help button home button Am J Pathol International Conference on Pathology of Chest Diseases
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McIntosh, G. G.
Right arrow Articles by Milton, I. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McIntosh, G. G.
Right arrow Articles by Milton, I. D.
(American Journal of Pathology. 1999;154:77-82.)
© 1999 American Society for Investigative Pathology


Technical Advances

NCL-CD10–270: A New Monoclonal Antibody Recognizing CD10 in Paraffin-Embedded Tissue

Gary G. McIntosh* , Andrew J. Lodge{dagger} , Peter Watson{dagger} , Andrew G. Hall{ddagger} , Katrina Wood{dagger} , John J. Anderson{dagger} , Brian Angus{dagger} , Charles H. W. Horne* and Ian D. Milton*

From Novocastra Laboratories Ltd.* and Departments of Pathology{dagger} and Paediatric Oncology,{ddagger} University of Newcastle, Newcastle-upon-Tyne, United Kingdom


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CD10 (CALLA) antigen is expressed in a wide variety of epithelial and nonepithelial tissues, but its most significant application is in the diagnosis and classification of certain types of malignant lymphoma and leukemia. CD10 is expressed in a high percentage of cases of acute lymphoblastic leukemia (ALL), follicular lymphoma, Burkitt's lymphoma, and some hematopoietic tumors. Although the antigen is not lineage specific, CD10 expression is widely used to define subgroups within B-ALL and is a useful tool for detecting the presence of leukemic blasts in the bloodstream. Currently available monoclonal antibodies to CD10 have been found to be effective only in fresh-frozen tissue and for techniques such as flow cytometry. We have used a recombinant protein corresponding to the whole of CD10 to generate a monoclonal antibody that is effective in paraffin-embedded tissue sections. We have used this antibody to assay for the presence of CD10 on a range of normal and pathological tissues. Strong staining was seen in lymphoid germinal centers, renal tubules, glomeruli, syncytiotrophoblast, hepatic parenchymal canaliculi, B-lineage ALL, follicle center cell lymphoma, and a proportion of cases of large-B-cell lymphoma. We believe that this antibody will be of value in the characterization of malignant lymphoma, in particular the differential diagnosis of small-B-cell lymphoma and subtyping of lymphoblastic leukemia, as well as the investigation of the significance of expression of CD10 in other normal and pathological tissues.



    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Malignant lymphomas can generally be classified accurately on the basis of morphological features by microscopy of hematoxylin and eosin (H&E)-stained standard preparations, together with a limited range of phenotypic markers. However, difficulties are sometimes encountered, and full characterization requires supplementary studies for demonstration of characteristic antigens; assessment of CD10 expression is of value in certain situations in this context.

CD10 is a 100-kd type II cell-surface metalloproteinase known by a variety of eponyms, including enkephalinase and common acute lymphoblastic leukemia antigen (CALLA). It is a member of a family of exopeptidases that includes CD13 and CD26,1 and it functions by reducing the cellular response to peptide hormones. Identified substrates are largely neural or humoral oligopeptides agonists (reviewed in Ref. 2 ), and the enzyme functions to terminate signaling by degrading the ligand, analogous to the acetylcholine/acetylcholinesterase system.3 CD10 is thought to be expressed during the first stages of heavy chain gene rearrangement, and in an immunological context, it is thought that the enzyme modulates the enkephalin-mediated inflammatory response.4

The major expression sites of this enzyme are the brush border of enterocytes, renal tubules and glomeruli, and lymphoid precursor cells.5 However, the enzyme is not expressed on mature B and T lymphocytes. On neoplastic cells, the antigen is present in a high percentage of cases of acute lymphoblastic leukemia (ALL), follicular lymphoma, Burkitt's lymphoma, and some hematopoietic tumors and is a useful tool in detecting the presence of leukemic blasts in the bloodstream.6 Although expression of CD10 is not lineage specific, it is widely used to define subgroups within B-lineage ALL. CD10 expression on B-lineage leukemias defines the largest subgroup of ALL and typically represents a group with a good prognosis. However, the absence of CD10 defines a subgroup of ALL that is particularly resistant to treatment and therefore deserves special attention.

CD10 therefore represents a useful tool in the classification and diagnosis of malignant leukemia and lymphoma. However, currently available reagents have been shown to be effective only in fresh-frozen tissue and for techniques such as flow cytometry. In this paper, we describe the production and characterization of a new monoclonal antibody to CD10 that detects the antigen in formalin-fixed, paraffin-embedded tissue.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Production of CD10 Recombinant Protein

Total cellular RNA extracted from peripheral blood lymphocytes according to the method of Chomczynski and Sacchi7 was used as a template for reverse transcription. The reaction was primed with a specific CD10 primer (5'GGGATCCTCACCAAACCCGGCACTTCTTTT3') using a reverse transcription (RT) kit in line with manufacturer's instructions (Promega, Madison, WI). One-half the RT reaction mix was subsequently used as a template for 30 rounds of polymerase chain reaction (PCR) after the addition of a second CD10 primer (5'-GGGATCCGTGTGCAAACTATGTCAATGGG AATA-3') and appropriate adjustment of conditions. The amplification of a 1035-bp PCR product was confirmed by agarose gel electrophoresis before cloning into pUC57/T (MBI Fermentas, Vilnius, Lithuania). Clones were identified and characterized before subcloning into the expression vector pET15b (Novagen, Madison, WI). The resulting construct was transformed into Escherichia coli strain BL21, and cultures were grown to an OD550 of 0.4 before induction of protein expression by the addition of isopropyl thiogalactoside to 1 mmol/L. The CD10 fusion protein was found to be expressed in the form of insoluble inclusion bodies. These were solubilized in 8 mol/L urea in 10 mmol/L Tris/HCl, pH 8.0. The protein was refolded to a soluble form by stepwise dialysis against decreasing concentrations of urea. Final dialysis steps were against repeated changes of 10 mmol/L Tris/HCl, pH 8.0. Refolded CD10 was purified by column chromatography on His-bind resin (Novagen), and the purity of the final protein was assessed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) before immunization of female BALB/c mice.

Hybridoma Production

The recombinant protein was injected into five female BALB/c mice in a series of four injections at 14-day intervals. The first consisted of 20 µg of protein per mouse in Freund's complete adjuvant, injected subcutaneously. The second was identical but in Freund's incomplete adjuvant. The third and fourth injections were in PBS and administered intraperitoneally. Mice were boosted with 60 µg of protein intravenously 4 days before fusion.

The spleen cells were fused with NS-1/1Ag4–1 myeloma cells using polyethylene glycol and plated out into hypoxanthine-aminopterin-thymidine-selective growth medium. After 10 days, supernatants from each well were assayed by enzyme-linked immunosorbent assay (ELISA), and colonies showing reactivity were transferred to separate wells in 24-well growth plates. After an additional period of growth, colonies were again assayed by ELISA, and positive colonies were tested on paraffin-embedded small bowel sections. Colonies showing positive staining of the cytoplasmic membrane were subjected to an additional three rounds of cloning by double dilution.

Western Blotting

A sample of placenta was homogenized in Laemmli sample buffer8 before boiling for 4 minutes. Protein extracts were fractionated by SDS-PAGE on a 7.5% gel before transfer to Hybond C nitrocellulose (Amersham, Little Chalfont, UK) as described previously. After blocking, the nitrocellulose was incubated with primary antibody (1:50). After a 60-minute room temperature incubation, the blot was washed and transferred to a 1:1000 dilution of alkaline-phosphatase-conjugated rabbit anti-mouse secondary antiserum (Dakopatts, Glostrup, Denmark) for 1 hour. The blot was developed with 5-bromo-4-chloro-indolylphosphate/nitroblue tetrazolium (NBT/BCIP) until bands appeared; the reaction was stopped by immersing the blot in 10% acetic acid.

Immunohistochemistry

The antibody was tested on routinely processed paraffin-embedded tissue by an indirect avidin-biotin complex (ABC) immunohistochemical method. Briefly, sections were dewaxed and rehydrated, and endogenous peroxide activity was blocked with hydrogen peroxide/methanol. Antigen retrieval was carried out by pressure-cooker unmasking for 1 minute in citrate buffer (200 mmol/L citric acid, 500 mmol/L NaOH, pH.6.0). The tissue was then blocked with 1:20 normal rabbit serum in Tris-buffered saline (TBS; 140 mmol/L NaCl, 50 mmol/L Tris/HCl, pH.7.6) and incubated for 1 hour with primary antibody. After washing in TBS, a biotinylated rabbit anti-mouse secondary antibody was added at 1:500 (Novocastra, Newcastle, UK), and the sections were incubated for 30 minutes. Sections were again washed with TBS and then incubated with avidin-biotin at 1:100 (Novocastra). After a final wash in TBS, the sections were developed using diaminobenzidine in a TBS/hydrogen peroxide solution for 3 minutes. Finally, sections were counterstained with hematoxylin, dehydrated, and mounted in distrene dibutyl-pthalate xylene. Tissues showing membrane or cytoplasmic staining of any cells were assessed as positive. In neoplastic lymphoid tissue, no attempt was made to assess the proportion of cells showing positive labeling.

Tissues

All tissues used were routinely processed formalin-fixed, paraffin-embedded specimens retrieved from the archival files of the Pathology Department, Royal Victoria Infirmary, Newcastle-on-Tyne, UK. A wide range of normal tissues was studied as shown in Table 1 . Pathological tissues included 58 cases of childhood acute lymphoblastic leukemia, 13 cases of diffuse large-B-cell lymphoma, and 60 cases of small-B-cell lymphoma. The latter included 11 cases of follicle cell lymphoma, 23 cases of mantle cell lymphoma, 10 cases of marginal zone lymphoma, 12 cases of lymphocytic lymphoma, and 4 cases of lymphoplasmacytoid lymphoma. These cases were defined according to morphology assessed using hematoxylin-stained sections together with immunostaining for B- and T-cell markers CD5, CD23, CD43, and cyclin D1.


View this table:
[in this window]
[in a new window]
 
Table 1. Immunostaining for CD10 on a Range of Normal Tissues

 

    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Antibody Production

The recombinant protein was generated as described and used to produce an immune response in mice. After the fusion, the supernatants from each well were assayed by ELISA, and 195 colonies showed reactivity. These were transferred to fresh plates and, after an additional period of growth, were tested again by ELISA, and 70 colonies selected for testing on paraffin-embedded small bowel sections. Colonies showing positive staining of the cytoplasmic membrane were subjected to another three rounds of cloning by double dilution and assayed by Western blot.

Specificity of the antibody for CD10 was demonstrated by ELISA, Western blotting, and the labeling patterns on a panel of normal and neoplastic tissues. A single clone was isolated that showed positivity for all tests; isotyping of the supernatant revealed that the monoclonal antibody was of the IgG1 subtype. The antibody was termed NCL-CD10–270.

Antibody Characterization

Analysis by Western blot showed that the antibody labeled a protein of ~93 kd in a placental cell lysate (see Figure 1 ). This is slightly below the generally accepted 100-kd molecular mass of the protein but is within acceptable limits due to the variable post-translational modification of the 86-kd immature polypeptide.9 Analysis by immunohistochemistry revealed labeling that was principally confined to the cell membrane and cytoplasm, and antibody reactivity on a panel of normal tissues is described in Table 1 . Examples of tissues showing labeling include lymphoid germinal centers, renal tubules of glomeruli, syncytiotrophoblast, and hepatic parenchymal canaliculi.



View larger version (66K):
[in this window]
[in a new window]
 
Figure 1. Western blot for monoclonal antibody NCL-CD10–270 using a placental cell lysate. Note reactivity for CD10 at molecular weight 100,000.

 
Further characterization of the antibody was carried out on pathological tissues, including small-B-cell lymphomas, diffuse large-B-cell lymphomas, and a series of childhood acute lymphoblastic leukemias.

CD10 in Childhood Acute Lymphoblastic Leukemia

These comprised a series of cases presenting to the Royal Victoria Infirmary between 1985 and 1990, who were entered into the Medical Research Council trial UKALL X. Bone marrow aspirates from all patients were tested for CD10 status at diagnosis by either immunofluorescence of cyto-centrifuge preparations using a Coulter (J5) antibody or flow cytometry using a Becton Dickinson anti-CALLA monoclonal antibody (W8E7), which are both of proven efficacy. We have re-assessed paraffin-embedded tissue blocks of bone marrow trephines from all patients using NCL-CD10–270. The results showed a strong positive correlation using Fisher's exact test (P = 0.001; Table 2 ).


View this table:
[in this window]
[in a new window]
 
Table 2. Immunolabeling with Monoclonal Antibody NCL-CD10-270

 
CD10 in Other Pathological Tissues

Of 13 cases of large-B-cell lymphoma, 4 proved positive for CD10. In small-B-cell lymphoma, labeling for CD10 was observed in 10 of 11 cases of follicle center cell lymphoma and 2 of 23 cases of mantle cell lymphoma. Cases of lymphocytic, marginal zone, or lymphoplasmacytoid lymphoma all proved negative. These results are described in greater detail with results for other markers and molecular studies in a separate publication (submitted for publication).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The monoclonal antibody NCL-CD10–270 has been generated using a recombinant protein immunogen corresponding to the whole of the CD10 molecule. The specificity of this antibody is supported by reactivity with a molecule of the appropriate molecular weight in Western blot assays. The antibody has proven to be highly efficient for immunostaining in paraffin-embedded tissue. The predicted widespread distribution of the antigen at various sites has been observed. The strongest immunostaining was observed in renal tubules and glomeruli, brush borders of the intestine, and lymphoid germinal centers. These results are in keeping with the wide tissue distribution of CD10, which has been previously described.10-12

CD10, also known as the common acute lymphoblastic leukemia antigen (CALLA) is used in the characterization of acute lymphoblastic leukemia. CALLA positivity in ALL is associated with a better response to treatment and/or prognosis.13,14 We have carried out a comparative study in bone marrow trephines using cases previously assessed for CALLA status by flow cytometry or immunofluorescence, and an excellent correlation of results was obtained. Of the 47 cases originally diagnosed as CALLA-positive, 45 also showed labeling with NCL-CD10–270 (Table 2) . Four of nine cases that were initially diagnosed as being CD10 negative were found to be positive using NCL-CD10–270. Although this figure is unexpectedly high, some variability is to be expected as the threshold values for these methods are likely to be different, and the discrepancies may represent greater sensitivity of our technique. This antibody may therefore prove to be of significant diagnostic utility in immunophenotyping acute leukemias in bone marrow trephine biopsies. The antibody may serve as a useful addition to the limited panel of antibodies currently available,15 although these are of proven efficacy for flow cytometric or fresh-frozen tissue applications only.

In a study of CD10 expression in a series of small-B-cell lymphomas using NCL-CD10–270, we found strong staining in follicle center cell lymphoma; occasional mantle cell lymphomas demonstrated labeling, but all cases of lymphocytic, marginal zone, and lymphoplasmacytoid lymphoma were negative. These results are in accordance with known characteristic immunoprofiles of these tumors derived from previous studies using antibodies effective only in frozen tissues16 and will be discussed in greater detail in a forthcoming publication. Diagnosis of small-B-cell lymphoma is usually straightforward using H&E-stained preparations together with limited immunostaining. However, some cases present diagnostic difficulty, and the specificity for CD10 demonstrated here for certain subtypes indicates that NCL-CD10–270 may be of particular value in the differential diagnosis of these cases.

Of 13 cases of large-B-cell lymphoma assessed, 4 were shown to be CD10 positive, but the clinical and biological significance of this is unknown. It is possible that some of these CD10-positive cases may represent high-grade transformation of follicle center cell lymphomas, which would have significant therapeutic implications for these patients. Additional work is needed to address this question; to our knowledge, there have been no previous investigations with respect to the possible prognostic value of CD10 in this subgroup of lymphomas.

In conclusion, we consider that monoclonal antibody NCL-CD10–270 should prove of value in the diagnosis and characterization of malignant leukemias and lymphomas, in particular, small-B-cell lymphomas and acute lymphoblastic leukemias, and may also be useful in the investigation of CD10 expression at other sites in normal and pathological tissues.



View larger version (171K):
[in this window]
[in a new window]
 
Figure 2. Staining of normal and pathological tissues with NCL-CD10–270 using a standard ABC immunohistochemical method; magnification, x200 unless otherwise stated. A: Lymph node, reactive hyperplasia. Note strong staining of most cells in germinal centers and general absence of staining of cells in the paracortex. B: Normal human kidney. Note staining in glomerular epithelial cells and luminal aspect of ascending/descending tubules. C: Normal human small intestine. Note strong immunostaining of brush borders of enterocytes. D: Prostate gland, hyperplasia. Note intense staining of prostatic glandular epithelial cells, maximal at luminal aspect of the glands. E: Lymph node, follicular lymphoma (magnification, x40). The follicle center cells show intense labeling in contrast to near complete absence of staining of reactive cells between the follicles. F: Bone marrow, acute lymphoblastic leukemia (magnification, x400). The tumor cells show intense cytoplasmic labeling with membrane accentuation in some cells.

 

    Acknowledgements
 
We thank Helen Bell for her expert technical assistance.


    Footnotes
 
Address reprint requests to Dr. Andrew Lodge, Department of Pathology, University of Newcastle, Queen Victoria Road, Newcastle-upon-Tyne NE1 4LP, UK.

Accepted for publication September 24, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bene MC, Faure GC, : Groupe d'etude Immunologique des Leucémies: CD10 in acute leukaemias. Haematologica 1997, 82:205-210[Medline]
  2. Arber DA, Weiss LM: CD10: a review. Appl Immunohistochem 1997, 5:125-140
  3. Lu B, Gerard NP, Kolakowski LF, Jr, Finco O, Caroll MC, Gerard C: Neutral endopeptidase modulates septic shock. Ann NY Acad Sci 1996, 780:156-163[Abstract]
  4. Shipp MA, Stefano GB, Switzer SN, Griffin JD, Reinherz EL: CD10 (CALLA) neutral endopeptidase 24.11 modulates inflammatory peptide-induced changes in neutrophil morphology, migration, and adhesion proteins and is itself regulated by neutrophil activation. Blood 1991, 78:1834-1841[Abstract/Free Full Text]
  5. Lebien TW, McCormack RT: The common acute lymphoblastic leukemia antigen (CD10): emancipation from a functional enigma. Blood 1989, 73:625-635[Free Full Text]
  6. Borella L, Sen L, Casper JT: Acute lymphoblastic leukemia (ALL) antigens detected with antisera to E rosette-forming and non-E rosette-forming ALL blasts. J Immunol 1977, 118:309-315[Abstract/Free Full Text]
  7. Chomczynski P, Sacchi N: Single-step method of RNA isolation by acid guanidinium thiocyanate phenol chloroform extraction. Anal Biochem 1987, 162:156-159[Medline]
  8. Laemmli UK: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970, 227:680-685[Medline]
  9. Shipp MA, Richardson NE, Sayre PH, Brown NR, Masteller EL, Clayton LK, Ritz J, Reinherz EL: Molecular cloning of the common acute lymphoblastic leukemia antigen (CALLA) identifies a type II integral membrane protein. Proc Natl Acad Sci USA 1988, 85:4819-4823[Abstract/Free Full Text]
  10. Kalled SL, Siva N, Stein H, Reinherz EL: The distribution of CD10 (NEP 24.11, CALLA) in humans and mice is similar in non-lymphoid organs but differs within the hematopoietic system: absence on murine T and B lymphoid progenitors. Eur J Immunol 1995, 25:677-687[Medline]
  11. Sato Y, Itoh F, Hinoda Y, Ohe Y, Nakagawa N, Ueda R, Yachi A, Imai K: Expression of CD10/neutral endopeptidase in normal and malignant tissues of the human stomach and colon. J Gastroenterol 1996, 31:12-17[Medline]
  12. Sunday ME, Reyes B, Shipp MA: CD10 neutral endopeptidase-24.11 in human fetal lung: temporal and cell-specific patterns of gene expression. Clin Res 1992, 40:A305
  13. Bene MC, Faure GC, Vannier JP: Prognostic value of the CD19/CD10 phenotype in acute lymphoblastic leukaemias. J Cell Biochem 1987, S11A:226
  14. Uckun FM, Sather H, Gaynon P, Arthur D, Nachman J, Sensel M, Steinherz P, Hutchinson R, Trigg M, Reaman G: Prognostic significance of the CD10(+) CD19(+) CD34(+) B-progenitor immunophenotype in children with acute lymphoblastic leukaemia: a report from the Children's Cancer Group. Leuk Lymphoma 1997, 27:445-457[Medline]
  15. Arber DA, Jenkins KA: Paraffin section immunophenotyping of acute leukemias in bone-marrow specimens. Am J Clin Pathol 1996, 106:462-468[Medline]
  16. Harris NL, Jaffe ES, Stein H, Banks PM, Chan JKC, Cleary ML, Delsol G, Dewolf-Peeters C, Falini B, Gatter KC, Grogan TM, Isaacson PG, Knowles DM, Mason DY, Muller-Hermelink HK, Pileri SA, Piris MA, Ralfkiaer E, Warnke RA: A revised European-American classification of lymphoid neoplasms: a proposal from the International Lymphoma Study Group. Blood 1994, 84:1361-1392[Free Full Text]



This article has been cited by other articles:


Home page
Jpn J Clin OncolHome page
W.-B. Huang, X.-J. Zhou, J.-Y. Chen, L.-H. Zhang, K. Meng, H.-H. Ma, and Z.-F. Lu
CD10-positive Stromal Cells in Gastric Carcinoma: Correlation with Invasion and Metastasis
Jpn. J. Clin. Oncol., May 1, 2005; 35(5): 245 - 250.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Pan, P. M. Cardarelli, M. H. Nieder, L. B. Pickford, S. Gangwar, D. J. King, G. T. Yarranton, D. Buckman, W. Roscoe, F. Zhou, et al.
CD10 Is a Key Enzyme Involved in the Activation of Tumor-activated Peptide Prodrug CPI-0004Na and Novel Analogues: Implications for the Design of Novel Peptide Prodrugs for the Therapy of CD10+ Tumors
Cancer Res., September 1, 2003; 63(17): 5526 - 5531.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
S.-Y. Xiao, H. L. Wang, J. Hart, D. Fleming, and M. R. Beard
cDNA Arrays and Immunohistochemistry Identification of CD10/CALLA Expression in Hepatocellular Carcinoma
Am. J. Pathol., October 1, 2001; 159(4): 1415 - 1421.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McIntosh, G. G.
Right arrow Articles by Milton, I. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McIntosh, G. G.
Right arrow Articles by Milton, I. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS