| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Technical Advances |
From Novocastra Laboratories Ltd.*
and Departments of
Pathology
and Paediatric
Oncology,
University of Newcastle,
Newcastle-upon-Tyne, United Kingdom
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
CD10 is a 100-kd type II cell-surface metalloproteinase known by a variety of eponyms, including enkephalinase and common acute lymphoblastic leukemia antigen (CALLA). It is a member of a family of exopeptidases that includes CD13 and CD26,1 and it functions by reducing the cellular response to peptide hormones. Identified substrates are largely neural or humoral oligopeptides agonists (reviewed in Ref. 2 ), and the enzyme functions to terminate signaling by degrading the ligand, analogous to the acetylcholine/acetylcholinesterase system.3 CD10 is thought to be expressed during the first stages of heavy chain gene rearrangement, and in an immunological context, it is thought that the enzyme modulates the enkephalin-mediated inflammatory response.4
The major expression sites of this enzyme are the brush border of enterocytes, renal tubules and glomeruli, and lymphoid precursor cells.5 However, the enzyme is not expressed on mature B and T lymphocytes. On neoplastic cells, the antigen is present in a high percentage of cases of acute lymphoblastic leukemia (ALL), follicular lymphoma, Burkitt's lymphoma, and some hematopoietic tumors and is a useful tool in detecting the presence of leukemic blasts in the bloodstream.6 Although expression of CD10 is not lineage specific, it is widely used to define subgroups within B-lineage ALL. CD10 expression on B-lineage leukemias defines the largest subgroup of ALL and typically represents a group with a good prognosis. However, the absence of CD10 defines a subgroup of ALL that is particularly resistant to treatment and therefore deserves special attention.
CD10 therefore represents a useful tool in the classification and diagnosis of malignant leukemia and lymphoma. However, currently available reagents have been shown to be effective only in fresh-frozen tissue and for techniques such as flow cytometry. In this paper, we describe the production and characterization of a new monoclonal antibody to CD10 that detects the antigen in formalin-fixed, paraffin-embedded tissue.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Total cellular RNA extracted from peripheral blood lymphocytes according to the method of Chomczynski and Sacchi7 was used as a template for reverse transcription. The reaction was primed with a specific CD10 primer (5'GGGATCCTCACCAAACCCGGCACTTCTTTT3') using a reverse transcription (RT) kit in line with manufacturer's instructions (Promega, Madison, WI). One-half the RT reaction mix was subsequently used as a template for 30 rounds of polymerase chain reaction (PCR) after the addition of a second CD10 primer (5'-GGGATCCGTGTGCAAACTATGTCAATGGG AATA-3') and appropriate adjustment of conditions. The amplification of a 1035-bp PCR product was confirmed by agarose gel electrophoresis before cloning into pUC57/T (MBI Fermentas, Vilnius, Lithuania). Clones were identified and characterized before subcloning into the expression vector pET15b (Novagen, Madison, WI). The resulting construct was transformed into Escherichia coli strain BL21, and cultures were grown to an OD550 of 0.4 before induction of protein expression by the addition of isopropyl thiogalactoside to 1 mmol/L. The CD10 fusion protein was found to be expressed in the form of insoluble inclusion bodies. These were solubilized in 8 mol/L urea in 10 mmol/L Tris/HCl, pH 8.0. The protein was refolded to a soluble form by stepwise dialysis against decreasing concentrations of urea. Final dialysis steps were against repeated changes of 10 mmol/L Tris/HCl, pH 8.0. Refolded CD10 was purified by column chromatography on His-bind resin (Novagen), and the purity of the final protein was assessed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) before immunization of female BALB/c mice.
Hybridoma Production
The recombinant protein was injected into five female BALB/c mice in a series of four injections at 14-day intervals. The first consisted of 20 µg of protein per mouse in Freund's complete adjuvant, injected subcutaneously. The second was identical but in Freund's incomplete adjuvant. The third and fourth injections were in PBS and administered intraperitoneally. Mice were boosted with 60 µg of protein intravenously 4 days before fusion.
The spleen cells were fused with NS-1/1Ag4–1 myeloma cells using polyethylene glycol and plated out into hypoxanthine-aminopterin-thymidine-selective growth medium. After 10 days, supernatants from each well were assayed by enzyme-linked immunosorbent assay (ELISA), and colonies showing reactivity were transferred to separate wells in 24-well growth plates. After an additional period of growth, colonies were again assayed by ELISA, and positive colonies were tested on paraffin-embedded small bowel sections. Colonies showing positive staining of the cytoplasmic membrane were subjected to an additional three rounds of cloning by double dilution.
Western Blotting
A sample of placenta was homogenized in Laemmli sample buffer8 before boiling for 4 minutes. Protein extracts were fractionated by SDS-PAGE on a 7.5% gel before transfer to Hybond C nitrocellulose (Amersham, Little Chalfont, UK) as described previously. After blocking, the nitrocellulose was incubated with primary antibody (1:50). After a 60-minute room temperature incubation, the blot was washed and transferred to a 1:1000 dilution of alkaline-phosphatase-conjugated rabbit anti-mouse secondary antiserum (Dakopatts, Glostrup, Denmark) for 1 hour. The blot was developed with 5-bromo-4-chloro-indolylphosphate/nitroblue tetrazolium (NBT/BCIP) until bands appeared; the reaction was stopped by immersing the blot in 10% acetic acid.
Immunohistochemistry
The antibody was tested on routinely processed paraffin-embedded tissue by an indirect avidin-biotin complex (ABC) immunohistochemical method. Briefly, sections were dewaxed and rehydrated, and endogenous peroxide activity was blocked with hydrogen peroxide/methanol. Antigen retrieval was carried out by pressure-cooker unmasking for 1 minute in citrate buffer (200 mmol/L citric acid, 500 mmol/L NaOH, pH.6.0). The tissue was then blocked with 1:20 normal rabbit serum in Tris-buffered saline (TBS; 140 mmol/L NaCl, 50 mmol/L Tris/HCl, pH.7.6) and incubated for 1 hour with primary antibody. After washing in TBS, a biotinylated rabbit anti-mouse secondary antibody was added at 1:500 (Novocastra, Newcastle, UK), and the sections were incubated for 30 minutes. Sections were again washed with TBS and then incubated with avidin-biotin at 1:100 (Novocastra). After a final wash in TBS, the sections were developed using diaminobenzidine in a TBS/hydrogen peroxide solution for 3 minutes. Finally, sections were counterstained with hematoxylin, dehydrated, and mounted in distrene dibutyl-pthalate xylene. Tissues showing membrane or cytoplasmic staining of any cells were assessed as positive. In neoplastic lymphoid tissue, no attempt was made to assess the proportion of cells showing positive labeling.
Tissues
All tissues used were routinely processed formalin-fixed,
paraffin-embedded specimens retrieved from the archival files of the
Pathology Department, Royal Victoria Infirmary, Newcastle-on-Tyne, UK.
A wide range of normal tissues was studied as shown in Table 1
. Pathological tissues included 58 cases
of childhood acute lymphoblastic leukemia, 13 cases of diffuse
large-B-cell lymphoma, and 60 cases of small-B-cell lymphoma. The
latter included 11 cases of follicle cell lymphoma, 23 cases of mantle
cell lymphoma, 10 cases of marginal zone lymphoma, 12 cases of
lymphocytic lymphoma, and 4 cases of lymphoplasmacytoid lymphoma. These
cases were defined according to morphology assessed using
hematoxylin-stained sections together with immunostaining for B- and
T-cell markers CD5, CD23, CD43, and cyclin D1.
|
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The recombinant protein was generated as described and used to produce an immune response in mice. After the fusion, the supernatants from each well were assayed by ELISA, and 195 colonies showed reactivity. These were transferred to fresh plates and, after an additional period of growth, were tested again by ELISA, and 70 colonies selected for testing on paraffin-embedded small bowel sections. Colonies showing positive staining of the cytoplasmic membrane were subjected to another three rounds of cloning by double dilution and assayed by Western blot.
Specificity of the antibody for CD10 was demonstrated by ELISA, Western blotting, and the labeling patterns on a panel of normal and neoplastic tissues. A single clone was isolated that showed positivity for all tests; isotyping of the supernatant revealed that the monoclonal antibody was of the IgG1 subtype. The antibody was termed NCL-CD10–270.
Antibody Characterization
Analysis by Western blot showed that the antibody labeled a
protein of ~93 kd in a placental cell lysate (see Figure 1
). This is slightly
below the generally accepted 100-kd molecular mass of the protein but
is within acceptable limits due to the variable post-translational
modification of the 86-kd immature polypeptide.9
Analysis
by immunohistochemistry revealed labeling that was principally confined
to the cell membrane and cytoplasm, and antibody reactivity on a panel
of normal tissues is described in Table 1
. Examples of tissues showing
labeling include lymphoid germinal centers, renal tubules of glomeruli,
syncytiotrophoblast, and hepatic parenchymal canaliculi.
|
CD10 in Childhood Acute Lymphoblastic Leukemia
These comprised a series of cases presenting to the Royal Victoria
Infirmary between 1985 and 1990, who were entered into the Medical
Research Council trial UKALL X. Bone marrow aspirates from all patients
were tested for CD10 status at diagnosis by either immunofluorescence
of cyto-centrifuge preparations using a Coulter (J5) antibody or flow
cytometry using a Becton Dickinson anti-CALLA monoclonal antibody
(W8E7), which are both of proven efficacy. We have re-assessed
paraffin-embedded tissue blocks of bone marrow trephines from all
patients using NCL-CD10–270. The results showed a strong positive
correlation using Fisher's exact test (P =
0.001; Table 2
).
|
Of 13 cases of large-B-cell lymphoma, 4 proved positive for CD10. In small-B-cell lymphoma, labeling for CD10 was observed in 10 of 11 cases of follicle center cell lymphoma and 2 of 23 cases of mantle cell lymphoma. Cases of lymphocytic, marginal zone, or lymphoplasmacytoid lymphoma all proved negative. These results are described in greater detail with results for other markers and molecular studies in a separate publication (submitted for publication).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
CD10, also known as the common acute lymphoblastic leukemia antigen
(CALLA) is used in the characterization of acute lymphoblastic
leukemia. CALLA positivity in ALL is associated with a better response
to treatment and/or prognosis.13,14
We have carried out a
comparative study in bone marrow trephines using cases previously
assessed for CALLA status by flow cytometry or immunofluorescence, and
an excellent correlation of results was obtained. Of the 47 cases
originally diagnosed as CALLA-positive, 45 also showed labeling
with NCL-CD10–270 (Table 2)
. Four of nine cases that were initially
diagnosed as being CD10 negative were found to be positive using
NCL-CD10–270. Although this figure is unexpectedly high, some
variability is to be expected as the threshold values for these methods
are likely to be different, and the discrepancies may represent greater
sensitivity of our technique. This antibody may therefore prove to be
of significant diagnostic utility in immunophenotyping acute leukemias
in bone marrow trephine biopsies. The antibody may serve as a useful
addition to the limited panel of antibodies currently
available,15
although these are of proven efficacy for flow
cytometric or fresh-frozen tissue applications only.
In a study of CD10 expression in a series of small-B-cell lymphomas using NCL-CD10–270, we found strong staining in follicle center cell lymphoma; occasional mantle cell lymphomas demonstrated labeling, but all cases of lymphocytic, marginal zone, and lymphoplasmacytoid lymphoma were negative. These results are in accordance with known characteristic immunoprofiles of these tumors derived from previous studies using antibodies effective only in frozen tissues16 and will be discussed in greater detail in a forthcoming publication. Diagnosis of small-B-cell lymphoma is usually straightforward using H&E-stained preparations together with limited immunostaining. However, some cases present diagnostic difficulty, and the specificity for CD10 demonstrated here for certain subtypes indicates that NCL-CD10–270 may be of particular value in the differential diagnosis of these cases.
Of 13 cases of large-B-cell lymphoma assessed, 4 were shown to be CD10 positive, but the clinical and biological significance of this is unknown. It is possible that some of these CD10-positive cases may represent high-grade transformation of follicle center cell lymphomas, which would have significant therapeutic implications for these patients. Additional work is needed to address this question; to our knowledge, there have been no previous investigations with respect to the possible prognostic value of CD10 in this subgroup of lymphomas.
In conclusion, we consider that monoclonal antibody NCL-CD10–270 should prove of value in the diagnosis and characterization of malignant leukemias and lymphomas, in particular, small-B-cell lymphomas and acute lymphoblastic leukemias, and may also be useful in the investigation of CD10 expression at other sites in normal and pathological tissues.
|
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Accepted for publication September 24, 1998.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  W.-B. Huang, X.-J. Zhou, J.-Y. Chen, L.-H. Zhang, K. Meng, H.-H. Ma, and Z.-F. Lu CD10-positive Stromal Cells in Gastric Carcinoma: Correlation with Invasion and Metastasis Jpn. J. Clin. Oncol., May 1, 2005; 35(5): 245 - 250. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Pan, P. M. Cardarelli, M. H. Nieder, L. B. Pickford, S. Gangwar, D. J. King, G. T. Yarranton, D. Buckman, W. Roscoe, F. Zhou, et al. CD10 Is a Key Enzyme Involved in the Activation of Tumor-activated Peptide Prodrug CPI-0004Na and Novel Analogues: Implications for the Design of Novel Peptide Prodrugs for the Therapy of CD10+ Tumors Cancer Res., September 1, 2003; 63(17): 5526 - 5531. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.-Y. Xiao, H. L. Wang, J. Hart, D. Fleming, and M. R. Beard cDNA Arrays and Immunohistochemistry Identification of CD10/CALLA Expression in Hepatocellular Carcinoma Am. J. Pathol., October 1, 2001; 159(4): 1415 - 1421. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
