| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From INSERM U.148 and Department of Cell Biology*
and
Department of Pathology,
CHU de
Montpellier-Hôpital Lapeyronie, Montpellier, France
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(ER)-stained nuclei but was
inversely correlated with the progesterone receptor. However,
in cystadenomas and borderline tumors, both fibulin-1 and ER
protein levels increased, in comparison with normal
ovaries, suggesting an effect of estrogens in the early steps
of tumorigenesis. This fibulin-1 overexpression, demonstrated
in vivo in ovarian carcinomas, might be a useful
indicator for predicting cancer risk and/or
aggressiveness.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The aim of this pilot study was to determine the origin in
vivo of fibulin-1 (stromal, epithelial, or blood), its
significance in tumor progression, and its possible correlation with
estrogen and progesterone receptors. We studied the distribution and
levels of fibulin-1, ER, and PgR protein by immunohistochemistry in
14 normal ovaries and 44 human ovarian epithelial tumors. In some
tumors, we defined cells producing fibulin-1 mRNA by in situ
hybridization.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Ovarian tumors were obtained from the Departments of Gynecology and Surgery of the University Hospital of Montpellier, France. After surgery, tumors for immunohistochemical analysis were routinely fixed in formaldehyde (40%; 0.1:1, v/v), acetic acid (100%; 0.1:1, v/v), and methanol (100%; 0.4:1, v/v) in distilled water (FAAM) for at least 24 hours and embedded in paraffin. Thirty-three ovarian epithelial tumors diagnosed between 1994 and 1996 in the Pathology Department included five serous borderline tumors, sixteen serous carcinomas, four mucinous carcinomas, four endometrioid carcinomas, and four clear-cell carcinomas. Eleven serous cystadenomas diagnosed during the same period were selected at random for the same analysis. Fourteen normal ovaries were taken from total hysterectomies performed for prolapsus or fibromyoma. Serous carcinomas and serous cystadenomas to be analyzed by in situ hybridization were immediately frozen in liquid nitrogen after surgical removal and stored at -80°C until in situ hybridization and immunohistochemical analysis of adjacent frozen sections. All tissues were collected for therapeutic or diagnostic purposes according to the ethical rules of Helsinki (1984), modified in Tokyo, and with the approval of the local ethics committee.
Immunohistochemistry
Immunohistochemical analysis was performed on adjacent sections of
each paraffin-embedded block of tumors and normal ovaries using control
antibody and fibulin-1, ER, and PgR antibodies, respectively.
Fibulin-1 staining was performed as described with the mouse anti-human monoclonal antibody (MAb) 3A11.11
ER was revealed with 1D5 MAb17
(Dako, Glostrup, Denmark)
at 2.5 µg/ml using a microwave antigen retrieval
technique.18
The 1D5 MAb has been directed at the AB domain
of the ER and does not stain ERß as checked after transfection of
ERß expression vector into MDA-MB231 cells (A. Lucas, unpublished).
PgR was revealed with mPRIII (Transbio SARL, Boulogne, France) at 2.5
µg/ml.19
Staining was performed using a standard
streptavidin-biotin enhanced immunoperoxidase technique (LSAB kit,
Dako).
Immunostaining specificity was checked using an irrelevant mouse MAb of
the same immunoglobulin (Ig) subclass: UPC10 (Sigma) for 3A11 (IgG2a)
and MOPC 21 (Sigma) for 1D5 and mPRIII (IgG1). In each experiment,
sections of the same FAAM-fixed and paraffin-embedded cell pellet were
used as positive external control: BG1 ovarian cancer cell
line20
for Fib-1 staining, ER-transfected 3Y1-AD12 cell
line21
for ER staining, and MCF7 for PgR staining.
Fibulin-1 staining was also performed on frozen sections adjacent to sections used for in situ hybridization. The immunostaining technique was the same as that used for the paraffin-embedded samples but with only 1 µg/ml 3A11 MAb and without Pronase treatment.
Immunostaining Quantification
Fibulin-1 staining intensity was quantified with an image analyzer (SAMBA TITN, Unilog, Grenoble, France) adapted to a Leitz DMRB light microscope (Leica, Wetzlar, Germany) and a 3-CCD DXC-950P color video camera (Sony Corp., Tokyo, Japan) connected to a microcomputer. Fibulin-1 staining intensity was quantified in each section (ovarian and/or peritoneal localization) of the 32 serous tumors, both in proximal tumor stroma (stroma located 0 to 550 µm from tumor cells) and in distant stroma (stroma located 550 µm to 1.5 mm from these cells). In normal ovaries, fibulin-1 staining was also quantified in proximal stroma (0 to 550 µm from surface epithelial cells) and in distant stroma. Staining intensity was assessed as the mean integrated optical density measured in each section on 4 to 65 fields (one field corresponding to 550 µm diameter at x20 magnification). The field number varied with the tumor area and labeling heterogeneity. The background intensity of the negative control in an adjacent section was subtracted from the total intensity to obtain specific staining.22
No significant variations were observed between experiments, as checked with a positive stained external control (BG1 cells pellet) analyzed in parallel.
ER and PgR immunostaining semiquantification was performed using
light microscopy. The percentage of nuclei from tumor and normal
epithelial cells stained with the two antibodies was estimated and
separated into three groups with low, moderate, and high receptor
content (see Figure 7
).
|
The cellular distribution of fibulin-1 mRNA was analyzed with a nonisotopic in situ hybridization procedure using digoxigenin-labeled probe. A 325-mer antisense probe was chosen in the common region of fibulin-1 from nucleotides 84 to 409. Probe specificity was checked using the GeneJockey program on a Macintosh IICi computer and relative to Gene Bank nucleotide sequences.
The fibulin-1 cDNA template was synthesized by reverse transcription polymerase chain reaction (RT-PCR). One microgram of total RNA from the BG1 cell line was reverse transcribed as described.23 The PCR primers used were the 5' end primer CCGGAGTGGACGCGGATG (FibD, 84 to 102 bp) and the 3' end primer GCCAACCATGAGGCTGTACTCG (FibR, 387 to 409 bp). One microliter of the RT product was amplified by PCR in a final volume of 25 µl containing 20 mmol/L Tris/HCl (pH 8.55), 16 mmol/L (NH4)2SO4, 2.5 mmol/L MgCl2, 50 µmol/L dNTP, with 5 pmol of oligonucleotides, and 0.125 U of Taq DNA polymerase (Bioprobe, Montreuil, France). After an initial 2-minute denaturation step at 94°C, 36 rounds of PCR amplification were carried out on a DNA thermocycler (Perkin Elmer, Courtaboeuf, France). One cycle included 30 seconds denaturation at 94°C, 30 seconds annealing at 60°C, and 1 minute extension at 72°C. The samples underwent a final 7-minute extension step at 72°C. RT-PCR products were eluted from a 0.8% agarose gel using QIAquick gel extraction (QIAgen, Courtaboeuf, France) according to the manufacturer's instructions. The PCR product was then subcloned in the pGEMT plasmid (Promega, Charbonnières, France).
Digoxigenin-labeled antisense and sense RNA probes were synthesized with the Dig labeling transcription kit according to the manufacturer's instructions using T7 and SP6 RNA polymerase (Boerhringer Mannheim, Mannheim, Germany). Labeling efficiency was estimated using serial dilutions of the labeled probes that were spotted and fixed on a nylon membrane. The sense probe dilution was adjusted to the antisense probe dilution.
Adjacent 5- to 7-µm tissue sections were collected on Silane-prep slides (Sigma Diagnostics, St. Louis, MO) and fixed with paraformaldehyde (4%) in 0.1 mol/L phosphate buffer (PB; pH 7.4) at room temperature for 30 minutes. Slides were dehydrated in ethanol. In situ hybridization was performed as described.24 The antisense and sense probes were added to the tissue at a final concentration of 40 ng/µl in 20 µl of hybridization buffer. Hybridization was carried out at 42°C overnight in a humid chamber. Slides were incubated with polyclonal sheep anti-digoxigenin Fab fragments conjugated with calf intestinal alkaline phosphatase (Boehringer Mannheim), diluted 1:1000 at room temperature for 120 minutes. Color slides were developed overnight using nitroblue tetrazolium salt and 5-bromo-4-chloro-3-indoyphosphate in the presence of 24 mg/100 ml of levamisole. Slides were mounted with Glycergel (Dako, Carpinteria, CA) and stored in a dark box at 4°C.
For each sample, slides without any probe, sections hybridized with sense oligonucleotide probe, and slides treated with RNAse A before hybridization were used as nonspecific staining controls. mRNA integrity was controlled by amplification of the GAPDH housekeeping gene on adjacent sections.
Statistical Analysis
The data were analyzed using the STAT-ITCF package (Institut Technique de Céréales et des Fourrages, Paris, France).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In normal ovaries, fibulin-1 was generally weakly stained in the stroma close to surface epithelial cells and strongly stained in the vascular vessel walls.
In most ovarian tumors, fibulin-1 was found in the stroma and not in
tumor epithelial cells (Figure 1a)
. The
specificity of this stromal staining was shown using irrelevant
antibody11
(Figure 1c)
and extinction by the addition of
pure fibulin-1 in excess (Figure 1b)
.
|
.
|
. In addition, vascular vessels were strongly stained with fibulin-1
in all tumors and in normal ovaries, as previously reported for most
tissues.14 Fibulin-1 Staining Quantification
As serous ovarian carcinomas are the most common epithelial
ovarian tumors (46%),25
we quantified fibulin-1 staining
only in serous-type tumors and compared it with staining in normal
ovary. Even though the staining intensity varied for different
patients, Figure 3
is representative of
the general trend for these four types of ovarian tissues. Fibulin-1
staining was nil or weak in stroma of normal ovaries. It increased in
some cystadenomas, with stronger staining intensity close to the
basement membrane of surface epithelial cells. Staining was markedly
higher in the stroma of papillary structures of all borderline tumors,
ie, stronger under the proliferative surface epithelial cells than in
distant stroma. In serous carcinomas, it was also stronger in peritumor
stroma than in distant stroma. To assess the significance of this
apparent increase in fibulin-1 accumulation during tumor progression in
these four types of tissue, we systematically quantified fibulin-1
intensity in stroma close to surface epithelial cells and serous
carcinoma cells and compared it with intensities in distant stroma, as
described in Materials and Methods. As shown in Figures 4 and 5
, mean
fibulin-1 staining was stable in normal ovaries and in most serous
cystadenomas and not significantly higher in proximal stroma than in
distant stroma. In normal ovaries, the slightly higher intensity in
distant stroma suggests that fibulin-1 normally originates more from
blood than from surface epithelial cells.
|
|
|
, strongly suggesting that fibulin-1 characterizes a stroma
built by tumor cells. A comparison of median values for these five
types of lesions (Figure 5)
revealed a significant increased fibulin-1
staining in tumor stroma, starting in borderline tumors and reaching
maximal intensity in serous carcinomas and peritoneal metastases. This
fibronectin-binding protein was not or only slightly detected in
epithelial cells but mostly accumulated in the extracellular matrix
close to tumor cells. These results suggested that fibulin-1
overexpression during ovarian tumorigenesis originated from surface
epithelial cells and/or stromal cells surrounding the tumor. Fibulin-1
staining intensity in distant stroma was stable in premalignant lesions
but significantly increased in serous carcinomas and peritoneal
metastases (Figure 5)
. It is unknown whether fibulin-1 accumulation in
distant stroma originates from tumor cells or ascites. Fibulin-1 staining intensity was similar in the different serous carcinoma localizations (right and/or left ovary, peritoneal metastases) in the same patient but ranged from 10 to 70 arbitrary units in different patients (not shown). This suggested that increased fibulin-1 accumulation in stroma is a characteristic of epithelial tumor cells and indicated that this rapidly invasive cancer has the same clonal origin and characteristics regardless of whether it is located in the primary tumor or a peritoneal metastasis.
In Situ Hybridization of Fibulin-1 RNA
To determine the cell type expressing fibulin-1 gene, we then
performed in situ hybridization on frozen sections of some
serous ovarian tumors (cystadenomas and carcinomas). Hybridization
specificity was controlled in sections hybridized with sense
oligonucleotide probe (Figure 6, a, d, and g)
, sections without probe, and sections
treated with RNAAse A before hybridization (not shown).
|
, strong fibulin-1 mRNA expression was
detected in most epithelial cancer cells. Fibulin-1 immunostaining on
adjacent sections was strong in stroma close to cancer cells (Figure 6c)
and higher than in distant stroma, as described above in other
tumors. In one cyst, fibulin-1 expression was low in epithelial and
stromal cells (Figure 6f)
. Conversely, in another cyst, there was
strong fibulin-1 mRNA expression in the epithelial cell layer within
the cyst lumen. The stroma bordering this cyst contained many cells, as
shown by hematoxylin and eosin staining (Figure 6i)
, and was strongly
stained for fibulin-1 protein (not shown). However, only some stromal
cells expressed fibulin-1 mRNA (Figure 6h)
, indicating that fibulin-1
in this case was mostly produced by epithelial cells. Altogether, these
results demonstrated that fibulin-1 mRNA was mainly produced by tumor
epithelial cells but that accumulation of the corresponding protein in
proximal stroma was correlated with fibulin-1 mRNA expression in the
tumor. Correlation between Fibulin-1 Stromal Staining and Other Prognostic Clinico-Pathological Variables
Fibulin-1 staining intensity in tumor stroma was not correlated
with any other prognostic variables such as lymph node involvement,
histological grade, FIGO stage, or age of patients. However, most
ovarian carcinomas were graded as FIGO stage 3 or 4, whereas only two
carcinomas were stage 1 and 2, respectively. The clinical follow-up
time of 1 to 40 months was not sufficient to evaluate the putative
prognostic value of fibulin-1 staining. As fibulin-1 is known to be
induced in vitro by estradiol in ovarian cancer cell lines,
we also studied ER and PgR staining in serial sections of the same
tumors.
Estrogen Receptor-
Figure 3
(e, f, g, and h) shows one representative example of
ER staining in sections adjacent to fibulin-1 staining in normal
ovary and ovarian tumors. ER was generally weakly stained in the
nucleus of surface epithelial cells in normal ovaries. In cystadenomas
and borderline tumors, ER staining intensity and the percentage of
stained nuclei were generally higher, as summarized in Table 1
for all samples. ER staining was
generally weak in normal ovaries, even though normal surface epithelial
cells were often detached and lost.
|
shows the absence of
correlation between fibulin-1 stromal staining intensity and nuclear
ER staining in serous cystadenomas, borderline tumors, and
carcinomas. This absence of correlation was clearest in carcinomas that
most often overexpressed fibulin-1 but weakly expressed ER in 37%
of cases. When normal ovaries, cysts, and borderline tumors were
pooled, there was a trend for a positive correlation between these two
markers, as the fibulin-1 staining intensity was significantly lower in
the low ER group than in the high ER group
(P < 0.01). This suggests that fibulin-1 might
be estrogen dependent in the early steps of ovarian tumorigenesis, as
discussed later. Progesterone Receptor Staining
As shown in Table 1
, and Figure 7B
, PgR-positive cells were
significantly lower in serous carcinomas in comparison with borderline
and serous cysts. A significant inverse correlation was therefore
obtained with fibulin-1 that, conversely, increased with tumor
progression (Figure 7B)
. Carcinomas were mostly low in PgR and high in
fibulin-1, with 10 of 16 carcinomas being negative for PgR staining.
Cystadenomas had high PgR and low fibulin-1 levels, and borderline
tumors had intermediate PgR content. PgR staining was variable in the
10 normal ovaries represented in Table 1
.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
- and
PgR-positive cells in adjacent sections. The first information highlighted by our study concerns the site of fibulin-1 synthesis and accumulation in ovarian tumors. As expected on the basis of previous studies, fibulin-1 was mostly accumulated in stroma due to its high affinity to components of the extracellular matrix, and also stained vessel walls. As fibulin-1 circulates in blood12 and is secreted by ovarian epithelial cancer cell lines,8,11 we investigated whether its accumulation in stroma originated from blood, epithelial tumor cells, or stromal cells. Our finding that, in ovarian tumors, fibulin-1 staining intensity was significantly higher in stroma close to tumor cells than in distant stroma close to large vessels strongly suggested a tumor cell origin. This was demonstrated by in situ hybridization, which showed strong fibulin-1 transcript expression in the epithelial cell layer of some cystadenoma lumens and in serous ovarian cancer cells. Some stromal cells (likely fibroblasts) also expressed fibulin-1 RNA.
The fact that cellular epithelial staining of the protein was rarely obtained is in agreement with in vitro results on BG-1 cells that overexpress fibulin-1 RNA (data not shown) and secrete the corresponding protein.11 Immunostaining of fibulin-1 in these cells was positive on the fibronectin-coated substrate but weak in BG-1 cells, indicating that fibulin-1 is mainly secreted (our unpublished results). However, the additional contribution of fibroblasts in stroma close to tumors, which would be selectively stimulated by paracrine factors from cancer cells to secrete fibulin-1, is not excluded. In some cystadenomas and some borderline tumors, intense and linear fibulin-1 staining under the basal pole of surface epithelial cells indicated that fibulin-1 is a basement membrane component formed by epithelial tumor cells.
The second important finding is that fibulin-1 stromal staining close to tumor cells or surface epithelial cells progressively increased during ovarian tumor progression, starting in borderline tumors and peaking in serous ovarian cancers. The progressive accumulation of fibulin-1 during the stromal reaction of the tumor is most likely due to increased fibulin-1 gene expression, as observed here in tumor cells by in situ hybridization and as described previously in cancer cell lines.11 Further increased expression of a fibulin-1 binding protein such as fibronectin, as observed in some ovarian cancers,26 was considered. However, immunohistochemical staining of fibronectin in adjacent sections of two serous ovarian cancers showed that fibronectin and fibulin-1 were not always associated and that fibronectin was not specifically accumulated in proximal stroma, contrary to fibulin-1 (our unpublished data). The increased fibulin-1 expression and accumulation observed at the RNA and protein level in some serous cystadenomas might have prognostic significance in terms of risk markers in these cysts. This will require additional studies and clinical follow-up.
The possible consequence in tumor invasion of the increased fibulin-1 accumulation in the stroma of ovarian tumors is an interesting hypothesis. The fact that this secreted protein interacts strongly with components of the extracellular matrix suggests that it could modulate their effect on cell attachment and/or cell motility and could participate in tissue remodeling. Tenascin, another fibronectin-binding protein, was also shown to be accumulated close to breast cancer cells27,28 and associated with poor prognosis in breast cancer.28 Conversely, recent results from our laboratory showed an inhibitory effect of fibulin-1 on cancer cell motility stimulated by fibronectin in a two-chamber multi-well system,29 and others have suggested that fibulin-1 could be coded by a tumor suppressor gene.30 Investigations on mutations, loss of heterozygosity, or alternative splicing of fibulin-1 as well as clinical follow-up on a larger number of patients are required to determine whether or not local fibulin-1 overexpression interferes positively or negatively, or is only associated with ovarian tumor aggressiveness.
A third finding concerns the absence of correlation between the
estrogen-regulated fibulin-1 and ER level in ovarian tumors. This
lack of correlation was mostly observed with serous carcinomas and
suggests that at this late step of carcinogenesis, fibulin-1 may be
regulated by signals other than estrogens, eg, growth factors, as also
observed for estrogen-regulated cathepsin D in breast
cancer.31
The major involvement of ERß, which is known to
be more expressed in ovaries than ER,32
but which is not
detected by the ER antibody used in this study, should also be
considered. ER was mostly expressed in surface epithelial cells of
ovaries and also in some stromal cells. It was present in 43% of all
ovarian carcinomas, in agreement with previous studies on ER
immunohistochemical staining3,33
and the results of
cytosolic assays.3,7
However, at earlier steps of
tumorigenesis, in cystadenomas and borderline tumors, there was
concomitant increased expression of both ER and fibulin-1 relative
to normal ovaries. Moreover, the trend indicated a positive correlation
between fibulin-1 and ER in cystadenomas, and this was more
significant when the results for normal ovaries, cysts, and borderline
tumors were pooled. On the basis of the estrogen-enhanced fibulin-1
expression demonstrated in three ER-positive ovarian cancer cell
lines11
and of the mitogenic activity of estradiol in these
cells and in normal ovarian surface epithelial cells,34
it
is tempting to speculate that estrogens have the same mitogenic effect
in vivo during the early steps of ovarian tumorigenesis.
Increased local estrogenic activity, facilitated by an increased ER
content, as shown here and previously35
in some
cystadenomas and borderline tumors, may also be responsible for
fibulin-1 overexpression and secretion, thus participating in tissue
remodeling by preparing the tumor stroma. However, fibulin-1 was also
overexpressed in ER-negative serous carcinomas, explaining the lack of
correlation between these two markers at later stages of
carcinogenesis. The significant inverse correlation between two
estrogen-regulated proteins, fibulin-1 and PgR, in ER-positive cells
suggests that these two genes are differently regulated by the estrogen
receptor (different cross-talk, different ER or -ß species, and/or
different coactivators involved in these regulations?).
To conclude, this study clearly shows that fibulin-1 stromal staining in ovarian serous tumors originates at least partly from surface epithelial cells and cancer cells that produce the corresponding mRNA. Fibulin-1 overexpression and secretion at the basal pole of these cells may be associated with ovarian tumorigenesis but cannot be considered as a marker of estrogen responsiveness in ovarian cancers. Additional clinical studies and a complete understanding of fibulin-1 function in the extracellular matrix will be required to determine its significance as a prognostic marker. This study should prompt additional biological and clinical work on a larger number of patients including clinical follow-up in an attempt to determine the value of fibulin-1 as a marker of premalignant lesions and/or aggressiveness.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Supported by the Institut National de la Santé et de la Recherche Médicale, the Faculty of Medicine and University Hospital of Montpellier, the Association pour la Recherche sur le Cancer, the Groupement des Entreprises Française dans la Lutte Contre le Cancer, and the Ligue Nationale Contre le Cancer.
Accepted for publication July 22, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and ß. Endocrinology 1997, 138:863-870This article has been cited by other articles:
 |
|
 |
|
  L. Xie, K. Palmsten, B. MacDonald, M. W. Kieran, S. Potenta, S. Vong, and R. Kalluri Basement Membrane Derived Fibulin-1 and Fibulin-5 Function as Angiogenesis Inhibitors and Suppress Tumor Growth Experimental Biology and Medicine, February 1, 2008; 233(2): 155 - 162. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-H. Yi, D. J. Smith, W. W. West, and M. A. Hollingsworth Loss of Fibulin-2 Expression Is Associated with Breast Cancer Progression Am. J. Pathol., May 1, 2007; 170(5): 1535 - 1545. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Xiang, T. Sekine, H. Nakamura, S. Imajoh-Ohmi, H. Fukuda, K. Yudoh, K. Masuko-Hongo, K. Nishioka, and T. Kato Fibulin-4 is a target of autoimmunity predominantly in patients with osteoarthritis. J. Immunol., March 1, 2006; 176(5): 3196 - 3204. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Kania, D. Corbeil, J. Fuchs, K. V. Tarasov, P. Blyszczuk, W. B. Huttner, K. R. Boheler, and A. M. Wobus Somatic Stem Cell Marker Prominin-1/CD133 Is Expressed in Embryonic Stem Cell-Derived Progenitors Stem Cells, June 1, 2005; 23(6): 791 - 804. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Bardin, F. Moll, R. Margueron, C. Delfour, M. L. Chu, T. Maudelonde, V. Cavailles, and P. Pujol Transcriptional and Posttranscriptional Regulation of Fibulin-1 by Estrogens Leads to Differential Induction of Messenger Ribonucleic Acid Variants in Ovarian and Breast Cancer Cells Endocrinology, February 1, 2005; 146(2): 760 - 768. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Blackburn, E. E. Tarttelin, C. Y. Gregory-Evans, M. Moosajee, and K. Gregory-Evans Transcriptional Regulation and Expression of the Dominant Drusen Gene FBLN3 (EFEMP1) in Mammalian Retina Invest. Ophthalmol. Vis. Sci., November 1, 2003; 44(11): 4613 - 4621. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. P. Schiemann, G. C. Blobe, D. E. Kalume, A. Pandey, and H. F. Lodish Context-specific Effects of Fibulin-5 (DANCE/EVEC) on Cell Proliferation, Motility, and Invasion. FIBULIN-5 IS INDUCED BY TRANSFORMING GROWTH FACTOR-beta AND AFFECTS PROTEIN KINASE CASCADES J. Biol. Chem., July 19, 2002; 277(30): 27367 - 27377. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. E. Owens, R. A. Keri, and J. H. Nilson Ovulatory Surges of Human CG Prevent Hormone-Induced Granulosa Cell Tumor Formation Leading to the Identification of Tumor-Associated Changes in the Transcriptome Mol. Endocrinol., June 1, 2002; 16(6): 1230 - 1242. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
