| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Department of Pathology*
and Internal
Medicine,
Division of Pulmonary and Critical
Care, University of Michigan Medical School, and the Department of
Pathology,
Veterans Affairs Medical Center,
Ann Arbor, Michigan
| Abstract |
|---|
|
|
|---|
, interleukin
(IL)-12, and nitric oxide usually resolves in the absence of
fibrosis. To determine whether nitric oxide participates in modulating
the fibrotic response during the development of pulmonary granulomas in
response to purified protein derivative (PPD), mice
presensitized to PPD received daily intraperitoneal injections of
NG-nitro-D-arginine-methyl ester
(D-NAME),
NG-nitro-L-arginine-methyl ester
(L-NAME), or aminoguanidine after delivery of
PPD-coated beads to the lungs. Eight days later, morphometric
analysis of lung granulomas revealed that L-NAME-treated
mice when challenged with PPD in vitro for 36 hours had
the largest pulmonary granulomas and the greatest collagen deposition
among the treated groups. In addition, equivalent numbers of
dispersed lung cells from L-NAME- and
aminoguanidine-treated mice produced significantly higher levels of
IL-4, monocyte chemoattractant protein (MCP)-1, and
macrophage inflammatory protein (MIP)-1
and significantly lower
levels of eotaxin compared with D-NAME-treated mice.
Cultures of dispersed lung cells from L-NAME-treated mice
also produced significantly more IL-10 and less IL-12 compared with
similar numbers of dispersed lung cells from D-NAME-treated
mice. Cultures of isolated lung fibroblasts from
L-NAME-treated mice expressed higher levels of C-C
chemokine receptor 2 (CCR2) and CCR3 mRNA and contained less MCP-1 and
eotaxin protein than a similar number of fibroblasts from
D-NAME-treated mice. Thus, nitric oxide appears to
regulate the deposition of extracellular matrix in lung granulomas
through the modulation of the cytokine and chemokine profile of these
lesions. Alterations in the cytokine, chemokine, and
procollagen profile of this lesion may be a direct effect of nitric
oxide on the pulmonary fibroblast and provide an important signal for
regulating fibroblast activity during the evolution of chronic lung
disease.
| Introduction |
|---|
|
|
|---|
and interleukin (IL)-12, and little deposition of
extracellular matrix results around Sephadex beads coated with PPD that
are embolized in the lungs of PPD-sensitized mice. In contrast, the
cytokine response to Schistosoma mansoni egg antigen
(SEA)-coated beads also embolized to the lungs of SEA-sensitized mice
are dominated by IL-4 and accompanied by pulmonary fibroblast
activation and excessive extracellular matrix deposition within the
interstitium.5
Thus, the evolution of the fibrotic process
within the lung appears to be inherently dependent on the
counter-regulatory actions of specific cytokine profiles.6
Further examination of the mechanisms through which cytokine profiles
dictate the pulmonary fibrotic response has revealed that the
chemotactic cytokines or chemokines also play unique roles in this
process.7,8
Monocyte chemoattractant protein (MCP)-1 and
macrophage inflammatory protein (MIP)-1
are two such C-C chemokines
that have garnered attention because of their demonstrable roles in
experimental interstitial fibrosis. MCP-1 has been shown to be
necessary for the development of fibrosis in the kidney.9
Interestingly, studies by Gharaee-Kermani et al10
have
revealed that MCP-1 has direct stimulatory effects on de
novo synthesis of transforming growth factor (TGF)-ß, which in
turn augments collagen generation by cultured rodent pulmonary
fibroblasts. Other experimental studies have shown that MIP-1
clearly contributes to the pulmonary fibrotic response to
bleomycin.11
Clinical observations also support a role for
MCP-1 and MIP-1
in pulmonary fibrosis as both are elevated in the
bronchoalveolar lavage and open-lung biopsies from patients with
interstitial lung fibrosis.2,12-14
Eotaxin represents
another C-C chemokine that may also exert a prominent role in pulmonary
inflammation because of its ability to recruit
eosinophils.15
Although a causal link between eosinophils
and pulmonary fibrosis has yet to be established, eosinophils are found
in abundance in fibrotic tissue,16
and activated
eosinophils are a rich source of many inflammatory
cytokines.17
Thus, the cumulative balance of pro- and
antifibrotic cytokines and chemokines during a pulmonary inflammatory
response may be critical in regulating the tissue reparative process.
Endogenous nitric oxide synthesis is a key regulator of interstitial fibrotic responses in numerous organs, including the kidney,18 heart,19 and vasculature.20 This free radical is produced by many cells through the utilization of L-arginine by at least three distinct nitric oxide synthase (NOS) isoforms.21 The three major classifications of NOS are as follows: NOS I is a constitutive isoform found in neurons, NOS II is an inducible isoform found in activated macrophages and epithelial and smooth muscle cells, and NOS III is a constitutive isoform found in endothelial cells.22 NOS I and III are calcium-dependent enzymes that produce nanomolar pulses of nitric oxide continuously, whereas NOS II is expressed only after gene induction and can be involved in the generation of micromolar quantities of nitric oxide that may be cytotoxic.22 The major functions of NOS I through III include neurotransmission, microbicidal and tumoricidal effects, and vasoregulation, respectively.21 At present, the precise role of each NOS isoform in pulmonary fibrotic disease is unknown, but immunohistochemical studies have shown that NOS II expression is increased whereas NOS III is decreased in patients with early- and intermediate-stage interstitial fibrotic disease.23 Furthermore, the by-product of protein nitration by nitric oxide and superoxide, nitrotyrosine, has also been detected in interstitial fibrotic lung disease.23 However, other studies suggest that exogenous nitric oxide has a beneficial role in idiopathic pulmonary fibrosis,24 but only when it is administered in quantities that are similar to those generated by NOS I and III.25,26 Thus, nitric oxide may have dichotomous effects on the pulmonary interstitial fibrotic process that are related to the enzymatic source of this mediator.
In this study, we have addressed the role of nitric oxide in the
regulation of collagen deposition around PPD-bead pulmonary granulomas.
In a previous study, we showed that NOS II was prominent in many cells
in the lung by day 4 in the PPD-bead granuloma model, and the
granulomatous response on day 4 was markedly augmented after the
inhibition of nitric oxide synthesis.27
Furthermore, the
cytokine and chemokine profile of dissociated lung cells from
NG-nitro-L-arginine-methyl ester
(L-NAME)-treated, PPD-challenged mice reflected a cytokine
and chemokine profile more in line with that observed during a
granulomatous response to SEA-beads in SEA-sensitized
mice.5
As previous studies have shown that increased IL-4,
MCP-1, and MIP-1
are associated with the development of experimental
lung fibrosis,8
the specific aim of the present study was
to determine whether the inhibition of nitric oxide would alter the
resolution phase in the PPD-bead granuloma model and modify chemokine
and chemokine receptor expression by isolated lung fibroblasts from
mice with PPD-bead granulomas.
| Materials and Methods |
|---|
|
|
|---|
Specific-pathogen free (SPF), female CBA/J mice were purchased from Jackson Laboratories (Bar Harbor, ME) and were maintained under SPF conditions before and during experiments. All mice received a subcutaneous and intraperitoneal injection of complete Freund's adjuvant (CFA; Sigma Chemical Co., St. Louis, MO) diluted 1:1 with normal saline as previously described in detail.5 Immediately after the injection of CFA, all mice were fed a chemically defined diet from Zeigler Bros. (Gardiners, PA) that was deficient in L-arginine. Previous investigators have used this solid pellet chow to effectively reduce baseline nitric oxide synthesis in mice.28 In the present study we observed that this diet did not alter the normal growth patterns of the mice over the entire course of the experiment, but it did markedly reduce detectable levels of urinary nitric oxide metabolites such as nitrite and nitrate (data not shown). Sixteen days after CFA sensitization, all mice received 3000 Sepharose 4B beads covalently coupled to purified protein derivative (PPD) from Mycobacterium sp. by intravenous injection. Introduction of PPD-coated beads in this manner ensures that the beads embolize to the lungs and elicit a granulomatous response. After the introduction of PPD-coated beads, the mice were divided into groups of five and received daily intraperitoneal injections of L-NAME, D-NAME, or aminoguanidine during the PPD-bead embolization period. All compounds were administered at a dose of 8 mg/kg as previously described.27,29 L-NAME is a nondiscriminating inhibitor of all three isoforms of nitric oxide synthase, whereas D-NAME is a structural enantiomer of L-NAME that lacks nitric oxide synthase inhibitory actions.30 Aminoguanidine has been used by a number of investigators to more selectively inhibit NOS II activity.29,31-33 Aminoguanidine has also been shown to inhibit the induction of NOS II in the endotoxin-challenged lung.34 L-NAME and aminoguanidine were used in the present study to determine the relative contribution of all of the isoforms nitric oxide synthase (ie, NOS I, II, and III) as compared with the inducible nitric oxide synthase (ie, NOS II) on the development of extracellular matrix around PPD-bead granulomas. Based on results obtained by monitoring urine nitrite/nitrate levels, it appeared that both compounds equally reduced systemic nitric oxide production during the 8-day treatment protocol (data not shown). All mice were maintained on the L-arginine-deficient diet throughout the 8 days of PPD-bead challenge, after which whole lungs were removed and fixed for morphometric analysis or cultured for assessment of cytokine and chemokine synthetic capacity.
Morphometric Analysis and Masson Trichrome Staining of Collagen in Granulomatous Lungs
Whole lungs from D-NAME-, L-NAME-, or aminoguanidine-treated mice 8 days after PPD-bead administration were fully inflated by intratracheal administration of 4% paraformaldehyde. Lungs were then dissected out and fixed in fresh 4% paraformaldehyde for an additional 24 hours. Routine histological techniques were used to paraffin-embed this tissue, and 5-µm sections of whole lung were prepared for Masson trichrome staining as previously described.35 At the conclusion of this staining protocol, lung sections were counterstained with Mayer's hemotoxylin (Mayer & Myles Laboratories, Coopersburg, PA) for the visualization and identification of nucleated cells composing the granulomas. Quantitative digital morphometric analysis of granulomas was performed using a protocol described in detail elsewhere.27 A minimum of 10 granulomas were analyzed in each whole-lung tissue section, and granulomas were considered in this analysis if a full cross section of the bead nidus was visible. Using the application program IP Lab Spectrum-R4, images of the granulomas were captured, and copies of the image were made. The color wavelengths of the copied image were transformed into digital readings, allowing for quantification of the various color wavelengths using pixels as the unit of measure. Using the original image for comparison, the color spectra of each copied image was then adjusted until the collagen (highlighted in the original image by Masson trichrome staining) was green while the remaining granuloma was black. Percent collagen was then calculated by dividing the total pixel area of the granuloma by the pixel area corresponding to collagen.
Assessment of Cytokine and Chemokine Profiles from Dissociated Granulomatous Lungs
Granulomatous lungs from D-NAME-, L-NAME-, or aminoguanidine-treated mice were mechanically dissociated over steel mesh using a plunger from a 20-ml syringe. Red blood cells in the dissociated cell suspensions were lysed using a hypotonic lysing buffer (150 mmol/L NH4Cl, 10 mmol/L NaHCO3, 1 mmol/L EDTA) for 2 minutes at 4°C. The remaining cells were suspended in RPMI containing 10% fetal bovine serum and were added at a density of 4.0 x 105 cells/well in six-well tissue culture plates. The dispersed lung cells were then challenged with 3 µg/ml PPD for 36 hours at 37°C in a humidified CO2 incubator as previously described27,36 before 1-ml aliquots were removed and stored at -20°C before ELISA analysis.
Granuloma Lung Fibroblast Culture
Pulmonary granuloma fibroblasts from D-NAME- and
L-NAME-treated mice were subsequently grown out from mixed
lung cell primary cultures (see above), as previously
described.37
Briefly, these cells were transferred to
175-ml tissue culture flasks and were fed Dulbeco's modified Eagle's
medium (DMEM) containing 1% (v/v) antibiotic/antimycotic and 15%
(v/v) fetal bovine serum (FBS). After a minimum of three passages,
homogeneous populations of fibroblasts were transferred to six-well
tissue culture plates for experiments. Before use in any experiment,
lung fibroblasts were transferred to two-well Labtek chamber culture
slides and stained for
-actin, desmin, and
-naphthyl acetate
esterase. After the third passage, lung fibroblasts stained for
-actin, suggesting a myofibroblast-type phenotype, but cultures of
these cells were found to be completely free of
-naphthyl acetate
esterase-positive cells such as macrophages (data not shown). After
ensuring the homogeneity of fibroblast cultures, each well in a
six-well tissue culture plate was initially seeded with approximately
1.0 x 106
fibroblasts. When cell confluence was
reached, the DMEM was removed and IL-4 (R&D Systems, Minneapolis, MN)
or IFN-
(Genzyme, Cambridge, MA) suspended at 10 ng/ml in RPMI
containing 10% FBS was added. Twenty-four hours later, cell-free
supernatants were removed for ELISA measurements, and the adherent
fibroblasts were washed and subjected to RNA isolation or prepared for
flow cytometry. Cultured lung fibroblasts were used in these
experiments up to the sixth passage.
Cytokine and Chemokine Measurement
Murine IL-4, IL-10, IL-12, MCP-1, MIP-1
, eotaxin, and TGF-ß
levels were determined in 50-µl supernatant samples from dispersed
lung cells or purified lung fibroblasts using a standardized sandwich
ELISA as previously described.27
Briefly, Nunc-immuno ELISA
plates (MaxiSorp) were coated with the appropriate cytokine capture
antibody at a dilution of 1 µg/ml coating buffer (0.6 mol/L NaCl,
0.26 mol/L H3BO4, 0.08 mol/L NaOH, pH 9.6) for
16 hours at 4°C. Excess capture antibody was washed away and each
plate was blocked for 90 minutes with 2% bovine serum albumin
(BSA)/PBS at 37°C. After the blocking period, each ELISA plate was
washed with PBS/Tween 20 (0.05%, v/v), and 50-µl samples (no
dilution or 1:10) were added to wells in duplicate for 1 hour at
37°C. Recombinant murine IL-4, IL-10, IL-12, MCP-1, MIP-1
,
eotaxin, and TGF-ß standard curves were used to calculate cytokine
concentrations. The plates were then thoroughly washed, and the
appropriate biotinylated polyclonal rabbit anti-cytokine antibody (3.5
µg/ml) was added. After washing the plates 30 minutes later,
streptavidin-peroxidase (Bio-Rad Laboratories, Richmond, CA) was added
to each well for 30 minutes, and each plate was thoroughly washed
again. Chromogen substrate (Bio-Rad Laboratories) was added and plates
were read on an ELISA plate scanner at 492 nm. The limit of detection
for each cytokine was consistently above 50 pg/ml.
Reverse Transcription Polymerase Chain Reaction
mRNA expression in the lung fibroblasts derived from
D-NAME- or L-NAME-treated mice with PPD-bead
lung granulomas were examined using reverse transcription polymerase
chain reaction (RT-PCR). Briefly, total RNA was isolated from cultured
fibroblasts and 1 µg of total RNA was reverse transcribed to yield
cDNA using techniques previously described in detail.27
The
following sense and antisense primers, respectively, were used in the
PCR reaction: ß-actin sense, 5'-GTGGGGCGCCCCAGGCACCA-3', and
antisense, 5'-GCTCGCCCGTGGTGGTGAAGC-3' (450-bp product); CCR2 sense,
5'CACGAAGTATCCAAGAGCTT3', and antisense, 5'CATGCTCTTCAGCTTTTTAC3'
(422-bp product); and CCR3 sense, 5'TGGGCAACATGATGGTTGTG3', and
antisense, 5'GCTGTCTTGAGACTCATGGA3' (385-bp product); procollagen type
I
sense, 5' TCGTGACCGTGACCTTGCG3', and antisense,
5'GGATGAGTCGGCAGACACGGA3' (255-bp product); and procollagen type III
sense, 5' GCTCAGAGTAGCACCATCAG3', and antisense,
5'GGCTGATGTACACATGCTCC3' (220-bp product).
PCR samples were initially incubated at 94°C for 5 minutes and then cycled 27 times through denaturation at 95°C for 30 seconds, annealing at 58°C for 45 seconds, and extension at 72°C for 75 seconds. PCR products were then separated on 2% agarose gels containing 0.3% ethidium bromide, and the bands corresponding to the intended products were photographed under ultraviolet illumination.
Statistical Analysis
Data are means ± SEM (SE). Each group contained a minimum of
five mice, and statistical analysis was performed using analysis of
variance. Multiple comparisons were made using the Dunnett's test. An
associate P value of
0.05 was considered significant.
| Results |
|---|
|
|
|---|
Our previous studies showed that the cellularity of the PPD-bead
granuloma on day 4 after bead embolization was significantly increased
by the inhibition of nitric oxide using
L-NAME.27
The increased cellularity of the
pulmonary granulomas in L-NAME-treated mice on day 4 was
attributable to augmented numbers of granulocytes such as neutrophils
and eosinophils in the lesion. Thus, we first determined whether
prolonged inhibition of nitric oxide using an
L-arginine-deficient diet in combination with either
L-NAME or aminoguanidine in the PPD-bead model was
associated with altered pulmonary granuloma size at day 8 after
PPD-bead administration. Previous characterization of this granuloma
model showed that the inflammatory infiltrate around the PPD-bead is
normally resolved by day 8.5
Consistent with these early
observations, the PPD-bead pulmonary granulomas in
D-NAME-treated mice, also maintained on the
L-arginine-deficient diet, showed little inflammatory
response around the day 8 PPD-bead granuloma (Figure 1A)
. In contrast, mononuclear and
polymorphonuclear inflammatory cells were present around PPD beads in
L-NAME-treated mice (Figure 1B)
. Fewer inflammatory cells
were detected around beads in aminoguanidine-treated mice (Figure 1C)
.
Morphometric analysis of pulmonary granulomas in
L-NAME-treated mice showed that the mean size of these
lesions was 24-fold larger than the pulmonary granulomas in the
D-NAME-treated group (Figure 2)
. Although the pulmonary lesions in the
aminoguanidine-treated mice were larger than those in the
D-NAME-treated mice (Figure 2)
, this difference did not
reach statistical significance. These data suggested that only the
nonselective inhibition of nitric oxide synthases (presumably NOS I,
II, and III) using L-NAME was associated with increased
inflammatory cell number around the PPD-bead.
|
|
Masson trichrome staining was used to reveal the deposition of
collagen in whole-lung sections from each treatment group. Whereas
collagen deposition was detectable in granulomas from each of the
treatment groups (see Figure 1, AC
), marked differences in the
percentage of collagen present in the pulmonary lesions from the
various treatment groups were noted. As summarized in Table 1
, 5% of the total area of the pulmonary
granulomas analyzed in L-NAME-treated mice was occupied by
collagen, a statistically significant increase in collagen content
above that measured in D-NAME-treated mice as less than
0.2% of the cross-sectional area of the granulomas found in
D-NAME-treated mice was composed of collagen (Table 1)
. In
aminoguanidine-treated mice, the collagen content was calculated to be
almost 3% of the total granuloma area. Overall, these data suggested
that the inhibition of nitric oxide with either the nonselective
L-NAME or the NOS-II-selective aminoguanidine was
associated with increased collagen deposition around the PPD-bead. In
the next series of experiments, we examined whether nitric oxide
regulated the production of profibrotic cytokines and chemokines by
dispersed lung granuloma cells from each of the treatment groups.
|
Previous studies have shown that the cytokine profile in the lung
is altered after the initiation of antigen-specific granulomatous
inflammation.5
In the PPD-bead model, the inflammatory
response at day 4 surrounding PPD-coated beads is dominated by IFN-
and IL-12.38
However, the inhibition of nitric oxide
synthesis with L-NAME in the PPD-bead model significantly
decreased the amounts of both IFN-
and IL-12 in cultures of
dispersed lung cells.27
In the present study, IFN-
was
not detected in any cultures of dispersed lung cells from day 8
granulomas rechallenged with 3 µg/ml PPD (data not shown), but IL-4,
IL-10, and IL-12 were present in cell-free supernatants removed from
these cultures 36 hours later (Figure 3, AC)
. IL-4 levels were significantly augmented in cultures of
dispersed cells from L-NAME- and aminoguanidine-treated
mice above those levels detected in cultures of cells removed from
D-NAME-treated mice (Figure 3A)
. When compared with cell
supernatants from cultures containing dispersed lung cells from
D-NAME-treated mice, significantly more IL-10 was detected
in cultures from L-NAME-treated mice whereas significantly
less IL-10 was detected in cultures from aminoguanidine-treated mice
(Figure 3B)
. Dispersed lung cells from L-NAME-treated mice
also generated significantly less IL-12 than similar numbers of cells
from D-NAME- and aminoguanidine-treated mice (Figure 3C)
.
Thus, these data suggest that IL-4 production was greater in the
cultures of lung cells taken from animals receiving either
pharmacological inhibitor of nitric oxide.
|

Further examination of cell-free supernatants from dispersed lung
cells removed from D-NAME-, L-NAME-, and
aminoguanidine-treated mice on day 8 of the PPD-bead granulomatous
response revealed differences in the accumulation of C-C chemokines
such as MCP-1, MIP-1
, and eotaxin. Dispersed lung cells from
L-NAME- and aminoguanidine-treated mice released
significantly more MCP-1 than a similar quantity of cells removed from
the D-NAME treatment group after PPD rechallenge for 36
hours (Figure 4A)
. MIP-1
levels in
cultures of dispersed lung cells from aminoguanidine-treated mice were
significantly increased approximately threefold above the other two
treatment groups (Figure 4B)
. In contrast to the above two C-C
chemokines detected in these cultures, eotaxin levels in dispersed lung
cell cultures from L-NAME- and aminoguanidine-treated mice
were significantly reduced by twofold compared with levels measured in
cultures containing similar numbers of cells from the
D-NAME treatment group (Figure 4C)
. In the next series of
experiments, cultured fibroblasts from the L-NAME- and
D-NAME-treated groups were examined to determine whether
these cells were a potential source of MCP-1, MIP-1
, and eotaxin
and, in turn, had the ability to recognize these chemokines through the
expression of chemokine receptors.
|
Lung fibroblasts from L-NAME- and
D-NAME-treated mice were also examined for changes in
MCP-1, MIP-1
, and eotaxin production after cytokine stimulation for
24 hours. MIP-1
was not detected in any of the cultures of
fibroblasts under any of the conditions tested (data not shown).
Cultures of purified lung fibroblasts from the D-NAME and
L-NAME treatment groups contained equivalent amounts of
MCP-1 when cultured without the addition of cytokines (Figure 5A)
. However, after IL-4 or IFN-
treatment of both types of fibroblasts in culture for 24 hours,
significantly more MCP-1 was detected in cell-free supernatants removed
from fibroblasts cultured from D-NAME-treated mice compared
to similar numbers of fibroblasts cultured from
L-NAME-treated mice. A constitutive level of approximately
50 pg/ml eotaxin was detected only in cultures of fibroblasts from
L-NAME-treated mice. After in vitro IL-4
treatment of both fibroblast types, eotaxin levels in the culture
supernatants exceeded 1.5 ng/ml, and the greater levels of eotaxin were
detected in cultures of fibroblasts from D-NAME-treated
mice. Eotaxin levels were identical in both cultures of fibroblasts
after IFN-
treatment for 24 hours (Figure 5B)
.
|
As the greatest differences in granuloma size and collagen
deposition in the Th1-type pulmonary granuloma model were observed
between the D-NAME and L-NAME treatment groups,
we examined whether these changes were related to differences in the
expression of CCR2 and CCR3 mRNA by purified lung fibroblasts with or
without in vitro cytokine treatment for 24 hours. CCR2 and
CCR3 are the receptors that recognize MCP-1 and eotaxin, respectively.
MIP-1
will also bind to CCR3 in the mouse. In pilot studies, these
two C-C chemokine receptors were expressed on a higher proportion of
normal fibroblasts than other chemokine receptors such as CCR1, CCR4,
and CCR5 (C.M. Hogaboam, personal observations). Changes in procollagen
I and III gene expression by these fibroblasts were also examined under
the same conditions. Figure 6
is a
composite of RT-PCR results obtained from cultured fibroblasts grown
from day 8 PPD-bead granulomas in D-NAME- and
L-NAME-treated mice showing a number of differences in
constitutive and cytokine-induced gene expression between these two
fibroblast types. First, CCR2 mRNA was not detected in fibroblasts
cultured from D-NAME-treated mice, whereas CCR2 mRNA
expression was present in cultured fibroblasts from
L-NAME-treated mice under all in vitro
conditions. Based on the ratios of CCR2 to ß-actin expression shown
in Figure 6B
, untreated lung fibroblasts from mice that received
L-NAME in vivo exhibited the greatest level of
CCR2 expression. Next, CCR3 gene expression by both fibroblast types
was apparent when IL-4 was present for 24 hours, but the highest
expression of CCR3 mRNA was measured in fibroblasts from
L-NAME-treated mice that were exposed to IFN-
for 24
hours in culture (Figure 6B)
. Finally, procollagen types I and III gene
expression were not detected in control cultures of fibroblasts from
both in vivo treatment groups. Procollagen types I and III
mRNA were present in fibroblasts from both mouse treatment groups when
these cells received IL-4 in culture. However, greater procollagen gene
expression was observed in the fibroblasts from the
D-NAME-treated mice when compared with similar numbers of
fibroblasts from L-NAME-treated mice (Figure 6B)
.
Interestingly, exposure of fibroblasts from L-NAME-treated
mice to IFN-
for 24 hours appeared to stimulate the gene expression
of procollagen III. This effect was not observed in cultures of
fibroblasts from D-NAME-treated mice (Figure 6, A and B)
.
|
Fibroblasts from both treatment groups were also examined for the
generation of the profibrotic cytokine TGF-ß. TGF-ß was detected
under control conditions in cultures of fibroblasts from
D-NAME- and L-NAME-treated mice (Figure 7)
. After IL-4 treatment, TGF-ß levels
were increased significantly (sevenfold) in cultures of fibroblasts
from L-NAME-treated mice but not in cultures from
D-NAME-treated mice. The presence of IFN-
in cultures of
fibroblasts cultured from D-NAME-treated mice abolished
TGF-ß levels, but a similar treatment did not affect TGF-ß
synthesis by fibroblasts from L-NAME-treated mice (Figure 7)
.
|
| Discussion |
|---|
|
|
|---|
The manner in which the inhibition of nitric oxide leads to increased
collagen deposition around the PPD-bead granuloma is not presently
known, but promotion of profibrotic cytokine synthesis in the lung
during nitric oxide inhibition may have played a prominent role. The
onset of fibrosis during clinical or experimental lung disease appears
to follow increases in IL-4, tumor necrosis factor-
and TGF-ß
levels.49
Experimental pulmonary granuloma formation is
also dependent on the initial cytokine profile
elicited.1,38
The PPD-bead granulomatous response is
initially dominated by IFN-
with little IL-4 synthesis, and this
lesion typically resolves without evidence of extracellular matrix
deposition around the bead. Interestingly, the resolution of the
PPD-bead granuloma can be reversed by the transgene-induced
overexpression of IL-4 in the lung.50
Under conditions of
increased IL-4 expression, the PPD-granuloma is markedly increased in
size, contains eosinophils, and has increased procollagen gene
expression.50
In the present study, an increase in IL-4
levels was measured in cultures containing dissociated lung cells from
L-NAME- and aminoguanidine-treated mice, as compared with
cultures of similar numbers of dispersed lung cells from
D-NAME-treated controls. In addition, a clear shift in the
cytokine profile was apparent in dispersed lung cell cultures from
L-NAME-treated mice as IL-4 and IL-10 were significantly
increased whereas IL-12 was significantly decreased. It is of note that
levels of all cytokines measured in cultures of dispersed lung cells
from day 8 PPD-bead lesions were markedly lower than cytokine levels
measured in cultures of similar cells from day 4 PPD-bead
lesions,27
confirming earlier studies showing that this
lesion is nearly completely resolved by day 8.5
Thus, the
appearance of collagen in the PPD-bead pulmonary granuloma may have
resulted from an alteration in the cytokine profile from an
antifibrotic (ie, IL-12) to a profibrotic (ie, IL-4) phenotype within
the lung.
Recent evidence also points to a unique role for chemotactic cytokines
in fibrotic responses.9
Whereas many investigators have
shown that MCP-1 expression is markedly augmented in
IPF,2,12,13,51
its precise role in this pulmonary fibrotic
disease is presently unknown. Pulmonary granuloma responses in mice
characterized by collagen deposition are MCP-1 dependent,48
and MCP-1 may promote the fibrotic process through the recruitment of T
cells and monocytes,52
modulation of T cell cytokine
synthesis,53-55
and T cell adhesion to extracellular
matrix.56
In the present study, C-C chemokine generation by
PPD-stimulated dispersed lung cells was altered by the in
vivo pharmacological inhibition of nitric oxide synthesis. MCP-1
was significantly increased in cultures of lung cells from
L-NAME-treated mice as compared with cells from
D-NAME-treated mice, and the levels of MCP-1 in cultures of
cells from aminoguanidine-treated mice were fivefold higher than either
of the other treatment groups. The effects of nitric oxide inhibition
on MCP-1 generation in fibroblast cultures are consistent with the
previous findings of Zeiher et al57
who observed that
nitric oxide modulates MCP-1 expression in vascular endothelial cells
through an oxidant-sensitive transcription mechanism. MIP-1
levels
in the cultures of dispersed lung cells from aminoguanidine-treated
mice were approximately threefold higher than levels measured in
dispersed cell cultures from D-NAME- and
L-NAME-treated mice. Thus, modulation of nitric oxide
production by constitutive and/or inducible nitric oxide synthases
during a PPD-bead pulmonary granuloma response promotes the increased
synthesis of known profibrotic C-C chemokines such as MCP-1 and
MIP-1
from dispersed lung cells.
Previous observations suggest that nitric oxide also directly regulates
fibroblast activation.58-60
In the present study, it was
observed that cultured fibroblasts were an excellent source of MCP-1
and eotaxin and that these cells respond to IL-4 and IFN-
, two
potent regulators of the fibrotic process. However, the regulatory
effect of nitric oxide on fibroblasts may be related to its effects on
the expression of chemokine receptor expression by these cells. CCR2 is
the receptor for MCP-161,62
that is required for a normal
PPD-bead granuloma response.63
CCR3 was originally
described as the receptor for eotaxin, but in the mouse CCR3 will bind
MIP-1
.64
Using RT-PCR, CCR2 and CCR3 gene expression
were detected in fibroblasts cultured from L-NAME-treated
mice, but mRNA for both chemokine receptors was largely absent from
lung fibroblasts derived from D-NAME-treated mice.
Therefore, nitric oxide appears to modulate CCR2 and CCR3 expression by
fibroblasts, which in turn may prevent fibroblasts from responding to
the presence of profibrotic chemokines.
The observation that procollagen types I and III were elevated in the
IL-4-pretreated pulmonary fibroblasts from PPD lesions is supportive of
other studies showing that IL-4 is a profibrotic
cytokine.65
However, procollagen I and III mRNA expression
was greater in fibroblasts cultured from D-NAME-treated
mice after an IL-4 stimulus than in similar numbers of fibroblasts from
L-NAME-treated mice. The decreased levels of procollagen I
and III in cultures of fibroblasts from L-NAME-treated mice
may reflect a hyporesponsiveness of these cells to a profibrotic
signals (ie, IL-4) because of their previous involvement in the
fibrotic PPD-granuloma response. Fibroblasts cultured from fibrotic
lesions have been previously described as hyporesponsive to various
inflammatory stimuli.66,67
It is also plausible that
fibroblasts from L-NAME-treated mice generate collagen
protein much more rapidly than similar cells from
D-NAME-treated mice through augmented or altered
procollagen mRNA translation.68
IFN-
treatment of
fibroblasts from L-NAME-treated mice also resulted in
procollagen III mRNA expression. Although these findings contrast with
previous studies in which IFN-
was found to inhibit collagen
synthesis by normal fibroblasts,69
these findings may
reflect changes in the way that procollagen mRNA is regulated in
fibroblasts derived from a nitric-oxide-deprived environment. This
observation is also of considerable interest considering that increased
procollagen type III occurs early in pulmonary fibrosis and is thought
to be predictive of fibrotic diseases in the lung.49,70
Although constitutive levels of TGF-ß did not differ between the two
types of fibroblasts, levels of this cytokine were approximately
sevenfold higher in cultures of IL-4-stimulated fibroblasts from
L-NAME-treated mice compared with their
D-NAME-treated counterparts. Furthermore, in
vitro IFN-
treatment of fibroblasts from
L-NAME-treated mice did not abolish TGF-ß synthesis.
Taken together, these data suggest that fibroblasts cultured from
L-NAME- and D-NAME-treated mice with PPD-bead
granulomas differ markedly in their ability to generate extracellular
matrix and TGF-ß, and these alterations may account for changes in
collagen production by these cells in vivo.
In summary, these findings suggest that inhibition of nitric oxide synthesis during PPD-bead granuloma formation can markedly change the cellular appearance and the degree of extracellular matrix deposition in this lesion. The results from the present study also suggest that changes in nitric oxide increase the ability of isolated lung cells to generate profibrotic cytokines and chemokines. Furthermore, nitric oxide appears to be important in the regulation of chemokine and chemokine receptor expression by the interstitial pulmonary fibroblast.
| Footnotes |
|---|
Supported by National Institutes of Health grants 1P50HL56402, HL35276, HL31963, and AI36302.
Accepted for publication September 3, 1998.
| References |
|---|
|
|
|---|
expression in interstitial lung disease. J Immunol 1993, 151:2852-2863[Abstract]
-inducible intercellular adhesion molecule-1. J Immunol 1994, 152:5883-5889[Abstract]
and IL-4 knockout mice: analysis of local and regional cytokine and chemokine networks. J Immunol 1997, 159:3563-3573
-smooth muscle actin expression, contractile phenotype, and apoptosis by IL-1ß. J Immunol 1997, 158:1392-1399[Abstract]
receptors: evidence for two closely linked C-C chemokine receptors on chromosome 9. J Biol Chem 1996, 271:7551-7558
influences eosinophil recruitment in antigen-specific airway inflammation. Eur J Immunol 1995, 25:245-251[Medline]
in human dermal fibroblasts cultured in three-dimensional collagen gel are photoaging- and aging-independent. J Dermatol Sci 1997, 15:188-200[Medline]
-interferon. Am Rev Respir Dis 1989, 139:A205
This article has been cited by other articles:
![]() |
S. M. Wells, M. C. Buford, C. T. Migliaccio, and A. Holian Elevated Asymmetric Dimethylarginine Alters Lung Function and Induces Collagen Deposition in Mice Am. J. Respir. Cell Mol. Biol., February 1, 2009; 40(2): 179 - 188. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. E. Burrell, G. Lu, X. C. Li, and D. K. Bishop OX40 Costimulation Prevents Allograft Acceptance Induced by CD40-CD40L Blockade J. Immunol., January 1, 2009; 182(1): 379 - 390. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Angeli, C. M. Prado, D. G. Xisto, P. L. Silva, C. P. Passaro, H. D. Nakazato, E. A. Leick-Maldonado, M. A. Martins, P. R. M. Rocco, and I. F. L. C. Tiberio Effects of chronic L-NAME treatment lung tissue mechanics, eosinophilic and extracellular matrix responses induced by chronic pulmonary inflammation Am J Physiol Lung Cell Mol Physiol, June 1, 2008; 294(6): L1197 - L1205. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. O'Riordan, N. Mendelev, S. Patschan, D. Patschan, J. Eskander, L. Cohen-Gould, P. Chander, and M. S. Goligorsky Chronic NOS inhibition actuates endothelial-mesenchymal transformation Am J Physiol Heart Circ Physiol, January 1, 2007; 292(1): H285 - H294. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Prado, E. A. Leick-Maldonado, L. Yano, A. S. Leme, V. L. Capelozzi, M. A. Martins, and I. F. L. C. Tiberio Effects of Nitric Oxide Synthases in Chronic Allergic Airway Inflammation and Remodeling Am. J. Respir. Cell Mol. Biol., October 1, 2006; 35(4): 457 - 465. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Nair, K. J. Guild, and D. Artis Novel Effector Molecules in Type 2 Inflammation: Lessons Drawn from Helminth Infection and Allergy J. Immunol., August 1, 2006; 177(3): 1393 - 1399. [Full Text] [PDF] |
||||
![]() |
F. Huaux, M. Gharaee-Kermani, T. Liu, V. Morel, B. McGarry, M. Ullenbruch, S. L. Kunkel, J. Wang, Z. Xing, and S. H. Phan Role of Eotaxin-1 (CCL11) and CC Chemokine Receptor 3 (CCR3) in Bleomycin-Induced Lung Injury and Fibrosis Am. J. Pathol., December 1, 2005; 167(6): 1485 - 1496. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Prado, E. A. Leick-Maldonado, D. I. Kasahara, V. L. Capelozzi, M. A. Martins, and I. F. L. C. Tiberio Effects of acute and chronic nitric oxide inhibition in an experimental model of chronic pulmonary allergic inflammation in guinea pigs Am J Physiol Lung Cell Mol Physiol, October 1, 2005; 289(4): L677 - L683. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Jakubzick, H. Wen, A. Matsukawa, M. Keller, S. L. Kunkel, and C. M. Hogaboam Role of CCR4 Ligands, CCL17 and CCL22, During Schistosoma mansoni Egg-Induced Pulmonary Granuloma Formation in Mice Am. J. Pathol., October 1, 2004; 165(4): 1211 - 1221. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kitagawa, T. Wada, K. Furuichi, H. Hashimoto, Y. Ishiwata, M. Asano, M. Takeya, W. A. Kuziel, K. Matsushima, N. Mukaida, et al. Blockade of CCR2 Ameliorates Progressive Fibrosis in Kidney Am. J. Pathol., July 1, 2004; 165(1): 237 - 246. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Jakubzick, E. S. Choi, K. J. Carpenter, S. L. Kunkel, H. Evanoff, F. J. Martinez, K. R. Flaherty, G. B. Toews, T. V. Colby, W. D. Travis, et al. Human Pulmonary Fibroblasts Exhibit Altered Interleukin-4 and Interleukin-13 Receptor Subunit Expression in Idiopathic Interstitial Pneumonia Am. J. Pathol., June 1, 2004; 164(6): 1989 - 2001. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Ichinose, K. D. Bloch, J. C. Wu, R. Hataishi, H. T. Aretz, M. H. Picard, and M. Scherrer-Crosbie Pressure overload-induced LV hypertrophy and dysfunction in mice are exacerbated by congenital NOS3 deficiency Am J Physiol Heart Circ Physiol, March 1, 2004; 286(3): H1070 - H1075. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tanaka, J. Morimoto, S. Kon, C. Kimura, M. Inobe, H. Diao, G. Hirschfeld, J. M. Weiss, and T. Uede Effect of Osteopontin Alleles on {beta}-Glucan-Induced Granuloma Formation in the Mouse Liver Am. J. Pathol., February 1, 2004; 164(2): 567 - 575. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Jakubzick, E. S. Choi, S. L. Kunkel, B. H. Joshi, R. K. Puri, and C. M. Hogaboam Impact of Interleukin-13 Responsiveness on the Synthetic and Proliferative Properties of Th1- and Th2-Type Pulmonary Granuloma Fibroblasts Am. J. Pathol., May 1, 2003; 162(5): 1475 - 1486. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Jakubzick, S. L. Kunkel, B. H. Joshi, R. K. Puri, and C. M. Hogaboam Interleukin-13 Fusion Cytotoxin Arrests Schistosoma mansoni Egg-Induced Pulmonary Granuloma Formation in Mice Am. J. Pathol., October 1, 2002; 161(4): 1283 - 1297. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Bone-Larson, C. M. Hogaboam, H. Evanhoff, R. M. Strieter, and S. L. Kunkel IFN-{gamma}-Inducible Protein-10 (CXCL10) Is Hepatoprotective During Acute Liver Injury Through the Induction of CXCR2 on Hepatocytes J. Immunol., December 15, 2001; 167(12): 7077 - 7083. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hesse, M. Modolell, A. C. La Flamme, M. Schito, J. M. Fuentes, A. W. Cheever, E. J. Pearce, and T. A. Wynn Differential Regulation of Nitric Oxide Synthase-2 and Arginase-1 by Type 1/Type 2 Cytokines In Vivo: Granulomatous Pathology Is Shaped by the Pattern of L-Arginine Metabolism J. Immunol., December 1, 2001; 167(11): 6533 - 6544. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hesse, A. W. Cheever, D. Jankovic, and T. A. Wynn NOS-2 Mediates the Protective Anti-Inflammatory and Antifibrotic Effects of the Th1-Inducing Adjuvant, IL-12, in a Th2 Model of Granulomatous Disease Am. J. Pathol., September 1, 2000; 157(3): 945 - 955. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |