| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Technical Advances |
Gene Rearrangements in Paraffin-Embedded Tissue by Polymerase Chain Reaction and Nonradioactive Single-Strand Conformational Polymorphism Analysis
From the Departments of Pathology,
Beth
Israel Deaconess Medical Center, Harvard Medical School, Boston,
Massachusetts, and Istituto Dermopatico dell'Immacolata,*
Rome, Italy
| Abstract |
|---|
|
|
|---|
(TCR-
) gene rearrangements by polymerase chain reaction
single-strand conformational polymorphism (PCR-SSCP) in
paraffin-embedded tissue. Jurkat and HSB-2 cell lines and peripheral
blood samples from normal individuals were used as monoclonal and
polyclonal controls, respectively. DNA was extracted from 24
biopsies of T-cell lymphomas, 12 biopsies of reactive lymphoid
infiltrates, and 2 biopsies of primary cutaneous large B-cell
lymphomas. V
18, V
9, V
10,
V
11, and J
1/J
2 consensus primers were used for TCR-
gene rearrangement amplification and PCR products were analyzed by
nonradioactive SSCP. Monoclonal controls yielded a well-defined banded
pattern, whereas all polyclonal T-cell controls showed a
reproducible pattern of smears. We detected monoclonality in 20/21
(95%) T-cell lymphoma cases, whereas no dominant T-cell clones
were found in any of the reactive lymphoid infiltrates or B-cell
lymphomas. Sensitivity of 15% was demonstrated by serially diluting
Jurkat cells in mononuclear blood cells from normal individuals. We
conclude that nonradioactive PCR-SSCP for TCR-
gene rearrangement
analysis is a useful adjunct to routine histological and
immunophenotypic methods in the diagnosis of T-cell lymphoproliferative
disorders in paraffin-embedded tissue.
| Introduction |
|---|
|
|
|---|
T-cell receptor (TCR) gene rearrangement analysis is a methodology used to detect clonality in a T-cell population.3,4 Clonality is not synonymous with malignancy because it can be detected in nonneoplastic lymphocytic infiltrates.5 Nevertheless, it is generally accepted that most neoplasms are clonal in origin. Therefore, the detection of a clonal population in an equivocal lymphoproliferative lesion can be a very useful diagnostic tool.
TCR gene rearrangments have been used in
the detection of clonality by Southern
hybridization.3,4
This technique requires a large
amount of DNA that must be extracted from fresh or frozen tissue. More
recently, polymerase chain reacion (PCR)-based methods have allowed the
detection of T-cell clonality in paraffin-embedded tissue without the
use of radioisotopes.6-9
Of the four TCR genes,
, ß,
, and
, the TCR-
gene consists of a relatively small
set of variable (V) and joining (J) regions and is therefore
particularly suitable for PCR amplification of DNA extracted from
paraffin-embedded tissue using consensus
primers.10-14
In addition, the TCR-
locus is
rearranged in the majority of normal and neoplastic T-lymphocytes.
Unfortunately, the simple genomic organization of the TCR-
locus and
the presence of only one hypervariable N region in each joining segment
are responsible for the small range of variability in length of the
different rearrangements.15
As a consequence, the
PCR products cannot be optimally analyzed by polyacrylamide gel
electrophoresis (PAGE), which separates DNA fragments on the basis of
size. To overcome this problem, PCR products have recently been
analyzed using procedures frequently used for point mutation detection,
such as denaturing gradient gel electrophoresis
(DGGE)5,16-18
and single-strand conformational
polymorphism analysis (SSCP),19-25
which
separate DNA fragments according to nucleotide sequence in addition to
size. The classic SSCP protocol26
uses
radioactive PCR products and large-formatted nondenaturing gels,
although several nonradioactive SSCP protocols have now been
developed.27,28
Nonradioactive PCR-SSCP of
TCR-
has been previously compared to TCR-ß analysis by both the
traditional Southern blot approach23
and the
reverse transcriptase PCR method25
using
available abundant frozen tissues, confirming the validity of this PCR
technique in detecting clonality. Here, we describe a simplified,
sensitive, highly reproducible, nonradioactive PCR-SSCP method for
TCR-
gene rearrangement analysis using precast minigels in a
thermally controlled recirculation apparatus. This technique allows
discrimination between clonal and polyclonal TCR-
gene
rearrangements in paraffin-embedded tissue and is suitable for
routine use in diagnostic surgical pathology laboratories.
| Materials and Methods |
|---|
|
|
|---|
Jurkat and HSB-2 cell lines with known TCR-
gene rearrangements
were used as a source of monoclonal T cells for control
experiments.17
The Jurkat cell line was used as
monoclonal control for assays performed with V
18 and V
11
primers and the HSB-2 cell line was used as monoclonal control for
V
9 and V
10 rearrangements. Peripheral blood samples from three
normal individuals were used as polyclonal controls.
Patient Cases
A series of 24 biopsies from 21 patients was selected from the
files of the Departments of Pathology of Beth Israel Deaconess Medical
Center and Istituto Dermopatico dell' Immacolata from 1994 to 1997 to
include as many T-cell lymphoma subtypes as possible. The series
included large cell cutaneous T-cell lymphoma (CTCL) CD30-positive (6
cases), mycosis fungoides (9 biopsies from 8 cases), large cell CTCL
CD30-negative (1 case), subcutaneous 
T-cell lymphoma (1 case),
peripheral T-cell lymphoma of the lung (1 case), nodal precursor T-cell
lymphoblastic lymphoma and metachronous neoplastic pleural effusion (2
biopsies from 1 case), nodal peripheral T-cell lymphoma (2 cases),
enteropathy-associated T-cell lymphoma of small bowel (2 biopsies from
1 case). CTCL represent the majority of the selected cases for two
reasons. First, skin is the most frequent site for T-cell lymphoma in
Western countries. Second, for most CTCL molecular assessment of
clonality must be performed on paraffin-embedded tissue because frozen
tissue is usually not available.
Fourteen cases of reactive nodal and cutaneous T-cell infiltrates were arbitrarily selected from the same files as controls. They included hyperplastic lymph nodes (6 cases), cutaneous lymphoid hyperplasia (3 cases), primary cutaneous large B-cell lymphoma (2 cases), lichen planus (2 cases), and chronic nonspecific dermatitis (1 case).
Thirty-one tissue samples and 1 pleural fluid were formalin-fixed and
paraffin-embedded; the remaining six biopsies were frozen (Table 1)
. In all cases, the diagnosis was based
on clinical, histological, and immunohistochemical criteria. T-cell
immunophenotype was determined by immunohistochemical expression of one
or more T-cell antigens (CD3, CD5, CD45RO) in neoplastic cells.
|
Cell lines were grown in RPMI medium (Gibco BRL, Gaithersburg, MD) with 10% fetal bovine serum (Gibco BRL) and 1% antibiotic-antimycotic (Gibco BRL). DNA was extracted from cell lines and peripheral blood cells using QIAamp Tissue Kit (QIAGEN, Chatsworth, CA). For paraffin-embedded tissues, 5-µm sections were cut with disposable blades, collected on glass slides, deparaffinized with xylene, washed with ethanol, and rehydrated in deionized water. For frozen tissue, 5- to 10-µm sections were cut, collected on glass slides, immediately fixed in cold 95% ethanol for 5 minutes, air-dried, and subsequently rehydrated in deionized water. The moist tissue was scraped off the glass slides with a sterile blade and digested in 50150 µl buffer containing 10 mmol/L Tris, 1 mmol/L EDTA, 1% Tween 20, and 200 µg/ml proteinase K. In 25 samples in which the infiltrate was localized only in circumscribed areas of the section, slides were lightly stained with hematoxylin and areas to be microdissected were visualized under the microscope and isolated on the slide, scraping the surrounding tissue with a sterile 30G1/2 needle. A new sterile 30G1/2 needle was then used to remove the target cells from the slide. These were placed in 3050 µl of digestion buffer. Proteinase K digestion was performed at 37°C for 1236 hours. The samples were then heated at 94°C for 5 minutes to inactivate the enzyme and centrifuged and the supernatant was used as template for PCR amplification.
PCR Amplification
ß-globin
To assess the quality of the DNA extracted from paraffin-embedded samples, the human ß-globin gene was amplified with specific primers (5'GAAGAGCCAAGGGCAGGTAC3' and 5'CAACTTCATCCACGTTCACC3')29 in a single-round PCR reaction for 35 cycles.
V
18
A seminested protocol involving two rounds of PCR was used for the
amplification of the rearranged TCR-
gene with V
18 primers.
Consensus primers for V
I family (V
18/A) and for J
1 and J
2
segments (J
1/J
2 consensus)24
(Figure 1
, left) were used in the first round (7
cycles). First-round products (110 µl) were reamplified in a
second-round (33 cycles) reaction using the same J
1/J
2 consensus
downstream primer and an internal upstream consensus primer for V
I
family (V
18/B).17
|
9
Cases that demonstrated polyclonality with V
18 primers were
reamplified with a single round of PCR using V
9 upstream primer with
the J
1/J
2 consensus downstream primer for 40 cycles (Figure 1
,
left).17
V
10
Cases that demonstrated polyclonality with V
18 and V
9
primers were reamplified with a single round of PCR using V
10
upstream primer with the J
1/J
2 consensus downstream primer for 40
cycles (Figure 1
, left).17
V
11
Cases that demonstrated polyclonality with V
18, V
9, and
V
10 primers were reamplified with a single round of PCR using V
11
upstream primer with the J
1/J
2 consensus downstream primer for 40
cycles (Figure 1
, left).17
PCR amplification was performed in GeneAmp PCR System 9600 (Perkin Elmer, Norwalk, CT). The reaction mixture (50 µl) contained PCR buffer (50 mmol/L KCl, 10 mmol/L Tris-HCl, pH 8.3), 200 µmol/L each of dNTP, 1.5 mmol/L MgCl, 0.2 µmol/L of each primer, and 1.25 U of AmpliTaq Gold (Perkin Elmer). Either 80120 ng of DNA or 110 µl of paraffin-embedded or frozen tissue digests were used as template. To optimize PCR amplification of formalin-fixed paraffin-embedded samples, different aliquots of tissue digests were tested for each case and the concentration that produced the most efficient amplification was used for PCR/SSCP analysis. Each PCR cycle consisted of 94°C for 1 minute, 55°C for 1 minute and 30 seconds, and 72°C for 1 minute and 30 seconds. Before each round, the PCR reaction mixture was heated to 94°C for 10 minutes to activate the AmpliTaq Gold. In all experiments, monoclonal (Jurkat and HSB-2 cell lines) and polyclonal (peripheral blood cells from normal individuals) controls were run in parallel with the test samples. To check the efficiency of the amplification, products were analyzed by electrophoresis on 2% agarose gels stained with ethidium bromide and visualized on an UV transilluminator. SSCP analysis was performed only if a single band of the expected size was detected on the gel. DNA from each sample was amplified at least twice.
SSCP Analysis
SSCP analysis was performed using a thermostatically controlled
electrophoresis apparatus. Briefly, 20% polyacrylamide TBE precast
minigels (8.0 x 8.0 x 0.1 cm;39:1
acrylamide:bis-acrylamide) were used with the ThermoFlow ETC System
(Novex, San Diego, CA) filled with 1.5x TBE buffer. The ThermoFlow ETC
System consists of the ThermoFlow MiniCell, the ETC unit, and a high
efficiency heat exchanger connected to an external thermostatically
controlled circulating bath (Isotemp 1016 D, Fisher Scientific,
Pittsburgh, PA). The buffer temperature is kept constant by
recirculation through the heat exchanger at high flow rates. We
optimized the SSCP, running the assay at different preset gel buffer
temperatures (7°C, 10°C, 15°C, 20°C, 22°C, and 25°C) (data
not shown). A constant buffer temperature of 22°C was used for
V
18 PCR products and of 20°C for V
9, V
10, and V
11 PCR
products. PCR products (510 µl) were mixed with 0.4 µl of 1 mol/L
methylmercury hydroxide (Johnson Matthey Electronics,War Hill, MA), 1
µl of 15% w/v Ficoll (MW 400,000) loading buffer containing 0.25%
bromophenol blue and 0.25% xylene cyanol, and 1x TBE buffer to a
total volume of 20 µl. The mixture was heated to 95°C for 5
minutes, chilled on ice for 1 minute, and loaded on the gel. Gels were
run at 200 volts for 12 hours for V
18 products, 7 hours for V
9
products, and 5 hours for V
10 and V
11 products. Gels were
subsequently stained with SYBR-Green II (Molecular Probes, Eugene, OR)
diluted 1:10,000 in 1x TBE for 3045 minutes and destained in water
for 10 minutes. Ultraviolet transillumination was used to visualize
gels.
Sequencing of SSCP Bands
One dominant SSCP band from two cases of T-cell lymphoma (1 large
cell CTCL CD30-positive and 1 mycosis fungoides) was excised from the
20% polyacrylamide gel using a sterile blade. In both cases, SSCP
bands were localized at the level of the uppermost smear present in the
polyclonal controls. To isolate DNA, the gel slice was crushed against
the wall of a microcentrifuge tube and incubated for 16 hours in
elution buffer (0.5 mol/L ammonium acetate, 10 mmol/L magnesium
acetate, 1 mmol/L EDTA, pH 8, 0.1% sodium dodecyl sulfate) at 37°C
on a rotating wheel.30
DNA was subsequently
precipitated in ethanol and resuspended in sterile water. The eluted
DNA was reamplified using V
18/B and J
1/J
2 consensus primers.
PCR products were cleaned with the Geneclean II kit (BIO 101, Vista,
CA) and sequenced using dye terminator fluorescence on an ABI 373
automated sequencer. One hundred nanograms of PCR products were used
with 3.2 pmol/L V
18/B upstream primer. Sequencing was performed
under the following cycling conditions: 96°C for 15 seconds, 55°C
for 2 minutes, and 73°C for 1 minute.
Sensitivity Test
To assess the sensitivity of the technique, Jurkat cells were
serially diluted in normal peripheral blood mononuclear cells. Jurkat
cells were pelleted and resuspended in sterile phosphate-buffered
saline at a concentration of 103
cells/µl.
Peripheral blood mononuclear cells were isolated by sedimentation in
gradients of Ficoll-Paque (Pharmacia, Upsala, Sweden), pelleted,
and resuspended in sterile phosphate-buffered saline at the same
concentration as Jurkat cells. Serial dilutions of Jurkat cells in
mononuclear blood cells from a normal individual (1:2, 1:10, 1:20,
1:100, and 1:1000) were prepared and DNA extraction was performed by
boiling the samples for 15 minutes. Ten microliters of each boiled
sample were subsequently used as template for PCR amplification using
V
18 and J
1/J
2 consensus primers.
| Results |
|---|
|
|
|---|
Aliquots of PCR products were resolved on 2% agarose gel. All
tested cases showed the presence of a single band of 268 bp for
ß-globin products (not shown). PCR amplification with specific
primers for TCR-
gene demonstrated a single band of approximately
240 bp for V
18 products (Figure 2A)
,
180 bp for V
9 products (Figure 3A)
,
160 bp for V
10 products, and 140 bp for V
11 products (Figure 4A)
.
|
|
|
V
18 PCR Products
SSCP analysis of V
18 PCR products resulted in two distinct
patterns. All polyclonal T-cell controls produced a pattern of three
smears of variable intensity occurring at reproducible locations and
distances from one another (Figure 1
, right, and Figure 2B
, Lanes 2 and
7). In contrast, the monoclonal control (Jurkat cell line) yielded a
well-defined banded pattern at the level of the lowest smear observed
in the polyclonal samples (Figure 1
, right, and Figure 2B
, Lanes 1 and
6). Occasionally, a slow migrating band above the uppermost smear could
be observed in both polyclonal and monoclonal samples and was thus
regarded as an artifact (not shown).
Results of the tissue samples study are summarized in Table 1
. By SSCP
analysis, 20 of 24 biopsies of T-cell lymphomas produced a banded
pattern characteristic of monoclonality, using V
I (V
18) family
consensus and J
1/J
2 consensus primers. Clonality was thus
confirmed in 17 of 21 (81%) T-cell lymphoma cases analyzed with this
set of primers. The bands were localized at the level of one (or rarely
two) of the three smears characteristic of the polyclonal controls
(Figure 2B
, Lanes 35). Each banded pattern consisted of two stronger
bands corresponding to the single DNA strands of the clonal TCR-
rearrangement. For each sample, the banded pattern was identical when
the products of at least two distinct PCR amplifications were run in
the same gel (Figure 5)
. In two T-cell
lymphoma cases (2 large cell CTCL CD 30-positive), SSCP analysis
produced a banded pattern consisting of four predominant bands, most
likely corresponding to biallelic rearrangements (Figure 2B
, Lane 4).
When the PCR products of these two cases were run on a 10%
polyacrylamide gel, each produced two bands, confirming the
rearrangement of both alleles (not shown). In three T-cell lymphoma
cases, in which samples from synchronous (1 mycosis fungoides) and
metachronous (1 precursor T-cell lymphoblastic lymphoma and 1
enteropathy associated T-cell lymphoma) lesions were studied, identical
banded patterns were observed on the SSCP gel for samples from the same
case (Figure 5)
. Using the same set of primers, 6/6 hyperplastic lymph
nodes, 4/6 inflammatory conditions of the skin, and 2/2 B-cell
lymphomas showed three smears identical to those obtained with
polyclonal controls (Figure 2B
, Lanes 810). Two cutaneous lichen
planus cases and one T-cell lymphoma case (mycosis fungoides) were
characterized by the presence of faint multiple bands located at all
three levels of smearing described for polyclonal cases (not shown).
However, in each of these cases the banded pattern was not reproducible
in the multiple amplifications of the same DNA sample. In one of the
two lichen planus cases, DNA was re-extracted using a smaller amount of
digestion buffer to obtain a higher DNA concentration and the assay was
repeated. This time a smear characteristic of a polyclonal population
was observed.
|
9 PCR Products
SSCP analysis of V
9 PCR products resulted in two distinct
patterns. All polyclonal T-cell controls produced a pattern of two
smears of variable intensity occurring at reproducible locations and
distances from one another (Figure 1
, right and Figure 3B
, Lane 2). In
contrast, the monoclonal control (HSB-2 cell line) yielded a
well-defined banded pattern at the level of both smears observed in the
polyclonal samples (Figure 1
, right; Figure 3B
, Lane 1).
Four T-cell lymphoma cases, twelve reactive lymphocytic infiltrates,
and two primary B-cell lymphoma cases that did not show a monoclonal
result with the first set of primers were also amplified using V
9
and J
1/J
2 consensus primers and submitted to SSCP analysis. One
of four T-cell lymphomas analyzed showed a monoclonal V
9
rearrangement (Figure 3B
, Lane 3), whereas the remaining three cases
produced polyclonal smears. Polyclonal V
9 rearrangements were also
observed in all reactive lymphocytic infiltrates and B-cell lymphomas
analyzed. As observed for V
18 PCR products, each banded pattern,
consisting of two predominant bands, was reproducible when different
PCR amplifications of the same sample were run on the same SSCP gel
(not shown).
V
10 and V
11 PCR Products
SSCP analysis of V
10 and V
11 PCR products resulted in two
distinct patterns. All polyclonal T-cell controls produced a smear
(Figure 1
, right; Figure 4B
, Lanes 2 and 6), whereas monoclonal
controls (HSB-2 and Jurkat cell lines) yielded a well-defined banded
pattern (Figure 1
, right; Figure 4B
, Lanes 1 and 5). Three T-cell
lymphoma samples, all reactive T-cell infiltrates, and B-cell
lymphomas, which did not show a monoclonal result with either V
18
or V
9 primers, were also amplified using V
10 and J
1/J
2
consensus primers and submitted to SSCP analysis (Figure 4B
, Lanes 3
and 4). Two of three T-cell lymphomas analyzed showed monoclonal V
10
rearrangements (Figure 4B
, Lane 3). The remaining T-cell lymphoma case,
all reactive T-cell infiltrates, and B-cell lymphomas previously tested
for V
10 rearrangements (Figure 4B
, Lane 4) were amplified using
V
11 and J
1/J
2 consensus primers and submitted to SSCP analysis
(Figure 4B
, Lane 7). The T-cell lymphoma case showed polyclonality.
Polyclonal V
10 and V
11 rearrangements were observed in all
reactive T-cell infiltrates and B-cell lymphomas.
In summary, monoclonality was detected in 20/24 biopsies using V
18
primers, in 1/4 using V
9 primers, in 2/3 using V
10 primers, and
in 0/1 remaining samples using V
11 primers. Thus, using V
111
primers, monoclonality was established in 23/24 samples from 20/21
patients.
Sequencing of SSCP Bands
Results of sequencing SSCP bands confirmed that the bands were
derived from clonal TCR-
gene rearrangements, in both T-cell
lymphoma cases analyzed. Sequencing analysis showed that both
rearrangements used the V
2 variable region and each one was
characterized by a unique N hypervariable segment (large cell cutaneous
T-cell lymphoma CD30-positive: TCAACGCGTAAATTATT, mycosis fungoides:
CCTATATGGATCC).
Sensitivity Test
To assess the sensitivity of the technique, Jurkat cells were
serially diluted in normal peripheral blood mononuclear cells. A banded
pattern was still observable on the SSCP gel when the Jurkat
cell line represented 15% of the sample (Figure 6)
.
|
| Discussion |
|---|
|
|
|---|
Because the junctional sequence of TCR-
gene rearrangements shows
relatively small variation in length but significant diversity in
nucleotide composition,15,17
only techniques that
separate PCR products on the basis of nucleotide sequence can reliably
detect clonal TCR-
gene rearrangements. SSCP26
analysis and DGGE31,32
are procedures that allow
separation of DNA fragments of identical length but different
nucleotide sequence. These methods are based on the principle that
secondary structures affect DNA mobility through a polyacrylamide gel.
Reverse transcriptase PCR/SSCP analysis of TCR-ß trancripts has been
successfully used to detect dominant TCR gene rearrangements within a
population of T lymphocytes.33-36
However,
because RNA cannot be efficiently extracted from paraffin-embedded
tissue, this methodology is not applicable to archival samples. Both
PCR/SSCP and PCR/DGGE have recently been used in the analysis of
TCR-
gene rearrangements either for diagnostic purposes or to follow
the evolution of a T-cell malignancy of a given
patient.5,16-25
In our opinion, both techniques,
used as reported in the literature thus far, have limitations for
routine diagnostic use.
PCR/DGGE has been extensively used for the detection of clonal TCR-
gene rearrangments. However, in our experience and according to several
authors,9,23,25
DGGE is a complex technique that
requires both a specialized apparatus and refined technical skills (eg,
in casting denaturing gels with reproducible gradients) and is thus not
readily adaptable to the routine clinical laboratory. In addition,
Offermans et al,37
after testing DGGE and SSCP as
tools for the detection of junctional diversity in rearranged TCR
sequences, pointed out that although both methodologies are suitable,
SSCP is a relatively simple and rapid procedure when compared to DGGE.
Volkenandt and Koch used a cRNA-SSCP methodology to analyze rearranged
TCR-
genes in acute lymphocytic leukemia, gastrointestinal
lymphomas, and cutaneous lymphomas.19-21
cRNA-SSCP is based on multiple different conformations of RNA
(generated by in vitro transcription from PCR products) that
give rise to an individual fingerprint. Although this methodology
appears to have a higher sensitivity in point mutation detection
compared to DNA-SSCP, when this methodology is applied to TCR-
gene
rearrangement analysis, the presence of multiple bands on the SSCP gel
prevents the discrimination between monoclonal and oligoclonal T-cell
populations. In fact, as pointed out by Koch et
al,20
biallelic TCR gene rearrangements or the
simultaneous presence of additional clones cannot be reliably
distinguished. Finally, cRNA-SSCP technique has the disadvantage of
requiring an additional time-consuming and expensive in
vitro transcription step.
Baruchel and co-workers studied clonality by PAGE analysis followed by
assessment of clonal evolution at Ig/TCR loci (both
and
) in
acute lymphoblastic leukemia by SSCP.22
Because
all relevant gene rearrangements were screened by PCR-PAGE analysis and
a radioactive SSCP technique was used only to compare rearranged
junctional sequences at presentation and relapse, it is difficult to
compare this study with ours, which has a strictly diagnostic intent.
Two additional recent articles describe TCR-
rearrangements using
nonradioactive PCR-SSCP.23,25
Although their
results confirm the utility of this technique, the authors have used
predominantly nonarchival tumor samples. In addition, Kaul and
co-workers23
used consensus primers for the V
I
(V
18) family only, whereas Lynas et al25
did
not adequately address the issue of the sensitivity of their technique.
Our goal was to develop a PCR-SSCP technique that is simple, reproducible, nonradioactive, and sensitive, as well as a valid alternative to the DGGE technology. In addition, because most T-cell lymphomas that present a diagnostic dilemma are extranodal and thus almost invariably formalin-fixed and paraffin-embedded, the methodology was developed in archival tissues, often microdissected from stained slides.
In devising our methodology, we chose to address the parameters that,
in the traditional approach, were responsible for the lack of
reproducibility of the SSCP technique.26,27
Gel
temperature is the most critical parameter influencing SSCP band
resolution and reproducibility. To avoid heat-induced conformational
changes in the secondary structure, gel temperature should be constant.
This, however, is quite difficult to achieve in large gels. It has been
recently shown that the use of a thermostatically controlled circulator
which accurately maintains a predetermined buffer temperature within
the gel unit allows reproducible separation of single strands of
nonradioactive PCR products on polyacrylamide precast
minigels.27
The ideal temperature for
nonradioactive SSCP varies among individual PCR products and requires
empirical trials to obtain optimal results for each product.
The temperatures of 22°C for V
18 products and of 20°C for
V
9, V
10, and V
11 products were chosen because they produced a
well defined banded pattern for monoclonal controls and a smear for
polyclonal controls.
In addition, to maximize the sensitivity of detection, SSCP gel staining was performed using SYBR-Green II (Molecular Probes), which has been shown to give better results in staining ssDNA when compared to ethidium bromide.28
In summary, there are five novel aspects of the technique described here. First, it is applicable to paraffin-embedded tissue. Second, it is simple, based on the use of commercially available precast minigels. Third, it is reproducible, based on standardization of all parameters including PCR settings, running time, temperature (using a recirculating apparatus capable of maintaining constant buffer temperature), and voltage. In fact, the same banding pattern is obtained when the same sample is amplified and run on different SSCP gels (data not shown). Fourth, it offers high sensitivity of detection for a nonradioactive technique with the use of SYBR Green II. Fifth, it uses microdissection before DNA extraction.
Using this technique, we were able to demonstrate clonality in 20/21
(95%) T-cell lymphoma cases. A very high percentage of our cases
(81%) showed at least one clonal TCR-
gene rearrangement involving
V
18 and J
1/J
2 regions. Three additional cases showed
clonality when subsequently analyzed with V
9, V
10, V
11, and
J
1/J
2 primers.
It has been previously shown that V
18 and J
1/J
2 segments are
involved in approximately 6070% of clonal TCR-
gene
rearrangements detected by Southern blot analysis in various T-cell
malignancies14,38
and in 79% of clonal TCR-
gene rearrangements detected by Southern blot and PCR/heteroduplex
methodology in CTCL.39
Clonality has been
demonstrated in 90% of CTCL cases investigated by PCR/DGGE, using
primers for V
19 and J
1/J
2 segments.5
Our study confirms the frequent use of V
19 and J
1/J
2 regions
in neoplastic clones of CTCL, representing the majority of T-cell
lymphoma cases included in our study. However, the true frequency of
V
19 and J
1/J
2 segments in clonal gene rearrangements of CTCL
needs to be assessed by further studies.
One of 21 (5%) T-cell lymphoma cases showed polyclonality with all
sets of primers used in our study. We can speculate that the TCR-
genes of the neoplastic clone were in germline configuration, deleted,
or, most likely, contained rearrangements involving one of the JP, JP1,
and JP2 regions that have not been investigated. Several authors who
recently studied TCR-
gene by PCR found that approximately 10% of
T-cell lymphoma cases contained clonal TCR-
gene rearrangements
exclusively involving JP, JP1, and JP2
pseudogenes.25,40
Therefore, we estimate that
about 510% of clonal TCR-
gene rearrangements are not detectable
by our technique, which does not include primers for JP, J1, and JP2
segments. We did not detect clonality in any of the reactive
lymphocytic infiltrates, hyperplastic lymph nodes, or B-cell lymphomas
with any of the sets of primers used (V
18, V
9, V
10, V
11,
and J
1/J
2 primers). However, two lichen planus cases and one
T-cell lymphoma case analyzed using V
18 primers produced faint,
nonreproducible bands on the SSCP gel. The T-cell lymphoma case showed
monoclonality when subsequently analyzed with V
10 primers. In one of
the two lichen planus cases, in which the assay was repeated using a
higher DNA concentration, a reproducible smear characteristic of a
polyclonal population was observed. The banded pattern obtained with
lower amounts of template in this lichen planus case is most likely
related to the preferential random amplification of TCR-
rearrangements of reactive T-lymphocytes present in samples with low
DNA concentration (so-called
pseudoclonality).41,42
Accordingly, in the T-cell
lymphoma case, we hypothesize that only the TCR-
gene rearrangements
of benign tumor infiltrating lymphocytes were randomly amplified using
V
18 and J
1/J
2 primers, whereas the rearrangments of the
neoplastic clone (shown to be clonal with V
10 primers) were not. To
avoid pseudoclonality, products from at least two different PCR
amplifications should be run on the same SSCP gel and only if an
identical banded pattern is obtained should the sample be considered
clonal for TCR-
gene rearrangement. In addition, seminested PCR is
used with V
18 and J
1/J
2 consensus primers to increase the
sensitivity and specificity of the amplification. Finally, SSCP should
be run only if a single band of the expected size and with an intensity
comparable to that of controls is present on the 2% agarose gel.
The SSCP banded pattern is closely related to the nucleotide sequence
of the DNA fragments and is, therefore, highly specific for each
monoclonal TCR-
gene rearrangement. Therefore, the PCR-SSCP
technique has the advantage of allowing direct comparison between
results of analyses performed on multiple samples. More specifically,
it may be used to evaluate synchronous and metachronous lesions from
the same patient. Furthermore, clonal TCR-
gene rearrangements can
be confirmed by sequencing dominant SSCP bands, without the need for
subcloning techniques.
In conclusion, we describe a simple, sensitive, reproducible,
nonradioactive technique for the assessment of T-cell clonality in
archival paraffin-embedded tissue. This technique is amenable to use in
routine diagnostic pathology. Based on the results of this study, we
are currently using TCR-
PCR-SSCP as an adjunct to the tools
commonly used to diagnose T-cell lymphoma.
| Footnotes |
|---|
Presented in part at the annual meeting of the United States and Canadian Academy of Pathology, Boston, Massachussetts, March 1998.
Accepted for publication October 28, 1998.
| References |
|---|
|
|
|---|
gene rearrangements in early mycosis fungoides/Sezary syndrome by polymerase chain reaction and denaturing gradient gel electrophoresis (PCR/DGGE). J Invest Dermatol 1994, 103:34-41[Medline]
chain gene. Diagn Mol Pathol 1992, 1:173-179[Medline]
-chain variable-region genes in human DNA. Nature 1986, 319:420-422[Medline]
genes: nine germline variable genes belonging to two subgroups. Cell 1986, 45:237-246[Medline]
gene locus. EMBO J 1987, 6:1945-1950[Medline]
gene (TRG
) locus. FEBS Lett 1987, 224:291-296[Medline]
gene locus: cloning of new segments and study of V
rearrangements in neoplastic T and B cells. Blood 1988, 72:776-783
9 and V
2 gene segments in normal blood and lung compared with the limited diversity in a granulomatous disease. J Exp Med 1990, 172:169-181
gene rearrangements by denaturing gradient gel electrophoresis of GC-clamped polymerase chain reaction products: correlation with tumor-specific sequences. Am J Pathol 1995, 146:46-55[Abstract]
gene rearrangements by polymerase chain reaction and denaturing gradient gel electrophoresis. Blood 1995, 86:305-310
and immunoglobulin heavy chain. Leukemia 1994, 8:946-952[Medline]
genes. Br J Haematol 1994, 86:316-321[Medline]
gene by polymerase chain reaction and single-strand conformation polymorphism (PCR-SSCP). Mol Diagn 1996, 1:131-137[Medline]
ß and 
varieties. Diagn Mol Pathol 1996, 5:121-126[Medline]
rearrangement. Mol Cell Probes 1998, 12:41-48[Medline]
locus in human peripheral T-cell lymphomas. J Pathol 1994, 174:233-242[Medline]
gene rearrangements for diagnosis and monitoring of cutaneous T-cell lymphomas. Blood 1994, 83:3271-3278
chain gene rearrangements in patients with lymphoproliferative diseases. Br J Haematol 1996, 94:136-139[Medline]
This article has been cited by other articles:
![]() |
M Christensen, A D Funder, K Bendix, and F B Soerensen Comparative investigations of T cell receptor {gamma} gene rearrangements in frozen and formalin-fixed paraffin wax-embedded tissues by capillary electrophoresis J. Clin. Pathol., June 1, 2006; 59(6): 645 - 654. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Werner, J. C. Woo, W. Vernau, P. S. Graham, R. A. Grahn, L. A. Lyons, and P. F. Moore Characterization of Feline Immunoglobulin Heavy Chain Variable Region Genes for the Molecular Diagnosis of B-cell Neoplasia Vet. Pathol., September 1, 2005; 42(5): 596 - 607. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Y. Yang, D. Xu, J. Du, H. Kamino, J. Rakeman, and H. Ratech Rapid Detection of Clonal T-Cell Receptor-{beta} Gene Rearrangements in T-Cell Lymphomas Using the LightCycler-Polymerase Chain Reaction with DNA Melting Curve Analysis J. Mol. Diagn., February 1, 2005; 7(1): 81 - 88. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. C. Greiner and R. J. Rubocki Effectiveness of Capillary Electrophoresis Using Fluorescent-Labeled Primers in Detecting T-Cell Receptor {gamma} Gene Rearrangements J. Mol. Diagn., August 1, 2002; 4(3): 137 - 143. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. S. Meier, A. Rufle, and F. Gudat Simultaneous Evaluation of T- and B-Cell Clonality, t(11;14) and t(14;18), in a Single Reaction by a Four-Color Multiplex Polymerase Chain Reaction Assay and Automated High-Resolution Fragment Analysis : A Method for the Rapid Molecular Diagnosis of Lymphoproliferative Disorders Applicable to Fresh Frozen and Formalin-Fixed, Paraffin-Embedded Tissues, Blood, and Bone Marrow Aspirates Am. J. Pathol., December 1, 2001; 159(6): 2031 - 2043. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-W. Lin, W.-H. Lee, C.-L. Chang, J.-Y. Yang, and S.-M. Hsu Restricted Killer Cell Immunoglobulin-Like Receptor Repertoire without T-Cell Receptor {gamma} Rearrangement Supports a True Natural Killer-Cell Lineage in a Subset of Sinonasal Lymphomas Am. J. Pathol., November 1, 2001; 159(5): 1671 - 1679. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. Nuovo, C. Morrison, P. Porcu, M. A. Caligiuri, and S. Suster In Situ Determination of T-cell Receptor Beta Expression Patterns J. Histochem. Cytochem., February 1, 2001; 49(2): 139 - 146. [Abstract] [Full Text] |
||||
![]() |
C. Assaf, M. Hummel, E. Dippel, S. Goerdt, H.-H. Muller, I. Anagnostopoulos, C. E. Orfanos, and H. Stein High detection rate of T-cell receptor beta chain rearrangements in T-cell lymphoproliferations by family specific polymerase chain reaction in combination with the GeneScan technique and DNA sequencing Blood, July 15, 2000; 96(2): 640 - 646. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. C. Greiner Advances in Molecular Hematopathology : T-Cell Receptor {gamma} and bcl-2 Genes Am. J. Pathol., January 1, 1999; 154(1): 7 - 9. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |