| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Departments of Pathology,*
Microbiology,
and
Pediatrics,§
University of Brescia, Brescia and
the Department of Pathology,
University of
Verona, Verona, Italy
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
. In contrast, the role of
iNOS in human immune response against infections is still
questioned, and its expression in granulomas is poorly
investigated. Using Western blotting and immunohistochemistry,
we investigated iNOS expression in human lymph nodes with nonspecific
reactions and in tissues containing granulomas caused by
mycobacteria, Toxoplasma,
Cryptococcus neoformans,
Leishmania, Bartonella,
noninfectious granulomas (sarcoidosis, foreign body),
and other hystiocitic reactions (Kikuchi's disease, Omenn
syndrome). iNOS was undetectable in nonspecific reactive
lymphadenitis, foreign-body granulomas, and Omenn
syndrome, whereas it was strongly expressed in infectious
granulomas, sarcoidosis, and Kikuchi's diseases.
Immunohistochemistry demonstrated that iNOS was selectively expressed
by the epithelioid and multinucleated giant cells within the
granulomas. Use of an anti-nitrotyrosine antibody, recognizing
nitrosilated amino acid residues derived from nitric oxide
production, revealed a consistent positivity within the cells
expressing iNOS, thus suggesting that iNOS is functionally
active. Detection of cytokines by reverse transcriptase-polymerase
chain reaction demonstrated that tissues that were positive for
iNOS, also expressed the Th1-type cytokine interferon-
mRNA, but not the Th2-type cytokine interleukin-4. Taken
together, these results indicate that iNOS is involved in
different human immune reactions characterized by
histiocytic/granulomatous inflammation and associated with Th1-type
cytokine secretion.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Inducible nitric oxide synthase is expressed in vitro as
well as in vivo by murine macrophages on infection with
intracellular pathogens such as mycobacteria, C. neoformans,
and Toxoplasma gondii.10-12
Expression of
iNOS is regulated primarily at the transcriptional level and is
modulated by various cytokines and microbial products. Stimulation of
murine macrophages with lipopolysaccharide or with other bacterial
derivatives induce iNOS expression. In addition, cytokines, such as of
interferon- (IFN-), interleukin-2 (IL-2), and tumor necrosis
factor-
potently enhance the extent of iNOS
expression.13-17
The expression of iNOS induced
by these agents is associated with the activation of transcriptional
factors, including NF-
B, STAT-1, and
IRF-1.13,15,18
During infection by intracellular pathogens, T cells infiltrating the
granulomatous tissue produce large amounts of Th1-type cytokines such
as IL-2 and IFN-. In contrast, IL-4 and IL-5, cytokines secreted by
Th2 lymphocytes, are not detectable.8,11,19,20
Genetic deletion of IFN- or of IFN- receptor genes in mice leads
to susceptibility to mycobacteria infections and greatly reduces the
degree of NO production.21-25
Similar features
are observed in iNOS-/-
mice,26-29
suggesting that both iNOS and IFN-
play a central role in murine immune response against intracellular
pathogens.
Human immune response against intracellular pathogens is less well
characterized; recent findings indicate that IFN- has an essential
function in immune response against mycobacteria because children that
lack IFN- receptor -chain or the IFN- receptor ß-chain
develop severe infections by bacillus Calmette-Guerin or
mycobacteria.30-33
However, the role of iNOS in
human immune defense against intracellular pathogens is still poorly
characterized. Several authors have reported that iNOS protein is
expressed in monocytes and broncoalveolar macrophages obtained from
patients with mycobacteria infections as well as in hepatocytes from
individuals suffering from malaria or chronic viral
hepatitis.34-36
However, there is no final
evidence that iNOS is expressed in human monocyte-derived cells
infected by intracellular pathogens. In addition, human monocytes or
monocyte-derived macrophages, activated in vitro by a
variety of stimuli, release only small amounts of NO derivatives, and
it is unclear whether the enzyme is indeed active in human
cells.37-39
In this study, we investigated the expression of iNOS on human tissues
that displayed various forms of infectious granulomas and other
pathological conditions predominantly characterized by histiocytic
reactions. In addition, the same tissues were assessed for the extent
of protein nitrosation as a measure of iNOS activation. Finally, the
cytokine expression and NF-B cell translocation were evaluated.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Immunoblotting
For Western blot (WB) analysis, small portions of lymph nodes were
lysed in buffer containing 300 mmol/L NaCl, 50 mmol/L Tris-HCl, 2
mmol/L EDTA, 0.5% Triton X-100, 2.5 mmol/L p-nitrophenyl
p-guanidinobenzoate, 10 mg/ml aprotinin, and 10 mg/ml
leupeptin and centrifuged at 12,000 x g. Fifty
micrograms of protein was then boiled, subjected to 8% sodium dodecyl
sulfate-polyacrylamide gel electrophoresis, and electrotransferred onto
polyvinylidene fluoride membranes (Immobilon; Millipore, Bradford, MA).
Membranes were probed with a mouse IgG2a monoclonal antibody directed
against a 21-kd protein fragment corresponding to residues 961-1144
murine iNOS (Transduction Laboratories, Lexington, KY). This monoclonal
antibody was shown to react also with the human counterpart of
iNOS.41
Expression of iNOS was then detected by
enhanced chemiluminescence (ECL; Amersham Life Science, Arlington
Heights, IL). Filters were then reblotted by a rabbit anti-ß-actin
polyclonal serum to allow comparability of samples. Cell lysates from
the murine lipopolysaccharide and IFN- activated macrophage cell
line RAW 264.7 provided by the manufacturer (Transduction Laboratories)
were used as a positive control.
Immunohistochemistry
Immunostaining for iNOS, performed applying the same antibody used
for WB, was applied on frozen sections at the concentration of 20
µg/ml; an isotype (IgG2a)-matched antibody was used as negative
control. Anti-CD3 (UCHT1, Dako, Milan), anti-CD20 (L26, Dako), and
anti-CD68 (KP1, Dako) antibodies were also applied to identify T cells,
B cells, and macrophages, respectively. Tissue immunostaining for
nitrotyrosine was performed on frozen sections using a monoclonal
antibody at the concentration of 15 µg/ml (Dr. Joseph Beckman,
University of Alabama, USA). Finally, the p65 component of the
transcription factor NF-B was analyzed using the polyclonal antibody
raised against the p65 component of NF-B (Santa Cruz Biotechnology,
Heidelberg, Germany), applied at the dilution of 1:100 on both frozen
and paraffin sections.
On both cryostat and paraffin sections, immunostaining followed the streptavidin-biotin immunoperoxidase technique. Inhibition of endogenous peroxidase was performed on paraffin sections only. Chromogen reaction was developed with 3-amino-9-ethylcarbazole or with 3–3'diaminobenzidine (DAB) solution, and nuclei were counterstained with Mayer's hematoxylin.
Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) Analysis
Extraction of total RNA and RT-PCR analysis were performed as
previously described.42
Briefly, total RNA was
purified using RNAzol B (Tel-test, Friendswood, TX) following the
manufacturer's instructions in liquid nitrogen to prevent RNA
degradation. cDNA synthesis was performed with 1 µg of RNA in a total
volume of 20 µl containing 10 mmol/L Tris-HCl, pH 8.3, 50 mmol/L KCl,
5 mmol/L MgCl2, 1 mol/L dNTPs, 20 U of
ribonuclease inhibitor (Ambion Inc., Austin, TX), 2.5 µmol/L of oligo
(dT), and 50 U of reverse transcriptase (Perkin Elmer Corp., Norwalk,
CT). The reaction mixture was incubated at 42°C for 40 minutes and
stopped at 94°C for 5 minutes. A 10-µl aliquot of the cDNA obtained
was amplified in a 20-µl reaction containing 50 mmol/L KCl, 10 mmol/L
Tris-HCl, pH 8.3, 1.5 mmol/L MgCl2, 0.2 mmol/L each dNTP,
200 nmol/L each primer, and 1 U of Taq DNA polymerase
(Boheringer Mannheim, Mannheim, Germany). The following previously
described oligonucleotides were used in PCR reaction: IFN- sense 5'
AGTTATATCTTGGCTTTTCA 3', IFN- antisense 5' ACCGAATAATTAGTCAGCTT 3',
with cycling conditions of 1 minute at 94°C, 1 minute at 45°C, and
2 minutes at 72°C for 40 cycles; IL-4 sense 5' CTTCCCCCTCTGTTCTTCCT
3', IL-4 antisense 5' TTCCTGTCGAGCCGTTTCAG 3', with cycling conditions
of 1 minute at 94°C, 1 minute at 50°C, and 2 minutes at 72°C for
40 cycles; ß-actin sense 5' GTGGGGCGCCCCAGGCACCA 3', ß-actin
antisense 5' CTCCTTAATGTCACGCACGATTTC 3', with cycling conditions of 1
minute at 94°C, 1 minute at 50°C, and 1 minute at 72°C for 35
cycles.43
A sample (15 µl) of each PCR reaction
was electrophoresed through a 1.5% agarose gel and visualized with
ethidium bromide. ß-actin PCR product was used as external standard
and the mRNA expression for each cytokine was evaluated as comparison
with the PCR product over ß-actin PCR product.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Human lymph nodes showing nonspecific reactive changes or
containing infectious and noninfectious granulomas were subjected to WB
analysis by an anti-iNOS monoclonal antibody. As shown in Figure 1
, a 130-kd protein corresponding to the
molecular weight of iNOS was detected at variable extent in human lymph
nodes. Low amounts of iNOS protein were found in reactive nonspecific
lymphadenitis, whereas high contents of the enzyme were detected in
granulomatous lymphadenitis and in Kikuchi's disease. The same 130-kd
band was detected in lysates from murine activated macrophages, whereas
human thymus was negative for iNOS.
|
The localization of iNOS reactivity in lymph nodes used for WB
analysis as well as on the other tissue samples was evaluated by
immunohistochemistry. In nonspecific reactive lymphadenitis and in
normal thymuses, most monocyte-derived cells (including sinus
macrophages, tingible body macrophages, interfollicular macrophages,
and plasmacytoid monocytes) and dendritic cells (interdigitating
reticulum cells and follicular dendritic cells) were consistently
negative for iNOS (Figure 2, a and b)
. In
contrast, in epithelioid cell granulomas, the epithelioid and the
multinucleated giant cells revealed obvious cytoplasmic reactivity for
iNOS (Figure 2, d, e, g, and 3a)
. The
reactivity was particularly intense in small epithelioid cells clusters
and small necrotizing granulomas, whereas larger granulomas associated
with extensive necrosis were formed by epithelioid cells that were
either weakly positive or negative for iNOS. In infectious granulomas
in which microorganisms could be easily identified on frozen sections
(C. neoformans and Leishmania
donovani-associated granulomas), the parasitized macrophages were
clearly positive for iNOS (Figures 2, d and g)
. In Kikuchi's
lymphadenitis, the collections of histiocytes associated or not with
central necrosis showed strong reactivity for iNOS, which in contrast
was completely negative in the plasmacytoid monocytes at the periphery
of the lesions (Figure 3b)
. Noteworthy, in all cases showing iNOS
positive granulomas, the reactivity was strictly confined to the cells
within the granulomas and was absent from the surrounding tissues as
well as from the remaining lymphoid parenchyma. Serial sections stained
with CD68, CD3, and CD20 revealed that iNOS positive cells were
represented by CD68+ macrophages, whereas T and B
lymphocytes did not stain for iNOS. Interestingly, in patients with
Omenn syndrome, a pathological condition characterized by
hypereosinophilia, T-cell activation, and production of Th2
cytokines,40
lymph nodes did not
display iNOS staining, although macrophages were
detectable in large numbers and focally formed small
epithelioid cell granulomas (Figure 3, c and d)
. In the
foreign-body granuloma associated with vascular plastic prosthesis, the
palisade of CD68 positive macrophages and multinucleated giant cells
surrounding the foreign material did not show any reactivity for iNOS
(Figure 2c)
. Practically no lymphoid cells were found associated with
this granulomatous reaction (data not shown).
|
|
Immunostaining for anti-nitrotyrosine revealed a weak granular
reactivity that was consistently detectable in the cytoplasm of the
macrophages forming the granulomas (Figure 2, f and h)
; no obvious
differences were found between infectious and noninfectious granulomas.
In ad- dition to macrophages, endothelial cells also
displayed nitrotyrosine expression. Lymph nodes showing nonspecific
reactive changes, as well the foreign body reaction that did not
express iNOS were negative for anti-nitrotyrosine staining (data not
shown).
Expression of Interferon- and IL-4 mRNAs
We extracted total RNA from lymph nodes obtained from patients
affected with mycobacteria, cryptococcal, and cat
scratch/Bartonella infections, Kikuchi's lymphadenitis, or
from nonspecific reactive lymphadenitis (Figure 4)
. By reverse transcription followed by
cDNA amplification, we found that IFN- mRNA was detectable in lymph
nodes that displayed a granulomatous reaction; in particular higher
levels were detected in one out of two mycobacteria lymph nodes, in the
Cryptococcus granuloma and in the Kikuchi's lymphadenitis. A lower
extent of IFN- mRNA expression was observed in the other lymph node
with mycobacteria and Bartonella granuloma. In contrast,
reactive lymph nodes did not express IFN- mRNA (Figure 4)
. IL-4 mRNA was not detectable in any of the tissue samples analyzed
but was expressed in activated peripheral blood lymphocytes that were
used as positive control. These observations suggest that iNOS
expression in macrophages from granulomatous tissues could be related
to local production of IFN-.
|
B in Granulomatous
Reactions
In normal lymphoid tissue sections, occasional nuclear reactivity
is found in rare lymphocytes and endothelial cells, whereas NF-B is
localized in the cytoplasm of the majority of lymphoid and nonlymphoid
cells (Figure 5a)
. In contrast,
immunostaining for NF-B in granulomas showed that most epithelioid
and multinucleated giant cells were positively labeled in their nuclei
(Figure 5b)
. Finally, no nuclear NF-B reactivity was detected in
foreign-body associated granulomas.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Besides microbial pathogens, cytokines associated with the immune
response against infectious agents also play a role in regulating iNOS
expression. In particular, the Th1-type cytokines IFN-, IL-2, and
TNF are potent inducers of iNOS
expression,13-15,44
whereas Th2 cytokines, such
as IL-4, suppress iNOS expression.44-47
The
potential role of cytokines in the induction of iNOS is supported by
the observation that noninfectious granulomas were also strongly
positive for iNOS. In vitro, lipopolysaccharide-induced iNOS
expression in murine macrophages is enhanced by stimulation with
IFN-, a Th1-type cytokine. It should be noted that Th1-type
cytokines, including IFN- are required to direct cell-mediated
immune responses leading to the eradication of intracellular
pathogens30-32
and are also fundamental in the
immune mechanisms involved in the formation of granulomas in
sarcoidosis.48
Tissue samples containing iNOS
positive cells in both infectious and noninfectious granulomas were
expressing IFN- mRNA as detected by RT-PCR. In particular,
mycobacterial, cryptococcal granulomas, and Kikuchi's lymphadenitis,
which were strongly positive for iNOS protein, also expressed at high
levels IFN- mRNA, thus suggesting a possible cause-effect
relationship between macrophage expression of iNOS and IFN-
production. The lack of IL-4 mRNA expression in these tissue samples is
in agreement with the observation that IL-4 is a potent inhibitor of
IFN- mediated iNOS expression in
vitro.44-46,49
To further support the role
of IFN- secreting T cells in the induction of iNOS expression in
macrophages, we have shown that lymph nodes derived from patients with
Omenn syndrome, a disease characterized by predominant production of
the Th2-type cytokines, IL-4 and IL-5,40
were
totally negative for iNOS although tissues contained a large number of
activated T cells.
In humans, other nongranulomatous inflammatory conditions characterized
by a Th1-dependent cell mediated immune response are associated with
iNOS expression by mononuclear macrophages, such as rheumatoid
arthritis, celiac disease, graft versus host reactions, and
psoriasis.9,41,50,51
The present study provides
evidence that also in Kikuchi's lymphadenitis the histiocytic reaction
is associated with strong iNOS expression by the histiocytes and with
high IFN- mRNA tissue content, suggesting that iNOS induction by
activated T cells might have a relevant role in the pathogenetic
mechanisms of this disease.
It has been shown that iNOS expression is primarily regulated at the
transcriptional level and depends on NF-B activation, as truncation
of NF-B binding sites in the promoter region of iNOS gene virtually
abrogates iNOS inducibility.13-15
Interestingly,
we have shown that staining for NF-B complex primarily occurs on the
nucleus of many epithelioid and giant cells within the granulomas,
suggesting that activation and translocation of this transcription
factor might be involved in iNOS activation. In contrast, foreign-body
granulomas neither expressed iNOS in the cytoplasm nor showed NF-B
positivity in their nuclei.
Up-regulation of iNOS mRNA and protein by murine macrophages is strictly associated with their capacity to produce NO and consequent microbicidal activity in vitro and in vivo.4 In mice, infections by intracellular pathogens are exacerbated by administration of NOS inhibitors, and mice rendered genetically deficient in iNOS show decreased resistance toward intracellular pathogens.27-29 In humans, the antimicrobial activity of iNOS expressing cells is not completely elucidated. iNOS has been detected in monocytes and monocyte-derived cells from patients with tuberculosis, chronic and acute pneumonia, Leishmania, malaria infection, and in hepatocytes from patients with viral hepatitis.34-36,52-54 Nevertheless, despite the fact that human macrophages can express iNOS mRNA and protein, their ability to generate NO has been questioned because nitrates or nitrites are hardly detectable in macrophage-derived supernatants.39 The evidence that iNOS is strongly expressed in the sites of infections sustained by intracellular pathogens seems to indicate that this enzyme is involved in the cellular defense mechanisms elicited against these infectious agents. Moreover, our observation that iNOS expression in infectious granulomas is associated with protein nitrosation suggests that iNOS is functionally active during infections sustained by intracellular pathogens, thus supporting a possible role of the enzyme in human immune responses against infectious agents.
In conclusion, the present study provides evidence that expression of iNOS and nitrotyrosine formation represent a common finding in human granulomas and histiocytic reactions with different etiology, but all characterized by a Th1-type cytokine production.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Supported in part by Grant n.96D/T/27 from the 2nd National Project on Tuberculosis, Istituto Superiore di Sanità, (Rome, Italy) to M. Duse and by a grant from M.U.R.S.T. (Rome, Italy), project 40%: Inflammation: Biology and Clinic to M. Chilosi.
Accepted for publication September 24, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
plus lipopolysaccharide-induced nitric oxide synthase in mouse macrophages. J Immunol 1995, 155:886-894[Abstract]
and bacterial lipopolysaccharide. J Exp Med 1993, 177:1779-1784, and TNF receptor-1-mediated signaling. J Immunol 1997, 158:905-912[Abstract]
-dependent production of reactive nitrogen intermediates mediates IFN- plus IL-2-induced murine macrophage tumoricidal activity. J Immunol 1992, 149:3290-3296[Abstract]
and lipopolysaccharide. Proc Natl Acad Sci USA 1993, 90:9730-9734 gene-disrupted mice. J Exp Med 1993, 178:2243-2247 receptor have profoundly altered responses to infection with Bacillus Calmette-Guerin and subsequent challenge with lipopolysaccharide. J Exp Med 1993, 178:1435-1440 receptor. Proc Natl Acad Sci USA 1993, 90:6626-6630 in resistance to Mycobacterium tuberculosis infection. J Exp Med 1993, 178:2249-2254-receptor gene and susceptibility to mycobacterial infection. N Engl J Med 1996, 335:1941-1949 receptor deficiency associated with idiopatic lethal bacillus Calmette-Guerin (BCG) infection. N Engl J Med 1996, 335:1956-1961 receptor 1 deficiency in a child with tuberculoid bacillus Calmette-Guerin infection and a sibling with clinical tuberculosis. J Clin Invest 1997, 100:2658-2664[Medline]
receptor and susceptibility to mycobacterial infection. J Clin Invest 1998, 101:2364-2369[Medline]
-induced production of nitric oxide in mouse macrophages infected with herpes simplex virus type 2. FEBS Lett 1997, 414:61-64[Medline]
(IFN-) on inducible nitric oxide synthase expression in bovine macrophages exposed to gram-positive bacteria. Clin Exp Immunol 1997, 109:431-438[Medline]
-dependent expression of inducible nitric oxide synthase, interleukin-12, and interferon--inducing factor in macrophages elicited by allografted tumor cells. Biochem Biophys Res Commun 1996, 224:555-563[Medline]
This article has been cited by other articles:
 |
|
 |
|
  M. V. Palmer, W. R. Waters, and T. C. Thacker Lesion Development and Immunohistochemical Changes in Granulomas from Cattle Experimentally Infected with Mycobacterium bovis Vet. Pathol., November 1, 2007; 44(6): 863 - 874. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Mukherjee, A. Ukil, and P. K. Das Immunomodulatory Peptide from Cystatin, a Natural Cysteine Protease Inhibitor, against Leishmaniasis as a Model Macrophage Disease Antimicrob. Agents Chemother., May 1, 2007; 51(5): 1700 - 1707. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. L. Pereira-Suarez, C. Estrada-Chavez, C. Arriaga-Diaz, P. Espinosa-Cueto, and R. Mancilla Coexpression of NRAMP1, iNOS, and Nitrotyrosine in Bovine Tuberculosis. Vet. Pathol., September 1, 2006; 43(5): 709 - 717. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Hostetter, E. Huffman, K. Byl, and E. Steadham Inducible Nitric Oxide Synthase Immunoreactivity in the Granulomatous Intestinal Lesions of Naturally Occurring Bovine Johne's Disease Vet. Pathol., May 1, 2005; 42(3): 241 - 249. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Raju, Y. Hoshino, K. Kuwabara, I. Belitskaya, S. Prabhakar, A. Canova, J. A. Gold, R. Condos, R. I. Pine, S. Brown, et al. Aerosolized Gamma Interferon (IFN-{gamma}) Induces Expression of the Genes Encoding the IFN-{gamma}-Inducible 10-Kilodalton Protein but Not Inducible Nitric Oxide Synthase in the Lung during Tuberculosis Infect. Immun., March 1, 2004; 72(3): 1275 - 1283. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. H. Darwin, S. Ehrt, J.-C. Gutierrez-Ramos, N. Weich, and C. F. Nathan The Proteasome of Mycobacterium tuberculosis Is Required for Resistance to Nitric Oxide Science, December 12, 2003; 302(5652): 1963 - 1966. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Greenwell-Wild, N. Vazquez, D. Sim, M. Schito, D. Chatterjee, J. M. Orenstein, and S. M. Wahl Mycobacterium avium Infection and Modulation of Human Macrophage Gene Expression J. Immunol., December 1, 2002; 169(11): 6286 - 6297. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Qadoumi, I. Becker, N. Donhauser, M. Rollinghoff, and C. Bogdan Expression of Inducible Nitric Oxide Synthase in Skin Lesions of Patients with American Cutaneous Leishmaniasis Infect. Immun., August 1, 2002; 70(8): 4638 - 4642. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H.-S. Choi, P. R. Rai, H. W. Chu, C. Cool, and E. D. Chan Analysis of Nitric Oxide Synthase and Nitrotyrosine Expression in Human Pulmonary Tuberculosis Am. J. Respir. Crit. Care Med., July 15, 2002; 166(2): 178 - 186. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. D. Chan, J. Chan, and N. W. Schluger What is the Role of Nitric Oxide in Murine and Human Host Defense against Tuberculosis? . Current Knowledge Am. J. Respir. Cell Mol. Biol., November 1, 2001; 25(5): 606 - 612. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Musso, R. Badolato, D. Ravarino, S. Stornello, P. Panzanelli, C. Merlino, D. Savoia, R. Cavallo, A. N. Ponzi, and M. Zucca Interaction of Bartonella henselae with the Murine Macrophage Cell Line J774: Infection and Proinflammatory Response Infect. Immun., October 1, 2001; 69(10): 5974 - 5980. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. A. Pileri, F. Facchetti, S. Ascani, E. Sabattini, S. Poggi, M. Piccioli, D. Rondelli, F. Vergoni, P. L. Zinzani, P. P. Piccaluga, et al. Myeloperoxidase Expression by Histiocytes in Kikuchi's and Kikuchi-Like Lymphadenopathy Am. J. Pathol., September 1, 2001; 159(3): 915 - 924. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. R. Gantt, T. L. Goldman, M. L. McCormick, M. A. Miller, S. M. B. Jeronimo, E. T. Nascimento, B. E. Britigan, and M. E. Wilson Oxidative Responses of Human and Murine Macrophages During Phagocytosis of Leishmania chagasi J. Immunol., July 15, 2001; 167(2): 893 - 901. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. C. Melby, B. Chandrasekar, W. Zhao, and J. E. Coe The Hamster as a Model of Human Visceral Leishmaniasis: Progressive Disease and Impaired Generation of Nitric Oxide in the Face of a Prominent Th1-Like Cytokine Response J. Immunol., February 1, 2001; 166(3): 1912 - 1920. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Nathan and M. U. Shiloh Reactive oxygen and nitrogen intermediates in the relationship between mammalian hosts and microbial pathogens PNAS, August 1, 2000; 97(16): 8841 - 8848. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Bonecchi, F. Facchetti, S. Dusi, W. Luini, D. Lissandrini, M. Simmelink, M. Locati, S. Bernasconi, P. Allavena, E. Brandt, et al. Induction of Functional IL-8 Receptors by IL-4 and IL-13 in Human Monocytes J. Immunol., April 1, 2000; 164(7): 3862 - 3869. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Jaiswal, N. F. LaRusso, L. J. Burgart, and G. J. Gores Inflammatory Cytokines Induce DNA damage and Inhibit DNA repair in Cholangiocarcinoma Cells by a Nitric Oxide-dependent Mechanism Cancer Res., January 1, 2000; 60(1): 184 - 190. [Abstract] [Full Text]
|
|
|
|
|
|
B. Balabanli, Y. Kamisaki, E. Martin, and F. Murad Requirements for heme and thiols for the nonenzymatic modification of nitrotyrosine PNAS, November 9, 1999; 96(23): 13136 - 13141. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Liu, R. P. Tewari, and P. R. Williamson Laccase Protects Cryptococcus neoformans from Antifungal Activity of Alveolar Macrophages Infect. Immun., November 1, 1999; 67(11): 6034 - 6039. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||
