| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Department of Pathology and Immunology, National Cancer Institute "Regina Elena," Rome, Italy
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
.
Additional structural and functional heterogeneity of the CD44
molecules may also be generated by cell type-specific glycosylation. In
fact, the extracellular region of CD44s contains seven potential
N-linked glycosylation sites and the membrane proximal domain contains
four Ser-Gly motifs (serine and glycine residues) that constitute the
minimal sequence for the attachment of chondroitin sulfate and other
glycosaminoglycan (GAG). Furthermore, several serine and threonine
residues, which may provide potential sites for O-linked glycosylation,
are available on the molecule (Figure 2)
.7-9
In CD44
splice variants (CD44v), the degree of glycosylation can be
consistently increased because extra N- and O-glycosylation sites are
provided by additional inserted exon products. Moreover, isoforms
containing exon products v3 and v10 possess additional sites for the
attachment of GAG side chains.9
Several reports
have demonstrated that CD44 hyaluronate-binding ability is tightly
regulated and alternative splicing of variant exons, as well as
posttranscriptional modifications of the molecule (changes in
glycosylation), represent two important regulatory mechanisms of
CD44-mediated functions.7-11
|
|
Following the initial demonstration by Gunthert et al2 that a variant of CD44 molecule containing exon product v6 could confer metastatic potential on a rat pancreatic adenocarcinoma cell line, a great deal of scientific interest has focused on attempting to better define the role that these molecules may play in tumor growth and progression, focusing on the possibility of identifying new prognostic tumor markers as well as potential targets for specific therapeutic approaches. Interestingly, an abnormal pattern of CD44 gene activity in terms of qualitative and/or quantitative expression of CD44v has been demonstrated in neoplastic cells compared to their normal counterpart.14 In several instances soluble CD44v molecules were detectable in serum of patients with neoplastic diseases.13,15,16 It seems likely that the possibility of detecting in vivo CD44 and its isoforms in both neoplastic tissues and serum specimens could represent a reliable approach to the diagnosis of malignancies and the assessment of their metastatic potential.
To explore this issue, several mAbs to CD44 variant exon products have been generated and are commercially available. These reagents are extensively used in immunohistochemical and immunoenzymatic assays with the aim of correlating the expression of specific CD44v to the biological features of the tumor. There is abundant scientific work in this field which may be of great prognostic value in oncology.13
In this study, using gene transfer experiments, reverse transcriptase-polymerase chain reaction (RT-PCR), and immunochemical assays, we demonstrate that the immunoreactivity of several mAbs directed at CD44 variant exon products could be strongly impaired by the structural variability of CD44v molecules. The unpredictable immunoreactivity of these reagents could generate a large series of false negative results, which in turn could affect both the reliability of immunophenotypical studies on CD44v expression in vivo and their prognostic value.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Normal and neoplastic tissues from surgical biopsies were obtained from the Department of Surgical Pathology at the Regina Elena Cancer Institute. Tissue samples were snap-frozen in liquid nitrogen and 4-µm cryostat sections were obtained and fixed in absolute acetone for 10 minutes. Fixed sections were used in immunohistochemical assays as previously reported.17 Cultures of human neoplastic cell lines derived from primary and metastatic tumors were maintained at 37°C in 5% CO2 according to standard methods. Tissue culture media (RPMI and Dulbecco's modified Eagle medium), L-glutamine, and G418 were purchased from Gibco (Grand Island, NY). Fetal bovine serum was obtained from Irvine Scientific (Santa Ana, CA). Tissue culture plastic ware was acquired from Falcon (Lincoln Park, NJ).
Monoclonal Antibodies and Polyclonal Antisera
All of the commercially available mAbs to CD44 and CD44 variant
exon products used in this study are reported in Table 1
. These reagents were used according to
the manufacturers' instructions. Mouse mAbs anti-human CD44 variants
acquired from R&D System (Minneapolis, MN) were derived from a fusion
of mouse myeloma cells (SP2/0) with spleen cells from a mouse immunized
with a human chimeric affinity-purified fusion protein, CD44v3–10-Fc,
containing the full product codified by all of the CD44 variant exons
(v3-v10) (Figure 1)
. The specificity of the mAbs to CD44v was
determined (as reported by the data sheet of the reagents) by two
independent sets of fluorescence-activated cell sorter (FACS)
analyses in which a panel of CD44-transfected COS cells and
CD44-transfected neoplastic B cells were used as targets. The cDNA used
for such transfections contained various combinations of the variant
exons v3-v10, (ie, v3, 8–10; v8–10; v7–10; v6–10, etc.). Several
mAbs specific for selected CD44 variant exon products were then
obtained after adequate cross-screening. Mouse mAbs specific to CD44
variant exon products and rabbit polyclonal antisera to CD44v3-v10
epitopes, acquired from Bender MedSystem (Vienna, Austria), were also
generated using purified CD44 fusion protein as immunogen and were
characterized as reported above. mAbs to pan-CD44 named IM-7, A3D8, and
3G5 were commercially obtained (Table 1)
. These reagents recognize a
nonpolymorphic determinant on mouse (IM-7) or human (A3D8 and 3G5) CD44
standard region. mAbs of the BRIC series, named BRIC35, BRIC205,
BRIC214, BRIC219, BRIC222, BRIC223, BRIC225, BRIC235, BRIC241, and
BRICKZ1, were kindly provided by Dr. Francis Spring (International
Blood Group Reference Laboratory, Bristol, UK), and have been
previously characterized.18
All of these
reagents, which are considered pan-CD44 monoclonal antibodies, detect
epitopes on the invariant CD44 extracellular region. mAb BRIC235, which
recognizes an epitope into the NH2-terminal
hyaluronic acid-binding domain of CD44, was used to inhibit
CD44-mediated binding to hyaluronate.7,18
Fluorescein-labeled goat anti-mouse and goat anti-rat antisera were
acquired from Cappel (Malvern, PA).
|
cDNA clones encoding amplified segments of human CD44 isoforms
containing no variable exons (CD44s), exon v10, exons v6–10, exons
v7–10, v3,8–10 and v3–10, were inserted into the
BglI/NarI cloning site of pRcCMV
CD44Bgl/Nar as previously
reported.6,19
This construct contained
full-length CD44 cDNA modified by site-directed mutagenesis to provide
a cassette for insertion of alternatively spliced exons at the
appropriate site within the CD44 extracellular domain. Development of
stable transfectants was performed according to a modified version of
previously described protocols.6,19
cDNA clones
encoding human CD44 standard molecule and isoforms v10, v6–10, v7–10,
v3,8–10, and v3–10 were inserted into the pRcCMV expression vector
and the construct transfected into Namalwa cells by electroporation
using 4-mm cuvettes (750 V/cm, 960 µF). Transfectants were selected
for resistance to geneticin (Gibco) and maintained at a concentration
of 2 mg/ml in RPMI (Gibco) supplemented with 10% fetal bovine serum, 2
mmol/L glutamine (Gibco), and gentamicin (15 µg/ml) (Table 2)
.
|
Production and characterization of CD44s N-glycosylation
site-specific mutants were previously described in
detail.7
Briefly, CD44 site-directed mutants were
prepared by encoding the desired mutation in overlapping
oligonucleotide primers20
and generating the
mutations by PCR using CD44s cDNA in the CDM8 expression vector as a
template. Finally, the constructs were stably transfected in
CD44-negative MC melanoma cell line using the electroporation method.
Transfectants were selected for resistance to geneticin (Gibco) and
maintained at a concentration of 1 mg/ml in Dulbecco's modified Eagle
medium as described before. Each of these mutants produces a CD44s
molecule in which asparagine residues (Asn) in one or more potential
N-glycosylation sites are substituted with isoleucine (Ile). The
mutants used in this study and the position of the Asn-Ile
substitutions are NGS1, Asn in position 25; NGS2, Asn in position 57;
NGS5, Asn in position 120; NGS2–5, Asn in positions 57 and 120;
NGS3–5, Asn in positions 100 and 120; and NGS3–4, Asn in positions
100 and 110, all substituted by Ile residues (Figure 3)
. The position numbering refers
to the sequence present in the CD44 file in SWISS-PROT
Protein Data Bank, accession number P16070.
|
Expression of CD44 and its variants on cell lines and transfectants was evaluated immunochemically by incubating the target cells with primary mAbs for 45 minutes at 4°C. Cells were then washed in phosphate-buffered saline (PBS), incubated with a fluorescein-labeled affinity-purified goat-anti-mouse or anti-rat antisera (Cappel) for 1 hour, washed twice, resuspended in PBS, and finally analyzed by flow cytometry (Becton Dickinson, Mountain View, CA). Maintenance of CD44 cell surface expression by the stable transfectants was tested periodically by flow cytometry.
Immunohistochemistry was performed using an indirect avidin-biotin complex (ABC) immunoperoxidase method, with Vectastain ABC Kit (Vector Laboratories, Burlingame, CA). Slides were incubated overnight with selected mAbs at 4°C in a moist chamber. The enzymatic activity was developed using 3-amino-9-ethyl-carbazole as previously reported.17
Cell Labeling and Immunoprecipitation
For metabolic labeling, cell lines and transfectants were washed with methionine-free RPMI 1640 (Gibco) and starved in the same medium supplemented with 10% dialyzed, heat-inactivated fetal bovine serum for 2 hours. Cells were then labeled with 250 µCi/ml 35S methionine (Amersham International, Buckinghamshire, UK) for 12 hours, washed in PBS, and lysed at 4°C for 1 hour in a lysis buffer containing 1% Triton X-100 (Sigma, St Louis, MO), 10 µg/ml leupeptin (Sigma), 100U/ml aprotinin (Sigma), and 10 µM phenylmethylsufonyl fluoride (BRL, Bethesda, MD). Nuclei were removed by centrifugation and lysates precleared by a 2-hour incubation with Protein A-sepharose CL4B beads (Pharmacia, Uppsala, Sweden) coated with rabbit anti-mouse IgG (Cappel). After preclearing, lysates were incubated with protein A-Sepharose CL4B beads previously conjugated with an anti-CD44 mAb for 1 hour at 4°C. Protein A-sepharose beads were then washed and immunoprecipitates eluted by boiling. Finally, precipitated proteins were subjected to sodium dodecyl sulfate/7.5% polyacrylamide gel electrophoresis and the gels were fixed, dried, and analyzed after exposure for autoradiography.
RT-PCR
Total RNA was obtained from cell lines, transfectants, and frozen tissue specimens by guanidine isothiocyanate method as previously described.8 cDNAs for PCR were prepared by a oligo-p(dT) method. Total RNA (5 µg) previously treated with DNaseI RNase-free (all commercial preparations in this paragraph obtained from Boehringer Mannheim) was incubated with 0.1 mol/L oligo-p(dT) (18 bases) for 10 minutes at 65°C and placed in ice for 5 minutes. Then 5 µl of 5x RT buffer, 40 units of RNase-Inhibitor (Boehringer Mannheim), 1 mmol/L dNTP, 25 units of M-MuLV Reverse Transcriptase, and water to a total volume of 25 µl were added together and the mix was incubated for 90 minutes at 37°C. Three microliters of the reaction volume were used for each PCR reaction. The PCR reactions were carried out in a total volume of 100 µl with the following reagents added together: 3 µl of cDNA; 8 µl of dNTP 1 mmol/L ; 0.2 mmol/L of each oligonucleotide; 10 µl of 10x buffer containing 100 mmol/L Tris-HCl, 15 mmol/L MgCl2, 500 mmol/L KCl, pH 8.3, and 2.5 units of Taq DNA polymerase.
The oligonucleotides used as primers in this study were: C4F, CCAATGCCTTTGATGGACCA and C16R, CTGGAATTTGGGGTGTCCT, complementary to the constant sequence respectively 5' upstream (standard exon 4) and 3' downstream (standard exon 16) of the variable portion of CD44 molecule (variant exons v3-v10). Exon-specific primers were designed for each CD44 variant exon as follows: V3F2, GGCTGGAGCCAAATGAAG; V3R, GGTGCTGGAGATAAAATC; V4F, TCAACCACACCAC-GGGCT; V4R, AGTCATCCTTGTGGTTGT; V5F, GTAGACAGAAATGGCACC; V5R, TGTCGTTGTAGAATGTGG; V6F, CAGGCAACTCCTAGTAGT; V6R, AGGTGTCCGTGTTGTCGA; V7F, GCCTCAGCTCATACCAGT; V7R2, ATGGGGTGTGAGATTGGG; V8F, ATGGACTCCAGTCATAGT; V8R, CGTTGTCATTGAAAGAGG; V9F, GCTTGA-TGTCAGAGTAGA; V9R2, ATCTTCCTTCCAAGCCTTC; V10F2, AGGAATGATGTCACAGGT; V10R, TGATAAGGAACGATTGAC. To minimize the possibility of amplification of genomic DNA, upstream and downstream primers were used in each PCR reaction on variant and standard exons respectively. Reaction products were obtained in a GeneAmp 9600 thermal cycler (Perkin Elmer, Norwalk, CT) with an initial denaturation step (94°C for 5 minutes) and a total of 30 cycles of denaturation (94°C for 1 minute), annealing (56°C for 1 minute), and extension (72°C for 1 minute), followed by a final elongation (7 minutes at 72°C). A nucleic acid sample (total RNA extract) without addition of reverse transcriptase was used as negative control for each PCR experiment. PCR products were separated on a 2% agarose (Boehringer Mannheim) and gels were stained with ethidium bromide (Sigma).
Treatment of Cells with Inhibitors of N- and O-Glycosylation
To inhibit N- and O-glycosylation, cells were cultured in standard
conditions with the addition of the following inhibitors of
glycosylation: 5–10 µg/ml tunicamycin (Calbiochem-Novabiochem, La
Jolla, CA) and/or 2 mM
phenyl-N-acetyl-
-D-Galactosaminide (pNAcGal)
(Sigma). Both drugs were used according to the manufacturers'
instructions and the cells were incubated at 37°C overnight.
Treatment of the cells with ß-D-xyloside (4-methyl-umbelliferil-ß-D-xyloside) to inhibit GAG side chain attachment on large CD44v molecules was performed by incubating each cell line with 1 mmol/L ß-D-xyloside at 37°C for 16 hours before performing both FACS analysis and CD44 immunoprecipitation.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Using CD44-negative Burkitt's lymphoma cell line (Na-malwa),
we created a panel of stable transfectants expressing CD44s and some
related isoforms, namely CD44v10, CD44v6–10, CD44v7–10, CD44v3,8–10,
and CD44v3–10, representative of CD44 molecules containing only
constitutive exon products and variable exon products v10, v6–10,
v7–10, v3,8–10, and v3–10 respectively (Table 2)
. These
transfectants have been extensively characterized both phenotypically
and functionally using flow cytometry, immunoprecipitation, and RT-PCR
and we previously demonstrated that all of them expressed the expected
CD44 receptor.6
A series of neoplastic cell lines
were also characterized for CD44 expression by flow cytometry,
immunoprecipitation (data not shown) and RT-PCR, using CD44
exon-specific primers (Table 3)
. Cell
lines and transfectants were used as targets to test a panel of mAbs
directed to CD44 variant exon products as reported below.
|
Namalwa transfectants and selected CD44v-expressing neoplastic cell lines were used as targets to study the immunoreactivity of mAbs to CD44 variant exon products. Although pan-CD44 mAb IM-7, which recognizes an epitope carried by the constant region of CD44, invariably detected CD44 molecules on both transfectants and neoplastic cell lines, mAbs directed at specific CD44 variant exon products failed in several instances to detect the respective CD44 isoforms. In fact, among the reagents used in this study, only anti-CD44v3 and anti-CD44v6 mAbs demonstrated a congruous immunoreactivity on all of the target cells carrying the respective epitopes.
A detailed selection of the most intriguing results regarding the
immunoreactivity of these reagents, as evaluated in FACS analysis, is
reported in Figure 4
. mAb to CD44v5 was
nonreactive on transfectant Nam v3–10, expressing a high molecular
weight CD44 isoform (>200 kd) representative of the full variant
region v3 to v10. Furthermore, mAb to CD44v6 showed a variable
reactivity on both transfectant Nam v3–10 and DeMa cell line
(constitutively expressing CD44v3, 6–7, and 9–10) compared to Nam
v6–10, in which CD44v6 epitope was consistently detected. mAb to
CD44v7–8, directed against an epitope encoded by both v7 and v8
variant exons, showed variable staining on Nam transfectant CD44v3–10
but failed to detect the respective target on transfectants CD44v6–10
and CD44v7–10 and breast carcinoma cell line Sab (expressing CD44v3
and 6–10). Finally, mAb to CD44v7 failed to detect the respective exon
product on several cell lines, including transfectants Nam CD44v7–10,
CD44v6–10, CD44v3–10 (Figure 4A)
and neoplastic cell lines Med and
DeMa (Figure 4B)
, despite the presence of CD44 isoforms carrying
specific exon product v7, as demonstrated in FACS analysis, RT-PCR
(Tables 2 and 3)
, and immunoprecipitation assay (Figure 5
and see below). Surprisingly, the same
mAb was reactive with neoplastic cell line Sab, constitutively
expressing a CD44 isoform containing the exon product v7 (Figure 4B)
.
This finding strongly suggests that the failure to immunodetect
specific targets on the above reported cell lines and transfectants is
not mAb-dependent but is probably due to the different exon assortment
in each CD44v molecule. mAb to CD44v10 was always nonreactive on both
Namalwa transfectants and neoplastic cell lines carrying the specific
epitopes.
|
|
. The
difference in CD44 variant exon assortment in the two cell lines (see
Tables 2 and 3
) was confirmed by the different molecular weight of CD44
immunoprecipitates. In fact, CD44 immunoprecipitated from Sab cell line showed a molecular weight of ~200 kd (depending on the presence of v3 and v6 additional exon products), compared to CD44v7–10 which had a molecular weight of ~170 kd.
In Figure 6
, using specific primers for
exon v7 and v8, we definitely demonstrated with RT-PCR the presence of
related transcripts in both breast carcinoma cell line Sab and Nam
CD44v7–10 transfectant, despite the restricted reactivity of mAb to
CD44v7 epitope on the Sab cell line. Furthermore, mAb to CD44v7–8
failed to detect the specific epitope in both of them.
|
To characterize the expression of CD44 and its isoforms in normal
and neoplastic human tissues, we used specific mAbs extensively in
indirect immunofluorescence and immunoperoxidase. Altogether we
evaluated about 200 tissue specimens from human breast, thyroid, colon,
lung, and skin. A panel of experimental human tumors derived from well
characterized neoplastic cell lines xenografted in nude mice was also
immunohistochemically evaluated. In our experience the mAbs to CD44
variant exon products showed a variable (staining 50–70% of the
cells) or heterogeneous (staining <10% of the cells) reactivity
with the majority of the neoplastic epithelial tissues, demonstrating
the presence of specific CD44 isoforms. In several instances the
expected immunoreactivity of some mAbs to CD44 variant exon products
was not observed, despite the presence of specific CD44v transcripts in
the target tissues. This inconsistent reactivity was negligible for
mAbs to CD44v6 and CD44v3. For all other reagents, the occurrence of
potential false negative results during immunohistochemical procedures
was estimated as summarized in Table 4
.
However, the presence of specific CD44v transcripts, demonstrated
in RT-PCR, do not per se guarantee the expression of CD44 isoforms
at detectable protein levels, so the percentage reported in Table 4
could be overestimated.
|
Differences in Glycosylation Can Affect Immunoreactivity of mAbs to CD44s
The possibility that posttranscriptional modifications of CD44 may
affect the immunoreactivity of specific mAbs is supported by the fact
that CD44s N-glycosylation site-specific mutants were not always
recognized by mAbs to pan-CD44. In fact, as demonstrated in FACS
analysis (Table 5)
, immunodetection of
CD44s is severely impaired in MC melanoma transfectants expressing
CD44s molecules carrying specific mutations in N-glycosylation sites.
|
) are critical for
immunodetection of CD44 molecules by the majority of the mAbs to
pan-CD44 used in this study. As reported in Table 5
, substitution of
the Asp residues in positions 25 (NGS1), 57 (NGS2), 57–120 (NGS2–5),
and 100–120 (NGS3–5) strongly impairs the immunoreactivity of the
BRIC mAbs, except for BRIC 214 and KZI, which seem to recognize
glycosylation-independent epitopes.18
As reported above, several mAbs to CD44 variant exon products used in
this study were raised by nonglycosylated fusion proteins and the
possibility that glycosylation could result in altered tertiary
structure of CD44v molecules, masking specific epitopes, has been
investigated. Treating cell lines and Namalwa transfectants with
tunicamycin and/or
phenyl-N-acetyl--D-galactosaminide to
inhibit N- and O-glycosylation respectively, we were unable to restore
the immunoreactivity of those mAbs which failed to detect specific
epitopes, but a consistent modulation of the staining was observed in
FACS analysis for all other reagents, indicating that differences in
the glycosylation status of CD44v, which is cell type-specific, can
really impair the immunotargeting of CD44 exon-specific mAbs
(unpublished results).
Removal of GAG Side Chains Inserted on Large CD44v Isoforms Can Change the Immunoreactivity of Some mAbs to CD44 Variant Exon Products
To investigate whether the presence of GAG side chains may alter
the immunoreactivity of mAbs to CD44 variant exon products, we
performed the experiment shown in Figure 7
. Breast carcinoma cell line Sab
(constitutively expressing CD44 exon products v3 and v6–10) was
stained with mAb to CD44v7 epitope when cultured in basal conditions.
However, after treatment with
4-methyl-umbelliferil-ß-D-xyloside, which inhibits the
attachment of GAG side chains on CD44v molecules, this immunoreactivity
was lost. A parallel decrease in CD44 molecular weight due to
inhibition of the attachment of GAG side chains on the CD44v3,6–10
molecules was observed in immunoprecipitation assay (Figure 8)
. This experiment demonstrates that in
particular, CD44 exon assortments (ie, Sab cell line v3,6–10) the
presence of GAG side chains is necessary to expose v7 epitope, probably
generating an open configuration of the molecule regarding the exon
product v7. On the contrary, the immunoreactivity of mAb anti-CD44v7
was not modulated in xyloside-treated Namalwa transfectants CD44v7–10,
v6–10, and v3–10, demonstrating the importance of both the exon
assortment and the molecular conformation compared to the presence of
the GAG side chains (data not shown).
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
)
possesses four additional potential N-glycosylation sites and a large
number of extra O-glycosylation sites.7,9
Consequently, CD44v isoforms are likely to be highly glycosylated. CD44v molecules are preferentially expressed on epithelial malignant lesions and some of them have recently been regarded as promising tools for the improvement of diagnostic accuracy and for predicting the unfavorable outcome of several neoplastic diseases.13 Furthermore, the possibility of interfering with specific functions mediated by these molecules has been also proposed as the basis for a new therapeutic approach to inhibiting tumor progression.2
With the aim of identifying in vivo the expression of CD44 variants on human tumors, mAbs directed against specific CD44 variant exon epitopes have been developed and are widely used in flow cytometry and immunohistochemical analysis. Although the immunohistochemical use of these reagents may still be informative in large and well-designed studies on human tissues, our findings demonstrate that such assays provide partial information about the real pattern of CD44v expression in vitro and in vivo.
It is important to remember that these reagents do not allow the identification of the specific exon assortment in CD44v molecules, but rather define exclusive epitopes on a specific exon product, which can sometimes be inaccessible for the complex structural variability of CD44v molecules. In fact, exon-specific epitopes can be included in a short CD44v molecule as well as in larger and highly glycosylated isoforms representative of a more complex exon assortment.
In this study we demonstrate that (1) in a model of well characterized neoplastic cell lines and CD44v transfectants, specific exon assortments and/or posttranscriptional modifications of CD44 variant molecules can mask exon-specific epitopes; 2) GAG side chains, carried by high molecular weight CD44v isoforms, may be part of the epitopes recognized by mAbs to CD44 variant exon products or, more likely, may play a critical role in determining the exact conformation of the molecule necessary to expose exon specific epitopes; (3) in a panel of transfectants expressing CD44 N-glycosylation site-specific mutants generated in the constant region of CD44 extracellular domain, asparagine-isoleucine substitution is sufficient per se to impair the immunoreactivity of several mAbs to pan-CD44.
These data strongly support the hypothesis that some sugar residues, when placed in the invariant CD44s extracellular domain, can be part of the epitopes recognized by specific CD44 mAbs. The finding that the N-glycosylation status of CD44 molecules, which is cell type-specific, can potentially affect the immunoreactivity of several pan-CD44 mAbs helps to explain the difficulties encountered in trying to epitope-map a number of CD44 mAbs over the past 10 years. At the same time, it may explain the failure of some exon-specific mAbs to detect their respective epitopes on highly N- and O-glycosylated CD44v molecules.21 In fact, it is noteworthy that both flanking sequences contributed by the alternative splicing of CD44v exons, as well as the different degree of glycosylation of CD44 isoforms, are potentially able to modify the conformation of a given epitope and hence render it available for antibody recognition.
In conclusion, we have shown that the reactivity of some mAbs directed at the CD44 variant exon epitopes can be impaired by the structural variability of CD44. These data suggest the potential for a large number of false negative results deriving from immunohistochemical studies focusing on CD44v expression in vivo, in particular on neoplastic epithelial tissues in which the glycosylation machinery is qualitatively and quantitatively altered. The possibility of this occurrence should be always considered during the immunohistochemical evaluation of CD44 expression in vivo.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Supported by Associazione Italiana per la Ricerca sul Cancro.
Accepted for publication September 21, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
3ß1 heterodimer with tumor progression. Int J Cancer 1993, 54:68-72[Medline]
This article has been cited by other articles:
 |
|
 |
|
  A. Gasbarri, M. P. Martegani, F. Del Prete, T. Lucante, P. G. Natali, and A. Bartolazzi Galectin-3 and CD44v6 Isoforms in the Preoperative Evaluation of Thyroid Nodules J. Clin. Oncol., November 1, 1999; 17(11): 3494 - 3502. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
.
