| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Developmental Biology Center,*
University of
California-Irvine, Irvine, California and the Department of
Pathology,
St. Joseph Hospital,
Orange, California
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
ZO-1, a human MAGUK, is a critical regulator of epithelial tight junctions.3 The structural and functional similarity of ZO-1 to Dlg suggests that it could play a significant role in cell proliferation and epithelial cancers. ZO-1 interacts directly with the transmembrane protein occludin, with ZO-2 (another MAGUK) and AF-6, a target of the ras oncogene which is involved in acute myeloid leukemia.7-10 ZO-1 has been shown to be down-regulated in poorly differentiated, highly invasive breast cancer cell lines11 and the gene encoding ZO-1, tjp-1, is found near a genomic interval showing frequent (70%) loss of heterozygosity (LOH) in metastatic breast tumors.12,13
To explore the possible role of ZO-1 in breast cancer, we characterized ZO-1 protein expression and localization in paraffin-embedded tumor samples using immunohistochemistry, and tested for LOH of polymorphic markers flanking tjp-1. Our results indicate that the majority of breast tumors show reduction or loss of ZO-1 expression, but that this is associated with LOH near tjp-1 in only a fraction of cases. The expression of E-cadherin, another junction-associated molecule that is known to be down-regulated in breast cancer,14 was also analyzed in the same samples.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Formalin-fixed, paraffin-embedded, archived breast tumor samples were collected from the University of California-Irvine Department of Medicine, Division of Epidemiology, the University of Michigan Department of Pathology, Ann Arbor, MI and the St. Joseph's Hospital Department of Pathology (Orange, CA). Samples were accompanied by pathology reports, which were corroborated by a pathologist (S-YL).
Immunohistochemical Detection of ZO-1 and E-cadherin
To examine protein expression in situ, paraffin-embedded sections were analyzed by double labeling with fluorochrome-labeled secondary antibodies according to Harlow and Lane.15 Additions to this protocol included deparaffination of tissue and antigen retrieval. For deparaffination, sequential washes in HemoD were used (Fischer, Pittsburgh, PA) followed by hydration with a decreasing ethanol series and a wash in TBS solution (100 mmol/L Tris, 0.9% NaCl, pH 7.5). For antigen retrieval, a pressure cooker was used to boil sections in 6.5 mmol/L of sodium citrate (pH 6.0) for 5 minutes (JM Anderson, personal communication).
Antibodies used were rabbit anti-ZO-1 pAb (ZyMed, San Francisco, CA) at 1:400 dilution; mouse anti-E-cadherin pAb (ZyMed) at 1:400 dilution; DTAF-labeled donkey anti-rabbit IgG (Jackson ImmunoResearch Laboratories, West Grove, PA) at 1:500 dilution; Cy3-labeled sheep anti-mouse IgG (Jackson ImmunoResearch) at 1:500 dilution. ToPro II (Molecular Probes Inc., Eugene, OR) was used to stain DNA.
The tissue sections were observed using an MRC 1024 Bio-Rad/Nikon Diaphot 200 laser-scanning confocal microscope and LaserSharp image analysis software (Bio-Rad Microscience Division, Cambridge, MA).
Evaluation of ZO-1 and E-cadherin Staining
Within each patient biopsy, the intensity of ZO-1 and E-cadherin
staining in breast tumors was compared to that seen in normal glands or
ducts present in the same tissue (Figure 1)
. The level of expression was
characterized semiquantitatively according to the number of positive
cells. When >10% of cells stained positively the tumor was defined as
Positive (Figure 1B)
. When up to 10% of cells stained positively the
tumor was defined as Reduced (Figure 1C)
. When epithelial
cells that normally stain showed no staining, the tumor was defined as
Negative (Figure 1D)
. Reduced and negative tumors were grouped together
as Rd type for statistical analysis.
|
The ZO-1 gene tjp-1, was precisely mapped using the
Stanford G3 and Whitehead G4 radiation hybrid panels (Research
Genetics, Huntsville, AL). The following tjp-1-specific
primers were used for amplification: 5' primer
ACCATCATTGTCGTCGCATGTAGATCC and 3' primer GATGCTCTAGGTGCCTGTTCGTAACG.
Reactions were done in duplicate with 20 ng of DNA, Taq DNA polymerase
buffer (20 mmol/L Tris-HCl (pH 8.4), 50 mmol/L KCl, 2.5 mmol/L
MgCl2), 2.5 mmol/L dNTPs, and 2.5 units recombinant Taq DNA
polymerase (Gibco BRL, Gaithersburg, MD). The samples were subjected to
35 cycles of denaturation (30 seconds at 95°C), annealing (1 minute
at 60°C), and extension (2 minutes at 72°C). The resulting binary
code of positive and negative radiation hybrid clones was sent to
Stanford (G3 hybrid panel; http://shgc.stanford.edu/) or the Whitehead
Institute at MIT (G4 hybrid panel; http://www.genome.wi.mit.edu/) and a
physical distance in centirads (cR) from specific DNA markers was
returned. The same procedure was used to map several polymorphic
markers (Table 1)
and to determine
their position relative to tjp-1. To determine the
approximate physical distances in megabases (Mb) between
tjp-1 and mapped markers, distances were determined using a
published chromosome-specific centirad to Mb conversion.16
|
To test for LOH of polymorphic markers linked to tjp-1,
DNA was extracted from 26 patient samples. With a razor blade, tumor
and normal tissue were dissected from paraffin sections. A method using
microwave and proteinase K treatment was used to extract DNA from the
paired samples.17
5' primers of the polymorphic markers
(Table 1)
were labeled with FITC. An
internal amplification control was used with primers specific for 5'
UTR of human skeletal 
-actin (5' primer
FITC-FACTTTCCGTTGCTGCCATCGTAA and 3' primer CACTCCCGCCCCAAGCAAATAAAC).
The DNA was polymerase chain reaction (PCR)-amplified using
approximately 20 ng of extracted DNA and thermocycled at either 33
cycles of 1 minute annealing and extension (D15S1019, D15S165, Actin)
or 33 cycles at 57°C for 30 seconds annealing and 72°C for 30
seconds extension (D15S122, Actin 1). Amplified DNA was electrophoresed
on an A.L.F. Pharmacia automated sequencer (Pharmacia Biotech, Uppsala,
Sweden) and electropherograms18
were generated by the
A.L.F. Manager 2.6 Pharmacia software package (Pharmacia Biotech).
Patients were scored as informative for a polymorphic marker if their
DNA was effectively amplified and their normal DNA was heterozygous.
LOH was characterized according to published methods.18,19
A decrease of 50% or more in peak area indicated LOH. PCR and analysis
of electropherograms was repeated four times for each sample.
Histopathological Findings and Statistical Analysis
An adjacent section from each tumor sample (Figure 1, E–H)
was
stained with hematoxylin-eosin for histological evaluation. Each tumor
was accompanied by a patient clinical history and pathology report. A
pathologist (S-YL) reviewed the reports and confirmed the reported
findings. The clinicopathological stage of the tumors was classified
according to the TNM classification system of the Union Internationale
Contre le Cancer.20
Their histological type was
evaluated based on the World Health Organization
classification21
and their histological degree of
differentiation was also graded using a modification of the Scarff and
Handley/Bloom and Richardson system as described by Elston and
Ellis.22
The 
2
test (Fischer's exact test 2-tail) and trend
analysis (with the well-differentiated grade and glandular
differentiation of 1 as the baseline categories) were used to determine
statistical significance.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
As expected because of its association with tight junctions, ZO-1
staining was intense at the apicolateral boundary of epithelial cells
in normal mammary ducts and glands (Figure 1A)
. Nonepithelial cells
also expressed ZO-1 in their cytoplasm (Figure 1A)
. In contrast to
normal epithelium, cancer tissue showed a variety of ZO-1 staining
levels (Figure 1, B–D)
. Thirty-eight infiltrating ductal carcinomas
(IDC), 5 ductal carcinomas in situ, 3 infiltrating lobular
and 2 infiltrating lobular carcinomas in situ were analyzed.
Of these 48 primary tumors, 15 (31.2%) were classified as positive and
33 (68.8%) were classified as showing the Rd type of expression (Table 2)
.
|
The relationship between ZO-1 expression and histopathology is
shown in Table 2
. There was a statistically significant trend toward
reduced ZO-1 staining in more poorly differentiated tumors. Comparing
well differentiated tumors to moderately differentiated tumors and
moderately differentiated to poorly differentiated revealed a
progressive reduction in the frequency of positive ZO-1 staining (Table 2
; P = .0093). There was also a statistically
significant difference in the numbers of ZO-1 Positive compared to Rd
tumors in both moderate and poorly differentiated groups (Table 2
,
P = .011). Thus, reduced ZO-1 staining was directly
correlated with the loss of differentiation in breast cancer tumors.
Of the three aspects of tumor differentiation—glandular
differentiation, mitotic index, and nuclear grade—only glandular
differentiation was correlated with ZO-1 expression. Comparison of
tumors with Scarff-Bloom-Richardson glandular differentiation scores of
1 to 2 to those with scores of 2 to 3 showed a statistically
significant trend towards decreasing ZO-1 expression with greater loss
of glandular differentiation (P = .0093). There
was also a significant difference in the number of ZO-1 Positive and Rd
tumors as a function of glandular differentiation score (Table 2
,
P = .0019). This correlation was found within
individual tumors as well. Glandular structures within tumors were
positive for ZO-1 staining regardless of overall tumor differentiation
(Figure 1B
, arrow, and data not shown). All infiltrating lobular
carcinomas examined in this study (n = 3)
completely lacked ZO-1 expression (Table 2)
. This tumor type lacks, in
general, glandular structure.23
Thus, Rd-type ZO-1
expression in tumors of poor differentiation correlated directly and
specifically with decreased glandular differentiation. No significant
correlations were found between tumor size or lymph node invasion and
ZO-1 staining.
Correlation of ZO-1 and E-Cadherin Staining
E-cadherin expression in tumors was also analyzed (Table 2)
. 80%
of E-cadherin Rd tumors were ZO-1 negative and all E-cadherin negative
tumors were ZO-1 negative (Table 2)
. The correlation of ZO-1 Rd
staining with E-cadherin Rd staining was statistically significant
(P = 4.9 x 10-5).
Furthermore, there was frequent overlap between ZO-1 and
E-cadherin near the apicolateral cell borders in normal and tumor
tissue. Whereas this was somewhat more pronounced in tumors, suggesting
delocalization of one or both of the proteins, it was sometimes
apparent in normal tissue as well (compare yellow color in Figure 1A and 1B
). Unlike ZO-1, E-cadherin immunostaining showed no significant
correlation with tumor differentiation.
Precise ZO-1 Mapping and Loss of Heterozygosity
The ZO-1 locus tjp-1 had been physically mapped to
chromosome band 15q13 before this study.12
To test for LOH,
we undertook more precise mapping by PCR using
tjp-1-specific primers and two radiation-hybrid panels.
tjp-1-positive radiation hybrid clones were reported to the
Stanford and Whitehead Institute Genome Centers and a map position
relative to other markers was provided by the Centers. tjp-1
mapped approximately 100 kb from WI-5590 (data not shown) and 1.4 Mb
from the dinucleotide-repeat polymorphic marker D15S165 (Table 1)
.
Other polymorphic markers flanking tjp-1 were mapped to the
radiation-hybrid panels and their relative positions were approximated
in this manner (Table 1)
. D15S165, D15S1019, and D15S122 were used to
analyze LOH in the vicinity of tjp-1 in DNA extracted from
26 paired normal and tumor samples. Three of 13 informative cases
(23%) showed LOH for the D15S1019 marker. In these three cases, there
was a significant decrease in the peak size of one allele in the
neoplastic component of the tumor (compare Figure 2C to F
igure 2D). This peak size decrease indicates LOH of the
marker.18,19
All three cases with LOH had Rd type ZO-1
staining and poor glandular differentiation (Figure 2
and data not
shown).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The differentiation of infiltrating ductal carcinomas is defined
routinely by characterizing three elements of the tumor phenotype:
gland (tubule) differentiation, nuclear grade, and mitotic
index.22,26
In the present study, the decrease in ZO-1
staining was significantly and specifically correlated with a decrease
in the glandular differentiation of the tumor. This correlation was
reflected by the absence of ZO-1 staining in infiltrating lobular
carcinomas, which largely lack glandular structure, and nearly
two-thirds of IDC samples with poor glandular differentiation (Table 2)
. The correlation is probably even stronger than suggested by the
statistics because the Scarff-Bloom-Richardson staging system
quantifies the amount of glandular structure for the entire tumor and
does not account for the variability of glandular phenotype within the
tumor. ZO-1 staining was evident in parts of the tumors that contain
glandular structures, regardless of overall tumor differentiation
(Figure 1B
, arrow, and data not shown). This correlation of ZO-1
staining with the glandular phenotype of breast tumors is consistent
with evidence showing that several properties of differentiated
epithelium, including paracellular permeability and tight junction
structure, are regulated by ZO-1.24,27,28
We have also documented a significant correlation between reduced
E-cadherin and reduced ZO-1 expression in breast cancer samples. All of
those tumors that were E-cadherin negative were also ZO-1 negative
(Table 2)
. A role for E-cadherin in regulating ZO-1 is supported by the
finding that E-cadherin-based adhesion is required for proper ZO-1
localization at the tight junction of kidney epithelial cell
lines.29
In this study we noted frequent overlap between
ZO-1 and E-cadherin staining indicated by yellow signal in the confocal
micrographs (Figure 1)
. However, this does not necessarily indicate the
presence of both proteins in the same domain of the plasma membrane,
since each of our images represents stacked laser scans though a
thickness of approximately 10 µm.
The interrelationship between ZO-1 and E-cadherin is potentially significant given the down-regulation and mutation of E-cadherin in breast cancer.14,30 Because of E-cadherin's crucial role in regulating cell-cell adhesion, it has been postulated that the loss of functional protein results in more invasive and metastatic tumor cells.31 While no clear mechanism for this function of E-cadherin has been characterized, the interaction of E-cadherin with ß-catenin, which is often mutated in colon cancer, could be involved.32,33 A recent study showing that ZO-1 also interacts with the catenin proteins29 raises the possibility that ZO-1 could function downstream of E-cadherin in an adhesion-dependent signaling pathway.
To begin characterizing the mechanism for decreased ZO-1 staining in breast tumors, genetic changes in the ZO-1 locus, tjp-1, were analyzed using a PCR-based LOH assay.18,19 One tjp-1-linked marker showed 23% LOH. This suggests LOH is one mechanism of ZO-1 protein loss. Other mechanisms could include point mutation and hypermethylation, both of which have been described for E-cadherin.30,34 The percentage of LOH observed in this study is higher than that reported by Wick et al,13 who found 11% LOH of markers near tjp-1 in nonmetastatic tumors of the breast. However, Wick et al also showed 70% LOH of the same markers in breast cancer metastases to the brain, suggesting the possibility that tjp-1 LOH and ZO-1 loss may be especially significant in allowing metastasis.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Supported by U.S. Public Health Service-National Institutes of Health National Cancer Institute Grant CA-70557.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  S. Tuomi, A. Mai, J. Nevo, J. O. Laine, V. Vilkki, T. J. Ohman, C. G. Gahmberg, P. J. Parker, and J. Ivaska PKC{varepsilon} Regulation of an {alpha}5 Integrin-ZO-1 Complex Controls Lamellae Formation in Migrating Cancer Cells Sci. Signal., June 30, 2009; 2(77): ra32 - ra32. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-C. Chao, S.-H. Pan, S.-C. Yang, S.-L. Yu, T.-F. Che, C.-W. Lin, M.-S. Tsai, G.-C. Chang, C.-H. Wu, Y.-Y. Wu, et al. Claudin-1 Is a Metastasis Suppressor and Correlates with Clinical Outcome in Lung Adenocarcinoma Am. J. Respir. Crit. Care Med., January 15, 2009; 179(2): 123 - 133. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. S. Balda and K. Matter Tight junctions at a glance J. Cell Sci., November 15, 2008; 121(22): 3677 - 3682. [Full Text] [PDF]
|
|
|
|
 |
|
 M. Zhao, P. Szafranski, C. A. Hall, and S. Goode Basolateral Junctions Utilize Warts Signaling to Control Epithelial-Mesenchymal Transition and Proliferation Crucial For Migration and Invasion of Drosophila Ovarian Epithelial Cells Genetics, April 1, 2008; 178(4): 1947 - 1971. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Matter and M. S. Balda Epithelial tight junctions, gene expression and nucleo-junctional interplay J. Cell Sci., May 1, 2007; 120(9): 1505 - 1511. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Zhang, S. Yeh, B. A. Appleton, H. A. Held, P. J. Kausalya, D. C. Y. Phua, W. Lee Wong, L. A. Lasky, C. Wiesmann, W. Hunziker, et al. Convergent and Divergent Ligand Specificity among PDZ Domains of the LAP and Zonula Occludens (ZO) Families J. Biol. Chem., August 4, 2006; 281(31): 22299 - 22311. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. McNeil, C. T. Capaldo, and I. G. Macara Zonula Occludens-1 Function in the Assembly of Tight Junctions in Madin-Darby Canine Kidney Epithelial Cells Mol. Biol. Cell, April 1, 2006; 17(4): 1922 - 1932. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Polette, C. Gilles, B. Nawrocki-Raby, J. Lohi, W. Hunziker, J.-M. Foidart, and P. Birembaut Membrane-Type 1 Matrix Metalloproteinase Expression Is Regulated by Zonula Occludens-1 in Human Breast Cancer Cells Cancer Res., September 1, 2005; 65(17): 7691 - 7698. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. S.M. Smalley, P. Brafford, N. K. Haass, J. M. Brandner, E. Brown, and M. Herlyn Up-Regulated Expression of Zonula Occludens Protein-1 in Human Melanoma Associates with N-Cadherin and Contributes to Invasion and Adhesion Am. J. Pathol., May 1, 2005; 166(5): 1541 - 1554. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. J. Mandell, B. A. Babbin, A. Nusrat, and C. A. Parkos Junctional Adhesion Molecule 1 Regulates Epithelial Cell Morphology through Effects on {beta}1 Integrins and Rap1 Activity J. Biol. Chem., March 25, 2005; 280(12): 11665 - 11674. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Bordin, F. D'Atri, L. Guillemot, and S. Citi Histone Deacetylase Inhibitors Up-Regulate the Expression of Tight Junction Proteins Mol. Cancer Res., December 1, 2004; 2(12): 692 - 701. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M Lacroix, R-A Toillon, and G Leclercq Stable 'portrait' of breast tumors during progression: data from biology, pathology and genetics Endocr. Relat. Cancer, September 1, 2004; 11(3): 497 - 522. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Bazzoni and E. Dejana Endothelial Cell-to-Cell Junctions: Molecular Organization and Role in Vascular Homeostasis Physiol Rev, July 1, 2004; 84(3): 869 - 901. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Zhu, J. Maric, M. Nilsson, M. Brannstrom, P.-O. Janson, and K. Sundfeldt Formation and Barrier Function of Tight Junctions in Human Ovarian Surface Epithelium Biol Reprod, July 1, 2004; 71(1): 53 - 59. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Yoshida, W. Cheng, J. Hung, D. Montell, E. Geisbrecht, D. Rosen, J. Liu, and H. Naora Lessons from border cell migration in the Drosophila ovary: A role for myosin VI in dissemination of human ovarian cancer PNAS, May 25, 2004; 101(21): 8144 - 8149. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Szafranski and S. Goode A Fasciclin 2 morphogenetic switch organizes epithelial cell cluster polarity and motility Development, May 1, 2004; 131(9): 2023 - 2036. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. G. Oshima, J. Lesperance, V. Munoz, L. Hebbard, B. Ranscht, N. Sharan, W. J. Muller, C. A. Hauser, and R. D. Cardiff Angiogenic Acceleration of Neu Induced Mammary Tumor Progression and Metastasis Cancer Res., January 1, 2004; 64(1): 169 - 179. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Quan and S.-J. Lu Identification of genes preferentially expressed in mammary epithelial cells of Copenhagen rat using subtractive hybridization and microarrays Carcinogenesis, October 1, 2003; 24(10): 1593 - 1599. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Anders, C. Christian, M. McMahon, F. McCormick, and W. M. Korn Inhibition of the Raf/MEK/ERK Pathway Up-Regulates Expression of the Coxsackievirus and Adenovirus Receptor in Cancer Cells Cancer Res., May 1, 2003; 63(9): 2088 - 2095. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Anders, R. Hansen, R.-X. Ding, K. A. Rauen, M. J. Bissell, and W. M. Korn Disruption of 3D tissue integrity facilitates adenovirus infection by deregulating the coxsackievirus and adenovirus receptor PNAS, February 18, 2003; 100(4): 1943 - 1948. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. S. Balda, M. D. Garrett, and K. Matter The ZO-1-associated Y-box factor ZONAB regulates epithelial cell proliferation and cell density J. Cell Biol., February 3, 2003; 160(3): 423 - 432. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. A. Watson, T. P. Rollason, G. M. Reynolds, P. G. Murray, L. Banks, and S. Roberts Changes in expression of the human homologue of the Drosophila discs large tumour suppressor protein in high-grade premalignant cervical neoplasias Carcinogenesis, November 1, 2002; 23(11): 1791 - 1796. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Lamorte, I. Royal, M. Naujokas, and M. Park Crk Adapter Proteins Promote an Epithelial-Mesenchymal-like Transition and Are Required for HGF-mediated Cell Spreading and Breakdown of Epithelial Adherens Junctions Mol. Biol. Cell, May 1, 2002; 13(5): 1449 - 1461. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Mauro, M. Bartucci, C. Morelli, S. Ando', and E. Surmacz IGF-I Receptor-induced Cell-Cell Adhesion of MCF-7 Breast Cancer Cells Requires the Expression of Junction Protein ZO-1 J. Biol. Chem., October 19, 2001; 276(43): 39892 - 39897. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X.-j. Yi, Y. Wang, and F.-S. X. Yu Corneal Epithelial Tight Junctions and Their Response to Lipopolysaccharide Challenge Invest. Ophthalmol. Vis. Sci., December 1, 2000; 41(13): 4093 - 4100. [Abstract] [Full Text]
|
|
|
|
|
|
V. Ruotsalainen, J. Patrakka, P. Tissari, P. Reponen, M. Hess, M. Kestila, C. Holmberg, R. Salonen, M. Heikinheimo, J. Wartiovaara, et al. Role of Nephrin in Cell Junction Formation in Human Nephrogenesis Am. J. Pathol., December 1, 2000; 157(6): 1905 - 1916. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Reichert, T. Muller, and W. Hunziker The PDZ Domains of Zonula Occludens-1 Induce an Epithelial to Mesenchymal Transition of Madin-Darby Canine Kidney I Cells. EVIDENCE FOR A ROLE OF beta -CATENIN/Tcf/Lef SIGNALING J. Biol. Chem., March 24, 2000; 275(13): 9492 - 9500. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Gaudet, D. Branton, and R. A. Lue Characterization of PDZ-binding kinase, a mitotic kinase PNAS, May 9, 2000; 97(10): 5167 - 5172. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
