressing cells are clustered beneath the surface epithelium. B: CXCR4-expressing cells from the same biopsy have a similar localization as the CCR5-expressing cells. Increased numbers of CCR5-expressing cells were found compared with CXCR4-expressing cells. Magnification, x350.

 


View larger version (181K):
[in this window]
[in a new window]
 
Figure 4. Localization of cells co-expressing CD4 and CCR5 (yellow) using double-label immunofluorescence and laser confocal image analysis (patient 6). Cells expressing only CD4 appeared red (arrowheads), and cells expressing only CCR5 were not identified. The epithelium-submucosa junction is denoted by arrows.

 
The levels of CXCR4, CCR3, CCR2b, and US28 were significantly elevated in blood (P < 0.001) relative to the cervix when the whole study population was assessed, whereas the level of CCR5 in peripheral blood was not significantly elevated relative to the cervix (Table 2 , Figure 2 ). The difference between the level of CXCR4 and the level of CCR5 in peripheral blood was not statistically significant.

Quantification of Immune Cells in the Cervical Mucosa

Increases in chemokine receptor expression in a particular tissue can be attributed to an increase in the number of cells expressing a particular chemokine receptor, up-regulation of chemokine receptors in cells present in a particular tissue, or both. To determine whether increases in the number of cells known to express specific chemokine receptors contributed to the repertoire of chemokine receptor expression, we characterized the immune cells present in the ectocervix of women with normal, proinflammatory, and progesterone-predominant conditions.

Using immunohistochemistry and assisted computerized image analysis,20 we quantified the number of cells known to express CCR5 (CD4+ and CD45RO+ T cells, CD68+ macrophages, and S-100+ Langerhans' cells), CXCR4 (CD4+ and CD45RA+ T cells and CD68+ macrophages), CCR3 (CD4+ T cells, CD68+ macrophages, eosinophils, and basophils), CCR2b (CD68+ macrophages, natural killer cells), or US28 (CD4+ T cells and monocytes/macrophages) (Table 3) . Langerhans' cells, macrophages, and lymphocytes were evenly distributed in low quantities throughout the submucosa in four healthy controls such as patient 1 (Table 3 , Figure 5 ) and were rarely found in the epithelium. Dramatic yet heterogeneous increases in cellular infiltrates were seen in biopsies from women with GUD, progesterone predominance, or genital tract infections. The woman with noninfectious GUD (patient 5, Table 3 , Figure 5 ) had a moderate increase in macrophages and CD45RO+ T cells with a CD4/CD8 ratio of 4.9. In patients 6 and 7, an increase in CD45RO+ T cells and macrophages was observed in the progesterone-predominant biopsies. Women with human papillomavirus (HPV) or herpes simplex virus and HIV, such as patient 8 (Table 3 , Figure 5 ), had profound increases in CD45RO+ T cells and macrophages. Despite the presence of inflammatory conditions, neither the intensity of CD4 cell surface staining nor the number of Langerhans' cells changed in the women studied.


View this table:
[in this window]
[in a new window]
 
Table 3. Quantification of Immune Cells in Cervical Biopsies Using Image Analysis

 


View larger version (100K):
[in this window]
[in a new window]
 
Figure 5. Immunophenotypic characterization of cell types known to express CCR5 in representative cervical biopsies from patients listed in Table 1 . Activated/memory T lymphocytes (CD45RO), macrophages (CD68), and Langerhans' cells (S-100) were visualized and quantified using image analysis. Positive cells appear brown (arrowheads) in sections counterstained with hematoxylin (blue). A lymphoid follicle was identified (arrow) in one of the biopsies. Magnification, x200.

 
Regulation of Chemokine Receptor mRNA Expression in Vivo

To determine whether increased expression of cytokines involved in the mucosal immune response contributed to the pattern of chemokine receptor expression in our biopsies, we quantified the expression levels of IL-2, IL-4, and IL-10 using quantitative, kinetic reverse transcription-PCR and immunohistochemistry/assisted computerized image analysis. The type 1 cytokine IL-2 mRNA was up-regulated, whereas the type 2 cytokines IL-4 and IL-10 were below the limits of detection (10 mRNA copies) in biopsies from patients with STDs (Table 4 , Figure 6 ). To confirm the quantification and to localize the source of IL-2 up-regulation, we stained tissue sections with monoclonal antibodies against IL-2, IL-4, and IL-10. As might be expected, biopsies (Table 3 , patients 1 to 4) devoid of increased inflammatory cell infiltrates were negative for IL-2, as well as IL-4 and IL-10. Biopsies from women such as patients 8 and 9 (Figure 6) with the most inflammation and the highest level of CCR5 mRNA expression (Table 3 , patients 8 to 12) exhibited numerous cells in the epithelium and submucosa expressing IL-2 but lacked cells expressing IL-4 and IL-10. Biopsies from patients 6 and 7 revealed high levels of CCR5 expression in the absence of up-regulated IL-2.


View this table:
[in this window]
[in a new window]
 
Table 4. Quantification of Cytokine mRNA in Cervical Biopsies

 


View larger version (127K):
[in this window]
[in a new window]
 
Figure 6. Assisted computerized image analysis photomicrograph of cervical biopsies from patients 8 (A) and 9 (B) stained by immunohistochemistry for IL-2. IL-2-producing cells were identified by a juxtanuclear focal staining pattern (arrows) surrounded by extracellular immune reactivity caused by adherence of cytokines to matrix proteins. Tissue sections were counterstained with hematoxylin (blue). Magnification, x400.

 
Effect of Progesterone on Chemokine Receptor Expression

To determine the direct effects of progesterone on chemokine receptor expression at the cellular level, we incubated PBMCs with 50 ng/ml progesterone for 6 days. At time 0, 3 days, and 6 days of culture, we extracted total RNA for CCR5, CXCR4, CCR3, and CCR2b mRNA quantification (Figure 7A) . In addition, we performed flow cytometry on PBMCs from the same time points to localize increases of CCR5 and CXCR4 to specific cell types. Molecular and immunophenotypic analysis revealed 5- to 10-fold increases in CCR5, CXCR4, and CCR3 expression that peaked after 3 days of culture. Levels of CCR2b mRNA in PBMCs decreased after progesterone treatment. The increase in CCR5 after progesterone treatment was detected exclusively in CD14+ monocytes (Figure 7B) , whereas increased CXCR4 expression was detected equally in lymphocytes (CD4+ or CD8+) and CD14+ monocytes. The increase in CCR5/CXCR4 expression peaked at 3 days and remained elevated or slightly diminished by day 6 (data not shown).



View larger version (14K):
[in this window]
[in a new window]
 
Figure 7. A: Quantification of progesterone-induced chemokine receptor mRNA up-regulation after 3 days of PBMC culture in the presence of 50 ng/ml progesterone. CCR5, CXCR4, and CCR3 mRNA were significantly increased after progesterone treatment, whereas CCR2b mRNA decreased after treatment. B: Representative histograms from immunophenotyping/flow cytometry experiments. Untreated (top) and progesterone-treated (bottom) cells were double labeled with CD14-fluorescein isothiocyanate and CCR5-PE and gated based on CD14 expression and side scatter. Progesterone up-regulated CCR5 protein expression fivefold in CD14+ monocytes. The increase in CCR5/CXCR4 expression peaked at 3 days and remained elevated or slightly diminished by day 6.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Heterosexual transmission of HIV-1 is the leading mode of transmission worldwide.21 Understanding the dynamics of HIV-1 sexual transmission from male to female is critical to designing effective prevention strategies. Male-to-female transmission of HIV-1 involves exposure of cell-free or cell-associated virus in semen to cervicovaginal mucosa.22 The sexually transmitted macrophage-tropic, non-syncytium-inducing HIV-1 variants23 primarily use the chemokine receptor CCR5 as co-receptor,8,9 whereas T-cell-tropic, syncytium-inducing variants use CXCR4 as co-receptor.13 Our data indicate that CCR5 is the major HIV-1 co-receptor expressed in the female genital tract and CXCR4 is the predominantly expressed HIV co-receptor in peripheral blood. In cervical biopsies, CCR5 mRNA expression was 10-fold greater than CXCR4, 20-fold greater than CCR2b, and 100-fold greater than CCR3. In PBMCs, CXCR4 expression was 1.5-fold greater than CCR5, 10-fold greater than CCR2b, and 15-fold greater than CCR3. US28 was not expressed in any of the biopsies despite expression in PBMCs from five individuals. In particular, CCR5 expression was significantly elevated in cervical tissue from women with HIV and HPV or progesterone-predominant conditions when compared with biopsies from healthy normal women. These data have important implications for HIV transmission, considering studies showing a correlation between the level of CCR5 expression and infectability of cells by macrophage-tropic isolates of HIV-1.24

Significant increases in CD4+ and CD45RO+ T lymphocytes were found in all biopsies with increased CCR5 expression. With one exception, the increase of CCR5 expression was also associated with increased numbers of CD68+ macrophages. Our data support previous animal studies on lymphocyte recirculation that demonstrated memory T cells (CD45RO+ and CCR5+) migrating to peripheral tissues, whereas naïve T cells (CD45RA+ and CXCR4+) use a recirculation pathway that bypasses tissues.25 The significant difference in CCR5 and CXCR4 expression in these cervical biopsies must be due to either increases in CD4+ and CD45RO+ T cells that differentially express more CCR5 than CXCR4,26 or factors that preferentially up-regulate CCR5 expression. Monocytes and Langerhans' cells express both CCR5 and CXCR4, so increases in these cell types would be expected to increase both CCR5 and CXCR4, although blocks in CXCR4 cell surface expression have been shown in Langerhans' cells.27 Langerhans' cells, however, were not increased in any of the biopsies, raising the issue of their role in the increased HIV-1 susceptibility in women with STDs.

The first line of defense against HIV transmission in the female genital tract is the vaginal fluid and the cervical mucus.22 A recent study has identified increased levels of HIV-1 env-specific immunoglobulin A in cervicovaginal fluid from HIV-exposed, uninfected partners of HIV-infected men.28 Cervical mucus itself has been proposed to provide a physical barrier preventing HIV-1 from contacting the mucosal surface.22 The second layer of defense is the vaginal and cervical epithelium. Breaches in this physical barrier have been suggested to increase the risk of HIV transmission.15 This is not surprising in view of our data from the patient with noninfectious GUD. The base of the ulcer was lined by CD4+ and CD45RO+ T lymphocytes and macrophages, cell types that co-express CD4 and CCR5. The impact of oral contraceptives on genital-tract CCR5 expression in this patient, however, was not examined.

Studies have demonstrated an increased rate of HIV infection in women >45 years of age.29 Progesterone, the predominant hormone in menopause, has been shown to enhance SIV transmission presumably by allowing more virions to move through the thinned epithelium.15 In our study, a significantly increased level of CCR5 expression was found in cervical biopsies from progesterone-predominant women. In addition to epithelium only five to seven cells thick, immunohistochemical analysis revealed increased CD4+ and CD45RO+ T cells and macrophages localized to the epithelial-submucosa junction in cervical samples with immune activation (see Figure 3 ). In vitro stimulation of peripheral blood mononuclear cells with concentrations of progesterone known to increase female genital tract transmission of SIV in macaques revealed a 5- to 10-fold up-regulation of CCR5 in CD14+ monocytes/macrophages and 5-fold increase of CXCR4 expression in CD4+ lymphocytes and CD14+ monocytes/macrophages. The lack of CD4+ and CD45RA+ T cells, which predominantly express CXCR4, in tissue may explain why CXCR4 mRNA was higher in PBMCs when compared with cervical tissue (Table 2) . These data also suggest that CCR5 and CXCR4 have promoter regulatory elements responsive to the glucocorticoid/progesterone receptor pathway.30 Progesterone-containing oral contraceptives have been shown, depending on the study, to either increase or decrease the risk of sexual transmission.15,31 Further study is necessary to determine whether estrogen enhances or diminishes the effects of progesterone on chemokine receptor expression.

The last defense against HIV transmission in the female genital tract is the mucosal immune system. The immune system in the female genital tract consists of an inductive arm and an effector arm.31 Pathogens encounter the inductive arm, during which time phagocytosis occurs and antigen is processed. During an immune response in the female genital tract, antigen is presented by mucosal macrophages and Langerhans' cells.32 These antigen-presenting cells migrate via afferent lymphatics to draining lymph nodes, where they stimulate B and T lymphocytes. Activated lymphocytes reenter peripheral blood and migrate to the female genital tract, functioning in the effector arm of the immune response.31 We demonstrate that CCR5 mRNA is significantly increased when the effector arm of the cellular immune response is engaged in response to infectious and noninfectious inflammatory conditions. Local cytokine production is a critical correlate of an effective immune response. Preliminary data from our laboratory34 have shown that type 1 cytokines, such as those would predominate in cellular immune responses (IL-2, interferon-{gamma}, and IL-12), up-regulate CCR5 and to a lessor extent CXCR4. Type 2 cytokines (IL-4, IL-5, and IL-10), active in humoral immune responses, up-regulate CXCR4 but not CCR5.33 In the present study, we determined that IL-2, a cytokine known to up-regulate CCR5, is increased in biopsies from women with STDs, whereas expression of IL-10, a cytokine known to decrease CCR5 mRNA expression in vitro, is low in all biopsies.33 Although the contribution of genital HIV infection to this cytokine profile is unknown, HPV infection has been associated with an increase in IL-2 production.34 These data support at the tissue level previous studies relating strong type 1 cytokine production and weak type 2 cytokine production, as defined by the IL-2/IL-10 ratio, with the presence of non-syncytium-inducing HIV-1 isolates.35

The one-log range of CCR5 expression in the genital tract of homozygous wt CCR5 women may explain the wide variation in HIV infection rates and the increase of HIV sexual transmission in women with STDs. Here, we demonstrate that chemokine receptor expression was compartmentalized in the genital tract relative to peripheral blood; therefore, therapy directed at decreasing sexual transmission through modulating or blocking chemokine receptors should be locally targeted.


    Acknowledgements
 
The authors acknowledge the expert technical assistance of Paul Jung and David Carter and thank Vanessa Jones for photographic assistance and Scott Brodie and Michael Socol for critical review of this manuscript. We also acknowledge the gift of the chemokine and chemokine receptor antibodies from Dr. Monica Tsang (R&D Systems, Inc., Minneapolis, MN).


    Footnotes
 
Address reprint requests to Dr. Bruce K. Patterson, Northwestern University Medical School, 333 E. Superior Street, Suite 410, Chicago, IL 60611. E-mail: bpatters{at}nmh.org

Supported by grants from the National Cancer Institute (grant 2490), the Swedish Medical Research Council (grant 10850), the Women's Interagency HIV Study (grant 5 UO1 AI 34993-03), and the Northwestern Comprehensive AIDS Center.

Accepted for publication May 20, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Stakewski S, Schieck E, Rehmet S, Helm EB, Stille W: HIV transmission from a male after only two sexual contacts. Lancet 1987, 2:628-630
  2. Liu R, Paxton WA, Choe S, Ceridini D, Martin SR, Horuk R, MacDonald ME, Stuhlmann H, Koup RA, Landau NR: Homozygous defect in HIV-1 coreceptor accounts for resistance of some multiply exposed individuals to HIV-1 infection. Cell 1996, 86:367-377[Medline]
  3. Padian NS, Shiboski SC, Jewell NP: Female to male transmission of human immunodeficiency virus. JAMA 1991, 266:1664-1667[Abstract/Free Full Text]
  4. Plummer FA, Simonsen JN, Cameron DW, Ndinya-Achola JO, Kreiss JK, Gakinya MN, Waiyaki P, Cheang M, Piot P, Ronald AR, Ngugi EN: Cofactors in male-female sexual transmission of human immunodeficiency virus type 1. J Infect Dis 1991, 163:233-238[Medline]
  5. Laga M, Diallo OM, Buve: Inter-relationship of sexually transmitted disease and HIV: where are we now? AIDS 1994, 8:S119-S124
  6. Kreiss JK, Coombs R, Plummer FA: Isolation of human immunodeficiency virus from genital ulcers in Nairobi prostitutes. J Infect Dis 1986, 160:380-384
  7. Schuitemaker H, Kootstra NA, de Goede RE, de Wolf F, Miedema F, Termette M: Monocytotropic human immunodeficiency virus type 1 (HIV-1) variants detectable at all stages of HIV-1 infection lack T-cell line tropism and syncytium-inducing ability in primary T-cell culture. J Virol 1986, 65:356-363
  8. Deng H, Liu R, Ellmeier W, Choe S, Unutmaz D, Burhart M, Dimarzio P, Marmon S, Sutton RE, Hill CM, Peiper SC, Schall TJ, Littman DR, Landau NR: Identification of a major coreceptor for primary isolates of HIV-1. Nature 1996, 381:661-667[Medline]
  9. Alkhatib G, Combadiere C, Broder CC, Feng Y, Kennedy PE, Murphy PM, Berger EA: CC-CKR5: a RANTES, MIP-1{alpha}, MIP-1ß receptor as a fusion cofactor for macrophage-tropic HIV-1. Science 1996, 272:1955-1958[Abstract]
  10. Feng Y, Broder CC, Kennedy PE, Berger EA: HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G-protein-coupled receptor. Science 1996, 272:872-877[Abstract]
  11. Heath H, Qin S, Rao P, Wu L, LaRosa G, Kassem N, Ponath PD, Mackay CR: Chemokine receptor usage by human eosinophils. J Clin Invest 1997, 99:178-184[Medline]
  12. Doranz BJ, Rucker J, Yanjie Y, Smyth RJ, Samson M, Peiper SC, Parmentier M, Collman RG, Doms RW: A dual-tropic primary HIV-1 isolate that uses fusin, and the ß-chemokine receptors CKR-5: CKR-3, and CKR-2b as fusion cofactors. Cell 1996, 85:1149-1158[Medline]
  13. Plekoff O, Treboute C, Brelot A, Heveker N, Seman M, Alizon M: Identification of a chemokine receptor encoded by human cytomegalovirus as a cofactor for HIV-1 entry. Science 1997, 276:1874-1878[Abstract/Free Full Text]
  14. Spira AI, Marx PA, Patterson BK, Mahoney J, Koup RA, Wolinsky SM, Ho DD: Cellular targets of infection and route of viral dissemination after an intravaginal inoculation of simian immunodeficiency virus into rhesus macaques. J Exp Med 1996, 183:215-225[Abstract/Free Full Text]
  15. Marx PA, Spira AI, Gettie A, Dailey PJ, Veazey RS, Lackner AA, Mahoney CJ, Miller CJ, Claypool LE, Ho DD, Alexander NJ: Progesterone implants enhance SIV vaginal transmission and early virus load. Nat Med 1996, 2:1084-1089[Medline]
  16. Deng HK, Unutmaz D, KewalRamani VN, Littman DR: Expression cloning of new receptors used by simian and human immunodeficiency viruses. Nature 1997, 388:296-300[Medline]
  17. Frumkin L, Patterson BK, Leverenz J, Agy M, Wolinsky S, Morton W, Corey L: Infection of Macaca nemistrina brain with human immunodeficiency virus type 1. J Gen Virol 1995, 76:2467-2476[Abstract/Free Full Text]
  18. Korber B, Kunstman K, Patterson BK, Furtado M, McEvilly M, Levy R, Wolinsky S: HIV-1 sequence differences between blood and simultaneously obtained brain biopsy samples: conserved elements in the V3 region of the envelope protein of brain-derived sequences. J Virol 1994, 68:7467-7481[Abstract/Free Full Text]
  19. Koffron AJ, Hummel M, Patterson BK, Yan S, Kaufman DB, Frye JP, Stuart FP, Abecassis MI: Cellular localization of latent murine cytomegalovirus. J Virol 1998, 72:95-103[Abstract/Free Full Text]
  20. Litton MJ, Dohlsten M, Hansson J, Rosendahl A, Ohlsson L, Kalland T, Andersson J, Andersson U: Tumor therapy with an antibody-targeted superantigen generates a dichotomy between local and systemic immune responses. Am J Pathol 1997, 150:1607-1618[Abstract]
  21. : World Health Organization: The current global situation of the HIV/AIDS pandemic. Wkly Epidemiol Rec 1995, 70:7-8[Medline]
  22. Stratton P, Alexander NJ: Heterosexual spread of HIV infection. Cotton D Watts DH eds. The Medical Management of AIDS in Women. 1997, :pp 15-43 Wiley-Liss New York
  23. Zhu T, Wang N, Carr A, Nam DS, Moor-Jankowski R, Cooper DA, Ho DD: Genetic characterization of human immunodeficiency virus type 1 in blood and genital secretions: evidence for viral compartmentalization and selection during sexual transmission. J Virol 1996, 70:3098-3107[Abstract]
  24. Wu L, Paxton WA, Kassam N, Ruffing N, Rottman JB, Sullivan N, Choe H, Sodroski J, Newman W, Koup RA: CCR5 levels and expression pattern correlate with infectability by macrophage-tropic HIV-1, in vitro. J Exp Med 1997, 185:1681-1691[Abstract/Free Full Text]
  25. Mackay CR, Marston WL, Dudler L: Naïve and memory T-cells show distinct pathways of lymphocyte recirculation. J Exp Med 1990, 171:801-817[Abstract/Free Full Text]
  26. Bleul CC, Wu L, Hoxie JA, Springer TA, Mackay CR: The HIV coreceptors CXCR4, and CCR5 are differentially expressed and regulated on human T-lymphocytes. Proc Natl Acad Sci USA 1997, 94:1925-1930[Abstract/Free Full Text]
  27. Zaitseva M, Blauvelt A, Lee S, Lapham CK, Klaus-Kovtun V, Mostowski H, Manischewitz J, Golding H: Expression and function of CCR5 and CXCR4 on human Langerhans' cells and macrophages: implications for HIV primary infection. Nat Med 1997, 3:1369-1375[Medline]
  28. Mazzoli S, Trabattoni D, Caputo SL, Piconi S, Ble C, Meacci F, Ruzzante S, Salvi A, Semplicil F, Longhi R, Fusi ML, Tofani N, Biasin M, Villa ML, Mazzotta F, Clerici M: HIV-specific mucosal and cellular immunity in HIV-seronegative partners of HIV-seropositive individuals. Nat Med 1997, 3:1250-1257[Medline]
  29. : European Study Group on Heterosexual Transmission of HIV: Comparison of female-to-male and male-to-female transmission of HIV in 563 stable couples. Br Med J 1992, 304:809-813
  30. Beano M: Gene regulation by steroid hormones. Cell 1989, 56:335-344[Medline]
  31. Miller CJ, McGhee JR, Gardner MB: Biology of disease mucosal immunity, HIV transmission, and AIDS. Lab Invest 1992, 68:129-140[Medline]
  32. Parr MB, Kepple L, Parr EL: Antigen recognition in the female reproductive tract. II. Endocytosis of horseradish peroxidase by Langerhans' cells in murine vaginal epithelium. Biol Reprod 1991, 45:261-265[Abstract]
  33. Patterson BK, Czerniewski MA, Su F, Andersson J, Jiyamapa D, Burki Z, Landay A: Regulation of CCR5 and CXCR4 expression by type 1 and type 2 cytokines: type 1 cytokine upregulation of CCR5 mRNA expression can be abolished by IL-10. 5th Conference on Retroviruses and Opportunistic Infections. Abstract 178
  34. Tsukui T, Hildesheim A, Schiffman MH, Lucci J, III, Contois D, Lawler P, Rush BB, Lorincz AT, Corrigan A, Burk RD, Qu W, Marshall MA, Mann D, Carrington M, Clerici M, Shearer GM, Carbone DP, Scott DR, Houghten RA, Berzofsky JA: Interleukin 2 production in vitro by peripheral lymphocytes in response to human papilloma-derived peptides: correlation with cervical pathology. Cancer Res 1996, 56:3967-3974[Abstract/Free Full Text]
  35. Clerici M, Balotta C, Salvaggio A, Riva C, Trabattoni D, Papagno L, Berusconi A, Rusconi S, Luisa Villa M, Moroni M, Galli M: Human immunodeficiency virus (HIV) phenotype and interleukin-2/interleukin-10 ratio are associated markers of protection and progression in HIV infection. Blood 1996, 88:574-579[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Reproductive SciencesHome page
J. S. Sheffield, G. D. Wendel Jr, D. D. McIntire, and M. V. Norgard
The Effect of Progesterone Levels and Pregnancy on HIV-1 Coreceptor Expression
Reproductive Sciences, January 1, 2009; 16(1): 20 - 31.
[Abstract] [PDF]


Home page
ADRHome page
L.A. Bergmeier and T. Lehner
Innate and Adaptive Mucosal Immunity in Protection against HIV Infection
Advances in Dental Research, April 1, 2006; 19(1): 21 - 28.
[Abstract] [Full Text] [PDF]


Home page
ADRHome page
M.C. Herzberg, A. Weinberg, and S.M. Wahl
(C3) The Oral Epithelial Cell and First Encounters with HIV-1
Advances in Dental Research, April 1, 2006; 19(1): 158 - 166.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Venkataraman, A. L. Cole, P. Svoboda, J. Pohl, and A. M. Cole
Cationic Polypeptides Are Required for Anti-HIV-1 Activity of Human Vaginal Fluid
J. Immunol., December 1, 2005; 175(11): 7560 - 7567.
[Abstract] [Full Text] [PDF]


Home page
Sex. Transm. Infect.Home page
A M Minnis and N S Padian
Effectiveness of female controlled barrier methods in preventing sexually transmitted infections and HIV: current evidence and future research directions
Sex Transm Inf, June 1, 2005; 81(3): 193 - 200.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. Laverdiere, B. H. Hoang, R. Yang, R. Sowers, J. Qin, P. A. Meyers, A. G. Huvos, J. H. Healey, and R. Gorlick
Messenger RNA Expression Levels of CXCR4 Correlate with Metastatic Behavior and Outcome in Patients with Osteosarcoma
Clin. Cancer Res., April 1, 2005; 11(7): 2561 - 2567.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Philpott, H. Burger, C. Tsoukas, B. Foley, K. Anastos, C. Kitchen, and B. Weiser
Human Immunodeficiency Virus Type 1 Genomic RNA Sequences in the Female Genital Tract and Blood: Compartmentalization and Intrapatient Recombination
J. Virol., January 1, 2005; 79(1): 353 - 363.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Barassi, A. Lazzarin, and L. Lopalco
CCR5-specific mucosal IgA in saliva and genital fluids of HIV-exposed seronegative subjects
Blood, October 1, 2004; 104(7): 2205 - 2206.
[Full Text] [PDF]


Home page
JEMHome page
Q. Hu, I. Frank, V. Williams, J. J. Santos, P. Watts, G. E. Griffin, J. P. Moore, M. Pope, and R. J. Shattock
Blockade of Attachment and Fusion Receptors Inhibits HIV-1 Infection of Human Cervical Tissue
J. Exp. Med., April 19, 2004; 199(8): 1065 - 1075.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. S. Kemal, B. Foley, H. Burger, K. Anastos, H. Minkoff, C. Kitchen, S. M. Philpott, W. Gao, E. Robison, S. Holman, et al.
HIV-1 in genital tract and plasma of women: Compartmentalization of viral sequences, coreceptor usage, and glycosylation
PNAS, October 28, 2003; 100(22): 12972 - 12977.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Kawamura, F. O. Gulden, M. Sugaya, D. T. McNamara, D. L. Borris, M. M. Lederman, J. M. Orenstein, P. A. Zimmerman, and A. Blauvelt
R5 HIV productively infects Langerhans cells, and infection levels are regulated by compound CCR5 polymorphisms
PNAS, July 8, 2003; 100(14): 8401 - 8406.
[Abstract] [Full Text] [PDF]


Home page
Sex. Transm. Infect.Home page
R J DiClemente, G M Wingood, C Del Rio, and R A Crosby
Prevention interventions for HIV positive individuals
Sex Transm Inf, December 1, 2002; 78(6): 393 - 395.
[Full Text] [PDF]


Home page
Am. J. Pathol.Home page
B. K. Patterson, A. Landay, J. N. Siegel, Z. Flener, D. Pessis, A. Chaviano, and R. C. Bailey
Susceptibility to Human Immunodeficiency Virus-1 Infection of Human Foreskin and Cervical Tissue Grown in Explant Culture
Am. J. Pathol., September 1, 2002; 161(3): 867 - 873.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
H. Nagase, M. Miyamasu, M. Yamaguchi, M. Imanishi, N. H. Tsuno, K. Matsushima, K. Yamamoto, Y. Morita, and K. Hirai
Cytokine-mediated regulation of CXCR4 expression in human neutrophils
J. Leukoc. Biol., April 1, 2002; 71(4): 711 - 717.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
M. Clerici, S. Declich, and G. Rizzardini
African Enigma: Key Player in Human Immunodeficiency Virus Pathogenesis in Developing Countries?
Clin. Vaccine Immunol., September 1, 2001; 8(5): 864 - 866.
[Full Text] [PDF]


Home page
J. Virol.Home page
P. S. Beisser, L. Laurent, J.-L. Virelizier, and S. Michelson
Human Cytomegalovirus Chemokine Receptor Gene US28 Is Transcribed in Latently Infected THP-1 Monocytes
J. Virol., July 1, 2001; 75(13): 5949 - 5957.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
H. Behbahani, E. Popek, P. Garcia, J. Andersson, A.-L. Spetz, A. Landay, Z. Flener, and B. K. Patterson
Up-Regulation of CCR5 Expression in the Placenta Is Associated with Human Immunodeficiency Virus-1 Vertical Transmission
Am. J. Pathol., December 1, 2000; 157(6): 1811 - 1818.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Maier, M. M. Bartolome-Rodriguez, C. Moulon, H. U. Weltzien, and A. Meyerhans
Kinetics of CXCR4 and CCR5 up-regulation and human immunodeficiency virus expansion after antigenic stimulation of primary CD4+ T lymphocytes
Blood, September 1, 2000; 96(5): 1853 - 1856.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
P. Greenhead, P. Hayes, P. S. Watts, K. G. Laing, G. E. Griffin, and R. J. Shattock
Parameters of Human Immunodeficiency Virus Infection of Human Cervical Tissue and Inhibition by Vaginal Virucides
J. Virol., June 15, 2000; 74(12): 5577 - 5586.
[Abstract] [Full Text]


Home page
J. Gen. Virol.Home page
C. E. Mackewicz, B. K. Patterson, S. A. Lee, and J. A. Levy
CD8+ cell noncytotoxic anti-human immunodeficiency virus response inhibits expression of viral RNA but not reverse transcription or provirus integration
J. Gen. Virol., May 1, 2000; 81(5): 1261 - 1264.
[Abstract] [Full Text]


Home page
J. Immunol.Home page
R. Kaul, F. A. Plummer, J. Kimani, T. Dong, P. Kiama, T. Rostron, E. Njagi, K. S. MacDonald, J. J. Bwayo, A. J. McMichael, et al.
HIV-1-Specific Mucosal CD8+ Lymphocyte Responses in the Cervix of HIV-1-Resistant Prostitutes in Nairobi
J. Immunol., February 1, 2000; 164(3): 1602 - 1611.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B. Schramm, M. L. Penn, R. F. Speck, S. Y. Chan, E. De Clercq, D. Schols, R. I. Connor, and M. A. Goldsmith
Viral Entry through CXCR4 Is a Pathogenic Factor and Therapeutic Target in Human Immunodeficiency Virus Type 1 Disease
J. Virol., January 1, 2000; 74(1): 184 - 192.
[Abstract] [Full Text]


Home page
J. Virol.Home page
L. G. Kostrikis, A. U. Neumann, B. Thomson, B. T. Korber, P. McHardy, R. Karanicolas, L. Deutsch, Y. Huang, J. F. Lew, K. McIntosh, et al.
A Polymorphism in the Regulatory Region of the CC-Chemokine Receptor 5 Gene Influences Perinatal Transmission of Human Immunodeficiency Virus Type 1 to African-American Infants
J. Virol., December 1, 1999; 73(12): 10264 - 10271.
[Abstract] [Full Text]


Home page
Clin. Chem.Home page
H. B. Urnovitz, J. C. Sturge, T. D. Gottfried, and W. H. Murphy
Urine Antibody Tests: New Insights into the Dynamics of HIV-1 Infection
Clin. Chem., September 1, 1999; 45(9): 1602 - 1613.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A.-L. Spetz, B. K. Patterson, K. Lore, J. Andersson, and L. Holmgren
Functional Gene Transfer of HIV DNA by an HIV Receptor-Independent Mechanism
J. Immunol., July 15, 1999; 163(2): 736 - 742.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Vassiliadou, L. Tucker, and D. J. Anderson
Progesterone-Induced Inhibition of Chemokine Receptor Expression on Peripheral Blood Mononuclear Cells Correlates with Reduced HIV-1 Infectability In Vitro
J. Immunol., June 15, 1999; 162(12): 7510 - 7518.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
Y.-j. Zhang and J. P. Moore
Will Multiple Coreceptors Need To Be Targeted by Inhibitors of Human Immunodeficiency Virus Type 1 Entry?
J. Virol., April 1, 1999; 73(4): 3443 - 3448.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Patterson, B. K.
Right arrow Articles by Garcia, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Patterson, B. K.
Right arrow Articles by Garcia, P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS