| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Environmental Immunology Laboratory,*
the
Environmental Carcinogenesis Program,
and the
Environmental Toxicology Program,¶
National
Institute of Environmental Health Sciences, National Institutes of
Health, Research Triangle Park, North Carolina; the Department of
Dermatology,
Kao-Hsiung Medical College,
Kao-Hsiung, Taiwan; the Toxicology and Molecular Biology
Branch,§
National Institute for Occupational
Safety and Health, Morgantown, West Virginia; and the Department of
Environmental Health,||
Tokai University, School of
Medicine, Kanagawa, Japan
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, promote the formation of
skin tumors, we hypothesized that similar events may be
responsible for those associated with arsenic skin diseases.
Thus, the influence of arsenic in humans with arsenic skin
disease and on mouse skin tumor development in transgenic mice was
studied. After low-dose application of tetradecanoyl phorbol acetate
(TPA), a marked increase in the number of skin papillomas
occurred in Tg.AC mice, which carry the v-Ha-ras
oncogene, that received arsenic in the drinking water as
compared with control drinking water, whereas no papillomas
developed in arsenic-treated transgenic mice that did not receive TPA
or arsenic/TPA-treated wild-type FVB/N mice. Consistent with earlier
in vitro findings, increases in
granulocyte/macrophage colony-stimulating factor (GM-CSF) and TGF-
mRNA transcripts were found in the epidermis at clinically normal sites
within 10 weeks after arsenic treatment. Immunohistochemical staining
localized TGF- overexpression to the hair follicles. Injection of
neutralizing antibodies to GM-CSF after TPA application reduced the
number of papillomas in Tg.AC mice. Analysis of gene expression in
samples of skin lesions obtained from humans chronically exposed to
arsenic via their drinking water also showed similar alterations in
growth factor expression. Although confirmation will be required in
nontransgenic mice, these results suggest that arsenic enhances
development of skin neoplasias via the chronic stimulation of
keratinocyte-derived growth factors and may be a rare example of a
chemical carcinogen that acts as a co-promoter.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Although several hypotheses have been proposed for the mechanism of arsenic-induced carcinogenesis, it remains unknown, with limited evidence available for either genetic or epigenetic mechanisms. Arsenic neither promotes neoplastic disease in classical single- or two-stage murine models9-11 nor is mutagenic.12 Support exists that increased cell proliferation is a central event, as treatment of human keratinocytes with arsenic induces ornithine decarboxylase activity13 and growth factor expression14 as well as alters the DNA-binding activities of the AP-1 and AP-2 transcription factors, which are involved in proliferative events.15,16 Furthermore, treatment of in vitro skin models with arsenic induces keratins associated with proliferation and acanthosis.17 At the genetic level, arsenic is co-mutagenic with ultraviolet radiation, x-rays, or alkylating agents, induces sister chromatid exchange in lymphocytes,18 and causes gene amplification in mouse 3T3 cells.19 Genetic studies have focused recently on alterations in methylation patterns by arsenic, suggesting that DNA hyper- or hypomethylation may lead to altered gene expression, particularly in the p53 tumor suppressor gene.20,21 In this respect, authors from the present study have shown that high levels of immunoreactive p53 are expressed in Bowen's disease skin biopsies.6
Previously, observations that addition of low concentrations of arsenic
to human keratinocyte cultures resulted in the overexpression of
several cytokines and growth factors,14
including
transforming growth factor (TGF)- and granulocyte/macrophage
colony-stimulating factor (GM-CSF), suggested their involvement in
arsenic-mediated skin diseases. Although secretion of these products
from keratinocytes are critical to maintaining homeostasis and barrier
integrity in the skin,22
their overexpression can lead to
various pathological processes, such as allergic contact dermatitis,
irritant contact dermatitis, psoriasis, and neoplasia. In particular,
overexpression of TGF-, and to a lesser extent GM-CSF, has been
associated with neoplastic transformation in the skin,23,24
and keratinocytes transfected with a constitutive TGF- transgene
develop benign skin papillomas when grafted to nude mice.25
Injection of TGF- into initiated mouse skin induces DNA synthesis in
epidermal cells, an activity analogous to early tumor
formation,26
and targeted overexpression of TGF- to the
epidermis elicits hyperplasia, hyperkeratosis, and spontaneous squamous
cell carcinomas.27,28
Recent studies have demonstrated that
TGF- can synergize with c-myc to accelerate spontaneous and
chemical-induced neoplastic development.29-31
Furthermore,
TGF- transgenic mice exhibit keratinocyte hyperproliferation and
tumors in the pancreas, liver, and mammary epithelia,32-34
suggesting that TGF- overexpression has the unique ability to
complement both initiation and promotion by serving as a tumor enhancer
or co-promoter. However, TGF- may not be a strict requirement for
papilloma formation as TGF- null mice may develop papillomas at the
same incidence and multiplicity as that induced in the wild
type.35
Based on the aforementioned observations and our previous in vitro studies using primary human keratinocytes, we hypothesized that arsenic induces tumorigenesis by modulation of keratinocyte-derived growth-promoting cytokines leading to enhanced cell proliferation. To address this question, a model was developed using the transgenic mouse line Tg.AC, which has been used previously to evaluate the carcinogenic potential of a number of topically administered chemicals.36 Additional studies were conducted to examine gene expression in skin samples from individuals chronically exposed to high levels of arsenic in their drinking water.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Female, homozygous Tg.AC mice containing the fetal beta-globin
promoter fused to the v-Ha-ras structural gene (with
mutations at codons 12 and 59) and linked to a simian virus 40
polyadenylylation/splice sequence37
and nontransgenic FVB/N
mice were obtained from Taconic Farms (Germantown, NY). Mice were
maintained in our animal facility in compliance with approved
guidelines for the humane treatment of laboratory animals and were fed
Purina Pico Chow 5058 and water ad libitum. Groups of
8-week-old, age- and sex-matched wild-type FVB/N or Tg.AC transgenic
mice were provided 0.02% arsenic as sodium arsenite (Sigma Chemical
Co., St. Louis, MO) in their drinking water. Four weeks later, the
dorsal skin was shaved with electric clippers, and 72 hours later the
first of four doses (twice a week for 2 weeks) of 12-O-tetradecanoyl
phorbol-13-acetate (TPA; Sigma Chemical Co.) was applied topically in
200 µl of acetone. Animals were shaved thereafter during TPA dosing
as needed. Groups of control and arsenic-treated transgenic mice were
administered intravenous injections of 50 µg of either monoclonal
antibodies to mouse GM-CSF (Genzyme, Cambridge, MA) 2 weeks before TPA
treatment, 2 hours before application of TPA, and 2 weeks after TPA
treatment or polyclonal antibodies to mouse TGF- (Peninsula
Laboratories, Belmont, CA) 2 hours before application of TPA. Papilloma
incidents were recorded three times per week for 20 weeks. For cell
proliferation studies, animals were injected with 50 mg/kg
bromodeoxyuridine (BrdU) 30 minutes before sacrifice. Animals were
euthanized using CO2 narcosis, and skin samples were
collected.
Human Skin Samples
Human skin samples were obtained from volunteers residing in the Pa Chang Valley on the Southwest Coast of Taiwan where arsenic concentrations in the well water reached levels as high as 1.82 ppm.38 Biopsies (3 mm2) were aseptically obtained using a punch. For each individual, samples were obtained from nonlesioned areas and areas displaying evidence of arsenic-induced hyperpigmentation and hyperkeratosis. The nonlesioned skin samples served as controls. The samples were shipped in dry ice and stored at -70°C before RNA isolation.
RNA Extraction and Reverse Transcription Polymerase Chain Reaction
Human and mouse skin samples (shaved dorsal area) were homogenized
in a small volume of RNAzol B solution (Biotecx Laboratories, Houston,
TX), and total cellular RNA was extracted according to the
manufacturer's instructions. For analysis of cytokine/growth factor
gene expression, human and mouse RNA from human skin was further
processed with poly A to isolate mRNA.14
Synthesis of cDNA
was performed as previously described14
using 1 to 3 µg
of total or mRNA from each sample. Commercially available polymerase
chain reaction (PCR) primers for human GM-CSF, tumor necrosis factor
(TNF)-, TGF-, and glyceraldehyde-3-phosphate dehydrogenase
(G3PDH) and mouse GM-CSF, c-myc, and G3PDH were purchased from Clontech
Laboratories (Palo Alto, CA). Commercially available PCR primers for
mouse TNF- and epidermal growth factor receptor (EGFR) were
purchased from Stratagene (La Jolla, CA). The sequence for the mouse
TGF- primer, obtained from GenBank and synthesized by Bioserve
Biotechnologies (Gaithersburg, MD), contained the following sequence:
5' GGACAGCTCGCTCTGCTAGCG 3' and 5' CTTCTCGTGTCTGCAGACGAG 3' (amplified
PCR fragment, 410 bp).
Five-microliter aliquots of the synthesized cDNA (corresponding to 1 to 3 µg of RNA) were added to 45 µl of PCR mix containing 5 µl of 10X PCR buffer, 1 µl of deoxynucleotides (1 mmol/L each), 0.5 µl of sense and antisense primers (0.15 µmol/L), and 0.25 µl of DNA polymerase (GeneAmp PCR, Perkin Elmer Cetus, Norwalk, CT). The reaction mixture was covered with an Ampli(Gem) wax tablet (Perkin Elmer Cetus). Amplification was initiated by 1 minute of denaturation at 94°C for 1 cycle followed by 25, 30, or 35 cycles at 94°C for 30 seconds, 55°C for 30 seconds, and 55°C for 1 minute using a GeneAmp PCR System 9600 DNA Thermal Cycler (Perkin Elmer Cetus). After the last cycle of amplification, the samples were incubated for 7 minutes at 72°C. RNA concentrations and PCR cycles were titrated to establish standard curves, to document linearity, and to permit semiquantitative analysis of signal strength as previously described.14 For each set of primers, dilutions of cDNA were amplified for 20, 23, 25, 28, 30, 33, and 35 cycles, and PCR conditions were optimized with a commercially available kit (Stratagene) to define optimal conditions. When appropriate, the specificity of the PCR bands was confirmed by restriction enzyme analysis of the amplified cDNA, which generated restriction fragments of the expected size (data not shown). RNA isolation and PCR amplification to evaluate expression of the Tg.AC transgene was performed as previously described.35
The PCR products were visualized by ultraviolet illumination after electrophoresis through 2.0% agarose (UltraPure, Sigma) at 60 V for 80 minutes and staining in Tris borate/EDTA buffer (89 mmol/L Tris, 89 mmol/L boric acid, 2.5 mmol/L EDTA, pH 8.2) containing 0.5 µg/ml ethidium bromide. Gels were photographed with type 55 positive/negative film (Polaroid, Cambridge, MA). The films were analyzed using the Eagle Eye II Image Analysis System (Stratagene) and NIH Image 1.54 software, and the area under the curve was normalized for G3PDH content.
Immunohistochemistry and Histology
Frozen sections of skin, 6 µm thick, were cut and placed onto
positively charged slides prepared for immunohistochemistry. Slides
were pretreated with normal goat serum for 30 minutes and incubated for
4 hours at 4°C with a 1:50 dilution of polyclonal anti-mouse TGF-
antibody (Peninsula Labs) followed by an additional 1 hour with a 1:100
dilution of goat anti-rabbit IgG biotinylated antibody (Vector
Laboratories, Burlingame, CA). For BrdU and hematoxylin and eosin (H&E)
staining, samples of dorsal skin from control and arsenic-treated mice
were preserved in 10% buffered formaldehyde, and paraffin-embedded
tissue sections (5 to 6 µm thick) were prepared. For BrdU staining,
slides containing three sections of skin from each animal were
deparaffinized and hydrated with Automation buffer (Biomeda,
Burlingame, CA). The slides were incubated in 2 N HCL for 30 minutes at
37°C and neutralized in borate buffer. The BrdU antigenic sites were
unmasked by digestion of the sections in 0.01% trypsin in 1%
CaCl2 at 37°C for 3 minutes. Endogenous peroxidase
activity was blocked by incubation with 3%
H2O2 for 15 minutes. Sections were incubated
with a 1:50 dilution of monoclonal anti-BrdU antibody (Becton
Dickinson, Mountain View, CA) for 30 minutes followed by incubation for
20 minutes with a 1:100 dilution of biotinylated horse anti-mouse IgG
(Vector Laboratories). BrdU was localized with the peroxidase substrate
6,6'-diaminobenzidine enhanced with NiCl2. All slides were
counterstained with modified Harris' hematoxylin and dehydrated for
mounting.
Determination of Arsenic Levels in Tissues and Hair
Samples of lung, liver, kidney, and skin from control and arsenic-treated mice were quick-frozen in acid-free vials and stored at -70°C. Determination of arsenic tissue levels was performed by Radian Corp. (Morrisville, NC). Matrix spikes in tissue and method spikes in reagents were prepared for each sample at a concentration of 40 µg/L. After weighing and spiking, 2.0 ml of concentrated nitric acid was added to each sample, the vessels were capped, and samples were processed by microwave digestion. Each sample was transferred to a graduated cylinder, and deionized water was added to a final volume of 25 ml. The samples were analyzed by atomic absorption spectroscopy using a SpectrAA 600 with Zeeman background correction (Varian, San Fernando, CA) set to 193.7 nm with a flow rate of 3 ml/minute. The instrument was calibrated using a six-point standard curve prepared from an arsenic standard reference solution, and quality control standards were run during the analysis to confirm the calibration.
Statistical Analysis
Data shown are representative of at least three separate experiments. Statistical significance was determined by the Bonferroni adjustment of the Student t-test. Statistically significant differences were reported when the P value was <0.05.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
. Significant arsenic
accumulation also occurred in the skin and kidneys of treated animals,
whereas no detectable accumulation occurred in the liver or lung.
|
. Kinetic studies demonstrated that the
number of BrdU-positive nuclei in the skin of arsenic-treated animals
was increased after 4 weeks of exposure and remained elevated through
10 weeks (Figure 2)
.
|
|
. Expression of mRNAs for
GM-CSF and TGF- were slightly elevated after 4 weeks in
non-TPA-treated, arsenic-treated mice and significantly increased at 10
weeks, corresponding to the increased cell proliferation. TNF- and
EGFR mRNA expression were also significantly elevated after 10 weeks of
arsenic, whereas c-myc levels remained relatively constant over the
studied time course.
|
>)with
TPA.40,41
|
|
. However, within 4 to 6 weeks
after application of TPA (four times 2.5 µg), the incidence of
papillomas in arsenic-exposed Tg.AC mice were severalfold higher than
in TPA-treated mice that had not received arsenic (Figure 6, A and B)
.
The decrease in the number of papillomas that occurred 12 weeks after
TPA treatment in arsenic-exposed mice was due to both early deaths from
heavy papilloma burdens and regression of some papillomas. There were
no papillomas observed in TPA-treated wild-type FVB/N mice receiving
control or arsenic-treated drinking water for up to 3 months (data not
shown). Groups of mice were also treated with a non-inducing dose of
TPA (four times 1.25 µg), and papilloma incidence was monitored
(Figure 6A)
. Although there were no papillomas observed in transgenic
mice receiving a non-inducing dose of TPA and maintained on control
drinking water, arsenic-treated animals receiving the same dose of TPA
developed an average of five papillomas per mouse within 6 weeks after
TPA application. As TGF- and GM-CSF were overexpressed in the skin
after arsenic treatments, and these growth factors have been implicated
in skin neoplasia,23,27,28,42
we examined whether the
administration of neutralizing antibodies against GM-CSF or TGF-
affected papilloma formation. Injection of antibodies to GM-CSF before
and during application of TPA significantly reduced the average number
of papillomas over the entire time period examined (Figure 6B)
in both
TPA-control-water- and TPA-arsenic-treated mice. Antibodies to TGF-
had no apparent effect on papilloma development (data not shown). To
establish that arsenic-induced alterations in growth factor expression
and papilloma formation were not due to arsenic activation of the
v-Ha-ras transgene, we examined transgene expression in
Tg.AC mouse skin after exposure to control or arsenite-treated drinking
water for up to 8 weeks. As shown in Figure 7
, there was no evidence of transgene
expression in arsenic-exposed mice. In contrast, cells derived from a
TPA-induced Tg.AC carcinoma contained a high level of transgene mRNA
(Figure 7
, lane 2).
|
|
-immunoreactive protein was markedly increased in mice that
received arsenic in their drinking water for 14 weeks compared with
control drinking water (Figure 8)
.
Increased staining was particularly evident in the hair follicles.
GM-CSF immunostaining was only moderately enhanced in skin from
arsenic-treated mice and not detected in mice that received control
drinking water (data not shown). Thus, both the overexpression of
TGF- and tissue accumulation of arsenic can be localized to the hair
follicle region, the site where the v-Ha-ras oncogene has
been shown to be expressed early during TPA-induced
tumorigenesis.43
|
, GM-CSF, and TNF- mRNA
transcripts were examined by reverse transcription (RT)-PCR (Figure 9)
. GM-CSF and TGF- mRNA transcripts
were highly expressed in skin from areas exhibiting hyperpigmentation
and hyperkeratosis in arsenic-exposed individuals, as compared with
nonlesioned skin. These differences became more evident when the values
were normalized relative to the density of each corresponding band for
G3PDH (Figure 9B)
. There were no statistical differences in TNF-
expression.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
mRNA transcripts as well as immunoreactive
protein concentrated in the hair follicle region. Overexpression of
growth factors occurs in many human cancers, including squamous cell
carcinomas of the skin and Bowen's disease.44,45
Evidence
also exists that overexpression of EGFR and its ligand TGF-
participate in an autocrine loop that results in abnormal proliferation
and accumulation of EGFR in keratinocytes from Bowen's disease
lesions.45,46
Increased levels of TGF- have also been
demonstrated in a number of more benign hyperproliferative disorders of
the skin, such as psoriasis and solar keratosis.47
Several lines of evidence indicate that overexpression of TGF- can
stimulate tumor growth. TGF- transgenic mice develop higher
frequencies and larger, more dysplastic papillomas and squamous cell
carcinomas, compared with the parental strain, after initiation with
7,12-dimethylbenz[a]anthracene and promotion with
TPA.48
Furthermore, transgenic mice with
keratinocyte-targeted TGF- overexpression, as well as nude mice
engrafted with keratinocytes transfected with the human TGF-
transgene, demonstrate hyperkeratosis, hyperplasia, and the development
of spontaneous squamous papillomas.25,26
Like
arsenic-induced papillomas, many of which regress 14 weeks after TPA
promotion, these papillomas also frequently regress over time.
Introduction of the v-Ha-ras oncogene into murine
keratinocytes increases TGF- expression and proliferation in
vitro,49
and TGF- is overexpressed in skin
papillomas formed when nude mice are engrafted with these
keratinocytes.50
Furthermore, p53 has been shown to induce
transcriptional activation of the TGF- promoter in a human tumor
cell line.51
However, TGF- null mice develop
papillomas,35
indicating other growth factors can
substitute, and TGF- transgenic mice treated with TPA develop
papillomas that exhibit classic Ha-ras gene mutations and
not p53 gene mutations.48
Synergy may exist in skin tumor formation between TGF-
overexpression and Ha-ras activation,47
as well
as chronic arsenic exposure. Application of TPA (2.5 µg twice a week
for 2 weeks) to the dorsal shaved skin of Tg.AC transgenic mice induced
a modest incidence of papillomas within 4 weeks (mean of three per
mouse; J. Spalding, unpublished observation). When Tg.AC transgenic
mice were provided sodium arsenite in the drinking water and 4 weeks
later subjected to this TPA regimen, the incidence of skin papillomas
was significantly higher than in TPA-treated mice that did not receive
arsenic. Differences in papilloma frequencies were particularly evident
when a non-inducing dose of TPA (four times 1.25 µg) was applied.
Although no papillomas were observed in animals receiving control water
and the low dose of TPA, arsenic-exposed animals receiving the same
non-inducing TPA dose developed an average of five papillomas per mouse
6 weeks after TPA application. As papillomas were not observed in
arsenic-exposed, TPA-treated, wild-type FVB/N mice or Tg.AC mice that
did not receive TPA (data not shown) and as arsenic treatment alone did
not induce transgene expression (Figure 7)
, it would appear that
arsenic can serve as a co-promoter to enhance papilloma formation but
not as a complete tumor promoter or initiator. TPA-like tumor
promoters, in addition to stimulating processes such as protein
kinases, also increase growth factor expression, but unlike arsenic the
response is assumed to be acute and more potent.
In addition to its importance in dendritic cell development in the
skin, GM-CSF is a potent keratinocyte mitogen.52
Whereas
GM-CSF is only minimally, if at all, expressed in normal skin and is
not found in unstimulated keratinocyte cultures,23
increased expression has been shown in many skin diseases, and it is
readily induced in a paracrine fashion by cytokines, including
interleukin (IL)-1, IL-2, TGF-, and TNF-.53
Direct
intradermal injection of GM-CSF into human skin causes keratinocyte
enlargement and thickening of the epidermis.54
Recent
studies have shown increased GM-CSF mRNA expression in
lesional55
and lesion-free56
psoriatic skin as
well as skin from patients with atopic dermatitis.57
A role
for GM-CSF in dermal carcinogenesis has also been postulated based on
evidence that mice show dose- and time-dependent increases in GM-CSF in
the skin after topical treatment with tumor-promoting
agents.41,58
We had shown previously that arsenic amplifies
GM-CSF expression via paracrine stimulation by TGF- in keratinocyte
cultures.39
Like TGF-, increased immunoreactive GM-CSF
and GM-CSF transcripts were found in the skin after arsenic treatment.
Although treatment with TGF- antibodies before TPA application did
not have a protective effect against papilloma formation, antibodies to
GM-CSF reduced the average number of papillomas to near background
levels in animals receiving arsenic as well as control water. This
suggests that TGF- may play a critical role in keratinocyte
proliferation but that GM-CSF is more directly involved in the growth
and development of papillomas. Alternatively, neutralizing antibodies
to TGF- may be relatively ineffective as TGF- is produced
constitutively, is normally membrane bound, and has a substantial
half-life.
Distribution studies after chronic arsenic exposure showed that arsenic
accumulates in keratin-rich tissues such as the skin and
hair59
(Table 1)
, whereas immunohistological studies
demonstrated growth factor concentration to the hair follicle region.
Interestingly, animals exposed to arsenic experienced a delay in their
hair growth cycle compared with the control mice. Several mice did not
exhibit hair growth for up to 4 months after arsenite treatment had
been terminated, suggesting that irrevocable follicular toxicity had
occurred. Arsenic forms stable bonds with thiol groups of proteins and
has affinity for the SH groups of cysteine allowing for accumulation in
the hair and skin, which are rich in cysteine residues. Consistent with
these observations, it is believed that most skin papillomas also
originate in hair follicles where the v-Ha-ras transgene is
expressed in TPA-treated Tg.AC mice.44
Pluripotent stem
cell populations arising from the root sheath of the hair follicle may
be particularly receptive to increased levels of growth-promoting
cytokines after transgene activation. In addition, changes in DNA
methylation may result in altered growth factor receptor expression or
activation of transcription factors that promote keratinocyte
proliferation. Taken together, the studies described herein provide
evidence for a mechanistic-based hypothesis for arsenic
carcinogenecity, suggesting that, in addition to genetic factors,
neoplastic growth results from the ability of arsenic to concentrate in
hair follicles and alter the expression of autocrine and paracrine
growth signals. These data also suggest that elevated levels of
skin-associated TGF- and GM-CSF may serve as an early biomarker for
skin diseases associated with arsenic exposure.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
These studies were presented in part as an invited review in a special issue (Arsenic: a paradoxical human carcinogen. Rev Mutat Res 1997, 386:209–217).
Accepted for publication September 12, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
in normal malignant and hyperproliferative human keratinocytes. J Exp Med 1988, 167:670-675 stimulates growth of skin papillomas by autocrine and paracrine mechanisms but does not cause neoplastic progression. Mol Carcinog 1988, 1:7-12[Medline]
during epidermal development and differentiation. Genes Dev 1991, 5:714-727 in the epidermis of transgenic mice elicits hyperplasia, hyperkeratosis, and spontaneous, squamous papillomas. Cell Growth Differ 1993, 4:1071-1082[Abstract]
and hepatocyte growth factor in hepatocarcinogenesis. Br J Clin Pharmacol 1996, 42:43-52[Medline]
and c-myc in mouse mammary tumorigenesis: coordinated stimulation of growth and suppression of apoptosis. Oncogene 1996, 13:757-765[Medline]
transgenic mice. Cancer Res 1993, 53:4329-4336 in transgenic mice: induction of epithelial hyperplasia, pancreatic metaplasia, and carcinoma of the breast. Cell 1990, 61:1121-1135[Medline]
overexpression in transgenic mice induces liver neoplasia and abnormal development of the mammary gland and pancreas. Cell 1990, 61:1137-1146[Medline]
transgenic mice. Cell 1990, 61:1147-1155[Medline]
is dispensable for skin tumorigenesis in Tg.AC mice. Toxicol Pathol 1998 (in press)
and TGF-ß by cultured keratinocytes, skin, and oral squamous cell carcinomas: potential autocrine regulation of normal and malignant epithelial cell proliferation. Br J Cancer 1989, 60:542-548[Medline]
expression in situ epidermal neoplasia. Clin Exp Dermatol 1995, 20:208-212[Medline]
during the process of skin tumor promotion. J Mol Carcinog 1991, 4:52-60
in psoriatic epidermis. Science 1989, 243:811-814- induced epidermal growth factor receptor activation but not p53 inactivation. Mol Carcinog 1997, 18:160-170[Medline]
in primary keratinocytes and papillomas expressing v-Ha-ras. Mol Carcinog 1991, 4:210-219[Medline]
promoter: a potential growth-stimulatory role for p53. Mol Cell Biol 1995, 15:4694-4701[Abstract]
. Free Radical Biol Med 1995, 18:349-355[Medline]
This article has been cited by other articles:
 |
|
 |
|
  W. Ding, W. Liu, K. L. Cooper, X.-J. Qin, P. L. de Souza Bergo, L. G. Hudson, and K. J. Liu Inhibition of Poly(ADP-ribose) Polymerase-1 by Arsenite Interferes with Repair of Oxidative DNA Damage J. Biol. Chem., March 13, 2009; 284(11): 6809 - 6817. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. P. Waalkes, J. Liu, D. R. Germolec, C. S. Trempus, R. E. Cannon, E. J. Tokar, R. W. Tennant, J. M. Ward, and B. A. Diwan Arsenic Exposure In utero Exacerbates Skin Cancer Response in Adulthood with Contemporaneous Distortion of Tumor Stem Cell Dynamics Cancer Res., October 15, 2008; 68(20): 8278 - 8285. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Wu, J. Liu, M. P. Waalkes, M.-L. Cheng, L. Li, C.-X. Li, and Q. Yang High Dietary Fat Exacerbates Arsenic-Induced Liver Fibrosis in Mice Experimental Biology and Medicine, March 1, 2008; 233(3): 377 - 384. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. He, R. J. Greenwell, D. M. Brooks, L. Calderon-Garciduenas, H. D. Beall, and J. D. Coffin Arsenic Exposure in Pregnant Mice Disrupts Placental Vasculogenesis and Causes Spontaneous Abortion Toxicol. Sci., September 1, 2007; 99(1): 244 - 253. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. M. McCarty, T. J. Smith, W. Zhou, E. Gonzalez, Q. Quamruzzaman, M. Rahman, G. Mahiuddin, L. Ryan, L. Su, and D. C. Christiani Polymorphisms in XPD (Asp312Asn and Lys751Gln) genes, sunburn and arsenic-related skin lesions Carcinogenesis, August 1, 2007; 28(8): 1697 - 1702. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Shen, J. Liu, Y. Xie, B. A. Diwan, and M. P. Waalkes Fetal Onset of Aberrant Gene Expression Relevant to Pulmonary Carcinogenesis in Lung Adenocarcinoma Development Induced by In Utero Arsenic Exposure Toxicol. Sci., February 1, 2007; 95(2): 313 - 320. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Ouyang, J. Li, Q. Ma, and C. Huang Essential roles of PI-3K/Akt/IKK{beta}/NF{kappa}B pathway in cyclin D1 induction by arsenite in JB6 Cl41 cells Carcinogenesis, April 1, 2006; 27(4): 864 - 873. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Chen, S. Li, J. Liu, B. A. Diwan, J. C. Barrett, and M. P. Waalkes Chronic inorganic arsenic exposure induces hepatic global and individual gene hypomethylation: implications for arsenic hepatocarcinogenesis Carcinogenesis, September 1, 2004; 25(9): 1779 - 1786. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Liu, Y. Xie, J. M. Ward, B. A. Diwan, and M. P. Waalkes Toxicogenomic Analysis of Aberrant Gene Expression in Liver Tumors and Nontumorous Livers of Adult Mice Exposed in utero to Inorganic Arsenic Toxicol. Sci., February 1, 2004; 77(2): 249 - 257. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. P. Waalkes, J. M. Ward, and B. A. Diwan Induction of tumors of the liver, lung, ovary and adrenal in adult mice after brief maternal gestational exposure to inorganic arsenic: promotional effects of postnatal phorbol ester exposure on hepatic and pulmonary, but not dermal cancers Carcinogenesis, January 1, 2004; 25(1): 133 - 141. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T.-C. Zhang, M. T. Schmitt, and J. L. Mumford Effects of arsenic on telomerase and telomeres in relation to cell proliferation and apoptosis in human keratinocytes and leukemia cells in vitro Carcinogenesis, November 1, 2003; 24(11): 1811 - 1817. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D.-S. Bae, R. J. Handa, R. S. H. Yang, and J. A. Campain Gene Expression Patterns as Potential Molecular Biomarkers for Malignant Transformation in Human Keratinocytes Treated with MNNG, Arsenic, or a Metal Mixture Toxicol. Sci., July 1, 2003; 74(1): 32 - 42. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. He, W.-Y. Ma, G. Liu, Y. Zhang, A. M. Bode, and Z. Dong Arsenite-induced Phosphorylation of Histone H3 at Serine 10 Is Mediated by Akt1, Extracellular Signal-regulated Kinase 2, and p90 Ribosomal S6 Kinase 2 but Not Mitogen- and Stress-activated Protein Kinase 1 J. Biol. Chem., March 14, 2003; 278(12): 10588 - 10593. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P Vineis, G Matullo, and M Manuguerra An evolutionary paradigm for carcinogenesis? J Epidemiol Community Health, February 1, 2003; 57(2): 89 - 95. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L.-H. Yih, K. Peck, and T.-C. Lee Changes in gene expression profiles of human fibroblasts in response to sodium arsenite treatment Carcinogenesis, May 1, 2002; 23(5): 867 - 876. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. M. Wauson, A. S. Langan, and R. L. Vorce Sodium Arsenite Inhibits and Reverses Expression of Adipogenic and Fat Cell-Specific Genes during in Vitro Adipogenesis Toxicol. Sci., February 1, 2002; 65(2): 211 - 219. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Liu, M. B. Kadiiska, Y. Liu, T. Lu, W. Qu, and M. P. Waalkes Stress-Related Gene Expression in Mice Treated with Inorganic Arsenicals Toxicol. Sci., June 1, 2001; 61(2): 314 - 320. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. StJ. Battalora, J. W. Spalding, C. J. Szczesniak, J. E. Cape, R. J. Morris, C. S. Trempus, C. D. Bortner, B. M. Lee, and R. W. Tennant Age-dependent skin tumorigenesis and transgene expression in the Tg.AC (v-Ha-ras) transgenic mouse Carcinogenesis, April 1, 2001; 22(4): 651 - 659. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. P. Simeonova, S. Wang, M. L. Kashon, C. Kommineni, E. Crecelius, and M. I. Luster Quantitative Relationship between Arsenic Exposure and AP-1 Activity in Mouse Urinary Bladder Epithelium Toxicol. Sci., April 1, 2001; 60(2): 279 - 284. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Cohen, S. Yamamoto, M. Cano, and L. L. Arnold Urothelial Cytotoxicity and Regeneration Induced by Dimethylarsinic Acid in Rats Toxicol. Sci., January 1, 2001; 59(1): 68 - 74. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. W. Tennant, S. Stasiewicz, W. C. Eastin, J. H. Mennear, and J. W. Spalding The Tg.AC (v-Ha-ras) Transgenic Mouse: Nature of the Model Toxicol Pathol, January 1, 2001; 29(1_suppl): 51 - 59. [Abstract] [PDF]
|
|
|
|
|
|
P. P. Simeonova, S. Wang, W. Toriuma, V. Kommineni, J. Matheson, N. Unimye, F. Kayama, D. Harki, M. Ding, V. Vallyathan, et al. Arsenic Mediates Cell Proliferation and Gene Expression in the Bladder Epithelium: Association with Activating Protein-1 Transactivation Cancer Res., July 1, 2000; 60(13): 3445 - 3453. [Abstract] [Full Text]
|
|
|
|
|
|
J. Liu, Y. Liu, R. A. Goyer, W. Achanzar, and M. P. Waalkes Metallothionein-I/II Null Mice Are More Sensitive than Wild-Type Mice to the Hepatotoxic and Nephrotoxic Effects of Chronic Oral or Injected Inorganic Arsenicals Toxicol. Sci., June 1, 2000; 55(2): 460 - 467. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Huff, P. Chan, and A. Nyska Is the Human Carcinogen Arsenic Carcinogenic to Laboratory Animals? Toxicol. Sci., May 1, 2000; 55(1): 17 - 23. [Full Text] [PDF]
|
|
|
|
 |
|
 C. T. Siegel, K. Schreiber, S. C. Meredith, G. B. Beck-Engeser, D. W. Lancki, C. A. Lazarski, Y.-X. Fu, D. A. Rowley, and H. Schreiber Enhanced Growth of Primary Tumors in Cancer-prone Mice after Immunization against the Mutant Region of an Inherited Oncoprotein J. Exp. Med., June 6, 1999; 191(11): 1945 - 1956. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. P. Simeonova, S. Wang, T. Hulderman, and M. I. Luster c-Src-dependent Activation of the Epidermal Growth Factor Receptor and Mitogen-activated Protein Kinase Pathway by Arsenic. ROLE IN CARCINOGENESIS J. Biol. Chem., January 18, 2002; 277(4): 2945 - 2950. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) and 0.02%
sodium-arsenite-treated
([circo) drinking water.
*Significantly different from controls at P <
0.05.
, TPA plus arsenic; 
, NITPA plus water; 
, NITPA plus arsenic;
n = 20 mice per treatment group. B: Same as
A, using 2.5 µg of TPA, plus additional groups were treated
with monoclonal antibodies to mouse GM-CSF 2 weeks before TPA
treatment, 2 hours after each application of TPA, and 2 weeks after TPA
treatment. x, control water; 
, TPA plus water plus anti-GM-CSF antibodies; 
, TPA plus As plus
anti-GM-CSF antibodies; n = 13 to 14 mice per
treatment group. Papillomas were not observed in non-TPA-promoted,
arsenic-treated transgenic mice or TPA-promoted, arsenic-treated
wild-type FVB/N mice (data not
shown).
