| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Regular Articles |
From the Departments of Molecular Biology*
and
Immunology,
The Scripps Research Institute, La
Jolla, California
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Several possible mechanisms are thought to contribute collectively to the high threshold for the activation and infiltration of T cells into the CNS parenchyma. First, the presence of a BBB coupled with the absence of draining lymphatics reduces the number of immune cells and the rate at which immune cells interact with the CNS as compared with other tissues.1,2,4 Second, major histocompatibility (MHC) class I and MHC class II proteins are expressed at very low levels in the CNS parenchyma as compared with other tissues.2,4,5,11-13 As a consequence, under normal, nonpathological circumstances, the CNS lacks a resident cell population that is equipped to present antigen to T cells.11,13,14 By contrast, macrophages in the perivascular spaces, meninges, and choroid plexus do express MHC class I and II proteins and thus may be able to act as antigen-presenting cells (APCs).2,11-13 Hence, allografts can be rejected and T-cell responses can be initiated in these latter regions.2,3,11,13 Third, the CNS environment may inhibit T-cell activation directly. Ceramides, transforming growth factor (TGF)-ß1 production, and antigen-specific interactions between T cells and either astrocytes or microglia have all been suggested to suppress T-cell activation or even to induce T-cell apoptosis in the CNS.15-19 Thus, although antigen-specific responses may be generated in the perivascular spaces, meninges, ventricles, or even within allografts that contain their own resident APCs, T-cell responses may have difficulty spreading into the CNS parenchyma.
In vivo, the relative contributions of these factors have been difficult to ascertain because it is rarely possible to manipulate the parameters individually without global activation of the peripheral immune system or gross changes in CNS physiology. It is unclear whether the development of spontaneous CNS pathologies such as multiple sclerosis are due more to the failures of the CNS to limit immune responses or to the overactivation of leukocytes outside the CNS. Studies of early cases of multiple sclerosis favor the former possibility because the initial demyelinating lesions are composed primarily of activated microglia/macrophages and not lymphocytes.4,5,9 Lymphocyte accumulation appears fairly restricted to perivascular cuffs in the early stages of disease.
Similarly, it is unclear whether the higher failure rate of xenografts as compared with allografts is primarily T cell mediated. Suggestively, allografts in the CNS fail with an increasing rate correlating with increasing antigenic differences between donor and host.1,2 However, in most types of CNS graft failure, very few lymphocytes are found; rather, activated microglia/macrophages appear to mediate most of the graft damage. It is unclear whether the few lymphocytes recruited are sufficient to direct the microglia/macrophage-inflicted damage or whether their contribution to graft failure is of low significance.2,8,20
Here, we have tested whether CNS immune privilege results primarily from the absence of an effective resident APC population by injecting bone-marrow-derived dendritic cells directly into the CNS. These dendritic cells are 100- to 1000-fold more potent APCs than macrophages.12 In contrast to the CNS, most tissues have similar resident populations of tissue dendritic cells that can efficiently process and present antigen and that frequently recirculate to the lymph nodes.12,13 Many of the myelin and neural antigens usually used as T-cell targets in EAE are also expressed at very high levels in the thymus and spleen where their presence has been suggested to regulate ongoing T-cell responses.21-26 Consequently, to study CNS-specific modulation of immune responses independent of CNS epitopes, we used two types of stimuli that have been well characterized in both in vitro assays and peripheral tissue immune responses: 1) allogeneic stimuli in which fewer than 5% to 10% of the T-cell population are potential responders and 2) the moth cytochrome C peptide, in a transgenic mouse model in which greater than 90% of the T cells are potential responders. We found that, whereas potent APCs expressed numerous T-cell chemokines, T cells accumulated in the CNS only in an antigen-specific manner. The antigenic stimuli used were not myelin related and should have triggered primarily CD4+ T cell responses. Surprisingly, although leukocyte recruitment occurred predominantly in the ventricles, meninges, subarachnoid spaces, and the injection site, parenchymal leukocyte infiltration occurred almost exclusively in white matter tracts and consisted of equal numbers of CD4+ and CD8+ cells.
| Materials and Methods |
|---|
|
|
|---|
Dendritic-cell cultures were prepared from C57Bl/6, B10.(A)5R, B10.D2, and 107KO mouse strains and injected into C57Bl/6, 107KO, or ANDB6 mice. The AND transgenic mice express a transgenic TCR specific for moth cytochrome c peptide 88102 presented on class II I-Eb.27 The mice are maintained on a C57Bl/6 background; therefore, the TCR-transgenic T cells are positively selected on I-Ab even in the absence of the restricting element I-Eb. Thus, these mice contain clonotype-positive CD4+ T cells (>90% of all T cells) but do not contain APCs that can stimulate antigen-specific responses. Dendritic cells prepared from either the B10.(A)5R and 107KO mouse strains express I-Eb and can act as APCs to transgenic AND T cells.28 The 107KO mouse line is maintained on a C57Bl/6 background and does not express any MHC class II other than I-Eb.14,28
Dendritic Cell Isolation
Dendritic cells were isolated from bone marrow cultures essentially as described.12 Briefly, marrow from femur bones was eluted in RPMI 1640. Cells were recovered by centrifugation and cultured at 1 mouse equivalent per 150-mm plate in RPMI 1640 plus 10% fetal bovine serum (FBS), 25 mmol/L Hepes, 1 mmol/L glutamine, 50 µmol/L 2-mercaptoethanol, 50 U/ml granulocyte/macrophage colony-stimulating factor (GM-CSF), and 100 U/ml interleukin (IL)-4. After 2 days, non-adherent cells were transferred into a new 150-mm plate. Five days after the initiation of the bone marrow cultures, the cells were placed in AIM V media (Gibco/BRL, Gaithersburg, MD), and 48 hours later, dendritic cells were isolated from the non-adherent population in both 150-mm plates by flow cytometric sorting. Dendritic cells were identified by size, side scatter, and high B7.2 expression using fluorescein isothiocyanate (FITC)-conjugated antibodies against B7.2 (Pharmingen, San Diego, CA) and using a FACS Vantage or FACStar Plus with CellQuest acquisition software (Becton Dickinson, Mountain View, CA). FACs analysis demonstrated that these sorted dendritic cell preparations consisted of greater than 95% N418/CD11c+ and NLDC145/Dec 205+ cells.
Intrathecal Injections
After isolation, dendritic cells were allowed to recover for 20 minutes at 37°C in RPMI plus 2% FBS, 25 mmol/L Hepes, 50 µmol/L 2-mercaptoethanol in the presence or absence of 2 µg/ml moth cytochrome c peptide 88102. Cells were washed and resuspended at approximately 2000 to 5000 cells per µl in the same media plus or minus peptide. Approximately 10 µl were injected intrathecally using a 26-gauge needle into metophane-anesthetized mice.
Fluorescent Cell Labeling
Dendritic cells were incubated in RPMI plus 10% FBS and 25 µmol/L Cell Tracker Green (Molecular Probes, Eugene, OR) at 37°C for 20 minutes. As the dye must be cleaved intracellularly to become fluorescent, only viable cells are labeled. By this measure, greater than 90% of the sorted dendritic cells were viable.
Microglia Isolation from Mixed Glial Cultures
Mixed glial cultures were prepared as previously described.29 Briefly, CNS from newborn mice were stripped of meninges, mechanically dissociated, seeded into T-75 flasks, and maintained in OM5 media with 10% FBS. After 2 to 4 weeks, cultures were trypsinized and incubated in RPMI (10% FBS, without phenol red) in suspension for 60 minutes at 37°C to allow for the re-expression of trypsinized surface markers. Microglia were then purified by flow cytometry using phycoerythrin (PE)-conjugated antibodies against FcR/CD16/CD32 (Pharmingen) as previously described.14 An extensive characterization of the antigenic phenotype and APC potential of microglia prepared by this method has been previously described.14 The cells were suspended in RPMI plus 2% FBS, 25 mmol/L Hepes, 50 µmol/L 2-mercaptoethanol at approximately 2000 to 5000 cells per µl before intrathecal injection.
Preparation of Brain Cell Suspensions
The brains were removed from halothane-euthanized mice, the meninges were rapidly removed, and the brain tissue was mechanically dissociated into a single-cell suspension in PBS plus 10% serum. The cell suspension was washed twice to remove small debris and was suspended in RPMI plus 2% FBS, 25 mmol/L Hepes, 50 µmol/L 2-mercaptoethanol at approximately 2000 to 5000 cells per µl before intrathecal injection.
Immunohistochemistry
Mice were sacrificed by halothane inhalation. The brains were rapidly removed and snap-frozen in OCT (Miles Laboratories, Elkhart, IN). Cryostat sections (25 µm) were post-fixed in ice-cold 4.5% paraformaldehyde for 1 minute and then blocked in serial incubations with avidin, biotin, 5% goat serum, and 0.01% Triton X-100. Sections were incubated with primary antibodies overnight at 4°C, followed by incubations with secondary biotin-conjugated antibodies and tertiary streptavidin-horseradish peroxidase-conjugated antibodies. Immunoreactivity was visualized by using 3-amino-9-ethyl carbazole as the chromogen. For GFAP immunoreactivity, CNS tissue was prepared from mice that were perfused through the heart with saline followed by 4.5% paraformaldehyde. Brains were removed and post-fixed overnight in 4.5% paraformaldehyde at 4°C before cryosectioning. Sections were processed as described above.
Reverse Transcription Polymerase Chain Reaction
RNA was isolated from cells as previously described,30
and cDNA was prepared using the Pharmacia first-strand kit according to
the manufacturer's directions. Polymerase chain reactions (PCRs) were
performed in a Perkin Elmer 9600, with a denaturing temperature of
94°C (15 seconds), annealing temperature of 58°C (15 seconds), and
extension temperature of 72°C (30 seconds) repeated for 35 cycles.
All reactions were hot started by adding primers during an initial
denaturation step (4 minutes at 94°C) that preceded the
cycle program. Primers for each of the chemokines were as follows:
lymphotactin (CATGGGTTGTGGAAGGTG and
GCTGTGCTGGTGGACCTC), RANTES (GCTGCCCTCACCATCATCCTC
and ACTTCTTCTCTGGGTTGGCAC), MIP-1
(AGGTCTCCACCACTGCCCTTG and
TCAGGCATTCAGTTCCAGGTCAGT),MIP-1ß (CTCTGCGTGTCTGCCCTCTCTCTC
and CTGTCTGCCTCTTTTGGTCAGGAAT), and C10
(GCAACAGAGACAAAAGAAGT and GGAAGACCAAAGAAAGTAGC). As a control for
nonspecific amplification and to ensure that only in the presence of
both primers would a PCR product of the correct size be generated, each
of the primers was used separately in PCR reactions. To test for
genomic DNA contamination, the RNA sample used to generate the cDNA was
also used as a PCR template.
| Results |
|---|
|
|
|---|
To test whether the mere presence of an APC was detrimental to CNS
function and sufficient to initiate a T-cell-mediated immune response
in the CNS, we prepared dendritic cells from murine bone marrow
cultures. Dendritic cells are efficient and potent APCs.12
Although activated B cells and macrophages can act as APCs, dendritic
cells are approximately 100-fold more capable of stimulating naive T
cells in an antigen-specific manner.12,31,32
Dendritic
cells prepared from bone marrow cultures were non-adherent with
multiple processes characteristic of a mature dendritic cell (Figure 1B)
. MHC class II immunoreactivity was
observed on the cell surface and throughout the dendritic cell
processes (Figure 1B)
and was not localized only to the cytoplasm of
the cell body as seen in immature dendritic cells. Flow cytometric
analysis of the isolated dendritic cells demonstrated that more than
95% of the isolated cells expressed high levels of the molecular
components required to present antigen, namely, MHC class II and
co-stimulatory molecules B7.1, B7.2, and CD40 (Figure 1A)
. Reverse
transcription PCR analysis of RNA prepared from these dendritic
cells demonstrated that they expressed mRNAs for numerous chemokines
capable of recruiting T lymphocytes, including lymphotactin, RANTES,
MIP-1
, MIP-1ß, and C10 (Figure 1C)
, and thus were capable of
inducing T-cell extravasation. Although dendritic cells prepared by
this method expressed F4/80 (Figure 1A)
, more than 95% of the isolated
cells were positive for NLDC145/Dec 205 and N418/CD11c (Figure 1A)
.
|
One of the hallmark characteristics of mature dendritic cells is
their ability to migrate from the site of antigen to the T-dependent
regions of lymphoid organs. Therefore, we tested whether dendritic
cells injected either subcutaneously in the ear or into the CNS would
home to the cervical lymph nodes. For definitive identification,
dendritic cells were labeled with an intracellular, fluorescent dye,
Cell Tracker Green, just before injection. In both types of injections
(either into the ear or the CNS), labeled dendritic cells could be
found in cryosections of cervical lymph nodes from mice sacrificed 48
hours after injection (Table 1)
. In each
case, labeled cells were found only in the T-dependent and not the
B-dependent regions of the cervical lymph nodes. At 48 hours after
injection, fluorescently labeled cells could be detected in
cryosections of the injected tissue only in those mice injected in the
CNS and not in the ear. Labeled dendritic cells were found throughout
the CNS, but in a regionally restricted pattern. Fluorescently labeled
cells were found in the meninges and subarachnoid spaces and along the
length of the white matter tracts, including the optic chiasm,
striatum, corpus collosum, and fimbria. Labeled cells were rarely found
in the gray matter regions of the brain and then only in regions
that appeared damaged by the injection process.
|
Two different paradigms of antigenic stimulation, alloreactivity and peptide-specific interactions with a transgenic TCR, were used to characterize the ability of the CNS environment to modulate two qualitatively different T-cell responses. Alloreactivity involves high-ligand-density, low-receptor-affinity interactions of various T-cell receptors specific for the foreign MHC molecules on the APC.33,34 Alloreactive responses can involve both CD4+ and CD8+ T-cell populations if the APC and T cells differ in both MHC class I and II alleles, or only the CD4+ T-cell population if the differences are limited to MHC class II.34 In contrast, the peptide-specific interactions with a MHC-class-II-restricted transgenic TCR involves high-receptor-affinity interactions with the CD4+ T cell population.27 The transgenic TCR used here is specific for moth cytochrome c presented by I-Eb; however, the TCR transgene is maintained on a C57BL/6 backcross that is I-Eb negative.27,28 Consequently, none of the cells in the transgenic mice, including microglia, macrophages, and astrocytes, can act as APCs. The sizes of the potential responder populations also differ between the two types of stimuli; in alloreactive models, fewer than 5% to 10% of the T-cell population are potential responders, as opposed to greater than 90% of the T-cell population in the transgenic TCR model.
Injection of C57Bl/6 dendritic cells into the CNS of syngeneic C57Bl/6
mice induced astrogliosis and microgliosis as judged by respective
increases in GFAP and F4/80 immunoreactivity in the regions surrounding
the injection site relative to more distal regions (Figure 2, B and D)
. Minimal neutrophil
infiltration (GR-1+ cells) was observed near the injection
site and meninges (Figure 2A)
. Although mechanical destruction of both
neuronal and glial cells was caused by the injection process, the
syngeneic dendritic cells failed to initiate a CNS-directed T-cell
response. Only an occasional T cell (CD3+ cell) could be
found in the injection site or the meninges (Figure 2C)
. B cells
(B220+ cells) were not detected (data not shown).
|
|
|
Priming Mice with Allogeneic Cells Decreases the Requirement for a Potent APC
Although dendritic cells are highly potent APCs, many other cell types can act as partial or inefficient APCs. For example, microglia from mixed glial cultures express the molecular machinery to present antigen but are relatively weak APCs as tested in T-cell proliferation assays.14 Although these microglia are weak stimulators of T-cell proliferation, they display an activated phenotype that resembles microglia isolated from mice with severe demyelination induced by the overexpression of IL-3 in the CNS.35 Therefore, we injected into the CNS of allogeneic 107KO mice three types of weak APCs prepared from C57Bl/6 mice (microglia from mixed glial cultures, 3T3 fibroblasts, or whole-brain cell suspensions) in the same concentrations and sites as had been done with the dendritic cells. The site near the injection was examined by immunohistochemistry for evidence of gliosis and leukocyte accumulation. As with the injection of syngeneic dendritic cells, only an occasional T or B cell could be detected by immunohistochemistry. Increases in GFAP, F4/80, and GR-1 immunoreactivity on both ameboid and stellate-shaped cells surrounding the injection site were indicative of astrogliosis, microgliosis, and neutrophil recruitment, respectively (data not shown).
As weak APCs could not recruit naive T cells into the CNS, we asked
whether they could recruit T cells from mice that had been primed with
antigen at peripheral sites. For this experiment, 107KO mice were
primed by subcutaneous injections of 2 x 107
C57Bl/6
spleen cells 2 weeks before intrathecal injections. As in previous
experiments, CNS cryosections prepared from mice sacrificed 48 hours
after intrathecal injections were examined for cells immunoreactive for
the B cell marker B220 and the T cell markers CD4 and CD8. After
priming, all three types of weak APCs, including C57Bl/6 brain cell
suspensions, triggered the accumulation of cells immunoreactive for
CD4, CD8 (Figure 4, A, C, and D)
and B220
(Figure 4B)
in the CNS. B and T cell accumulation was not limited to
nonparenchymal CNS sites but extended into the white matter tracts. In
sections from primed 107KO mice injected with potent APCs (C57Bl/6
dendritic cells), greater numbers of cells immunoreactive for CD4
(Figure 5, A and C)
and CD8 (Figure 5, B and D)
were found in the CNS white matter than had been found in
similarly treated unprimed mice. T and B cell accumulation in white
matter did not appear diminished over 200 µm distant from the
injection site.
|
|
CD8+ T Cells Were Recruited Disproportionately
Antigen-specific effects should be mediated by CD4+ T
cells in both the transgenic TCR model and the allogeneic model in
which the dendritic cells differ from the CNS only in MHC class II
haplotype. Surprisingly, immunohistological characterization of the
recruited and infiltrating T cells revealed that the T-cell population
consisted of roughly equivalent numbers of CD4+ and
CD8+ cells (Figures 3, E and F
; 4, C and D; and 5, AD).
Leaky expression of the MHC-class-II-restricted TCR transgene in
CD8+ cells is insufficient to account for their large-scale
antigen-specific recruitment into the TCR-transgenic CNS. Flow
cytometric analysis of the TCR-transgenic mice indicated that
CD4+ cells outnumbered CD8+ cells by at least
58:1 in peripheral blood, spleen, and lymph node (Table 2)
. Flow cytometric analysis also
indicated that up to 66% of the CD8+ cells expressed
the transgenic TCR. Hence, the predicted ratio of CD8:CD4 cells
appearing in the CNS infiltrates would be lower than 1:80 if recruited
by direct antigen-TCR interactions and lower than 1:50 if
recruited secondarily by antigen-specific CD4 interactions. It is
unlikely that the disproportionate detection of CD8+ cells
is due merely to better histological detection of CD8+ T
cells in immunohistochemical as compared with flow cytometric analysis
because similar CD4:CD8 ratios were detected in lymph node and spleen
taken from unmanipulated ANDB6 mice whether analyzed by
immunohistochemistry or by flow cytometry. Thus, the observed
approximate 1:1 ratio of CD4+:CD8+ cells in
both the TCR-transgenic model and the allogeneic model involving only
MHC class II indicates that CD8+ T cells are preferentially
and nonspecifically recruited.
|
Activated T and B cells can be distinguished histologically from
naive cells by their intense labeling with antibodies against the IL-2
receptor (CD25) and the late activation marker VLA-4.4,7
We
examined the T and B cells found within the white matter, meninges,
ventricles, or injection site with antibodies against CD25, VLA-4,
LFA-1, and CD62L (Mel 14, the leukocyte homing receptor). Although
CD62L immunoreactivity was readily detected in lymph node sections, we
failed to detect CD62L immunoreactivity in CNS sections from either the
TCR-transgenic or alloreactive models (data not shown). However, we
could detect LFA-1 (a T-cell integrin; data not shown). The absence of
CD62L immunoreactivity coupled with LFA-1 expression was consistent
with the extravasation of T and B cells from the bloodstream. Fewer
than 10% of these T and B cells were labeled by antibodies directed
against CD25 or VLA-4 (Figure 6)
.
Positive cells were not scattered stochastically throughout the
infiltrating population. Rather, cells positive for VLA-4 and CD25 were
found primarily in the ventricles, injection sites, and perivascular
regions whereas T cells found within the CNS parenchyma white matter
rarely expressed VLA-4 or CD25 (Figure 6
and data not shown). These
data suggest that healthy CNS parenchyma may be able to down-regulate
T-cell activation markers.
T- and B-cell infiltration was associated with macrophage infiltration
and microglial activation as judged by increased F4/80, MHC class II,
and CD45 immunoreactivity in the white matter tracts and the areas
surrounding the injection sites in the TCR-transgenic model (Figure 7)
and the alloreactive model (Figure 5E)
. Ameboid cells that labeled intensely for CD45 were presumed to be
of peripheral origin, whereas stellate cells that labeled weakly for
CD45 were presumed to be resident microglia, based on previous
measurements on F4/80+ cells isolated from noninjected
mice.13,14,18
Under normal conditions, CD45 expression by
microglia is too low to be detected by immunohistochemistry. On
activation, microglial CD45 levels increase but remain much lower than
the levels found on peripheral immune cells. Microglia in the
surrounding gray matter regions appeared normal, although occasional
clusters of MHC-class-II-positive cells with stellate morphology were
found in the cerebral cortex (Figure 5F)
.
|
| Discussion |
|---|
|
|
|---|
Unexpectedly, we found that efficient APCs, capable of recruiting and activating naive T cells, were insufficient to initiate a T-cell-mediated response in the CNS of syngeneic mice. The injection of dendritic cells into the CNS caused tissue damage, yet the dendritic cells apparently could not present CNS antigens from the damaged tissue. Although this could be due to peculiarities of CNS antigens or the frequency of CNS-specific T cells, more probably it was a consequence of the maturation state of the dendritic cells used in our studies. As dendritic cells mature and become more potent APCs, they lose the ability to process antigen, relying on phagocytosing macrophage for that function.12 Consistent with this interpretation, the dendritic cells used in our studies displayed a mature phenotype and were capable of correctly homing to the T-dependent regions of the cervical lymph nodes whether they had been injected into the CNS or the ear. However, we did find that dendritic cells could recruit large numbers of leukocytes into the CNS when presenting allogeneic or peptide stimuli.
We do not address here how the injected dendritic cells can induce the antigen-specific accumulation of T cells into the CNS. It is possible that they merely trap the T cells that routinely enter the CNS under nonpathological conditions. It is also possible that dendritic cell chemokine expression serves to induce T-cell extravasation and subsequent CNS infiltration. Alternatively, the migration of injected dendritic cells to the T-dependent area of the cervical lymph nodes may serve to inform and activate lymph node T cells to migrate in search of the presented antigen (either allogeneic or peptide).
These studies revealed three other unexpected findings. First,
dendritic-cell migration and leukocyte recruitment into the CNS was
anatomically restricted to the meninges, subarachnoid spaces,
ventricles, and white matter of the CNS. Second, CD8+ T
cells were recruited into the CNS in numbers vastly disproportionate to
their numbers in peripheral blood, spleen, or lymph node. In the
TCR-transgenic model, some of these CD8+ T cells could have
been recruited via direct peptide-TCR interaction on the
CD8+ T cells; however, their recruitment in the allogeneic
model in which the allogeneic differences were solely in MHC class II,
recruitment should only be secondary to the antigen-specific
interactions with CD4+ T cells.27,34
Third,
although numerous T and B cells were recruited to the CNS in an
antigen-specific manner by a potent APC, very few of the cells
expressed the activation markers CD25 (IL-2 receptor) or VLA4, even in
mice previously primed with antigen. Consistent with this unactivated
T-cell phenotype, luxol fast blue staining of myelin, animal
appearance, and behavior appeared to be unaffected by the robust T-cell
recruitment. By contrast, mice injected in the CNS with
lipopolysaccharide/interferon-
or activated T cells rapidly show
signs of illness, developing a hunched posture, failing to groom
properly, and becoming less motile.36
The mechanism by which CD8+ T cells preferentially accumulated within the CNS is unclear, but the CNS itself must play a role shaping this response because initiation of CD4+ T-cell responses does not lead to a disproportionate accumulation of CD8+ T cells in other tissues.37,38 For example, in our studies, a preferential accumulation of CD8+ T cells was not observed when allogeneic dendritic cells were injected in the ear. Similarly, CD8+ T cells accumulate only in relatively small numbers as compared with CD4+ T cells during the initiation and progression of diabetes in a MHC-class-II-restricted TCR-transgenic model.38 At present, only IL-15 has been identified as a chemokine that may preferentially attract and activate CD8+ T cells as compared with CD4+ T cells.39 A preliminary comparison between CNS injected with dendritic cells plus antigen or CNS injected with dendritic cells in the absence of antigen failed to show any differences in IL-15 expression (unpublished observations).
Cumulatively, these data suggest that the spontaneous development of myelin-directed diseases such as multiple sclerosis need not be triggered by myelin-specific antigens. Rather, an initial myelin-restricted pattern of inflammation could result simply from the preferential leukocyte (both APC and responder cell) migration through white matter regions as opposed to gray matter regions. For example, if infiltrating APCs happen to initiate antigen-specific immune responses that are not directed against myelin or CNS antigens while in these areas, myelin-specific responses could result from determinant spreading.40 Such a phenomenon is observed in Theiler's virus infection of CNS oligodendrocytes.41 Although the initial immune response is directed solely against viral antigens, myelin-directed T-cell responses begin to emerge during the later stages of disease progression. In addition, our data indicate that significant CD8+ T-cell recruitment is not necessarily indicative of MHC-class-I-restricted stimuli such as is associated with viral antigens or molecular mimicry.4,7,34 Thus, it is possible that CD8 recruitment in diseases such as multiple sclerosis can be nonspecific and secondary to a MHC-class-II-restricted stimulus.
Although the functional significance of this disproportionate CD8+ T cell accumulation is unknown, several studies have suggested that CD8+ T cells can play a protective role in CNS pathology. For example, the frequency and severity of relapses in EAE is much higher in CD8 knockout mice as compared with wild-type mice.42 Conversely, studies by Weiner and colleagues have suggested that CD8+ T cells can acquire the ability to suppress CD4+ T cell responses in both rodent and human CNS demyelinating disease.43,44 In addition, these authors also found that CD8+ T cells from patients with chronic progressive multiple sclerosis were deficient in this immunosuppressive activity as compared with CD8+ T cells from patients with relapsing-remitting multiple sclerosis or from normal individuals.44
Finally, these data suggest that the absence of a resident population of APCs does play a protective role in the CNS but that additional mechanisms exist that shape the immune response and that set a high threshold for lymphocyte activation. It is not only inappropriate activation of the immune system in the periphery that can lead to neuropathology but also malfunctions of these protective CNS mechanisms.
| Acknowledgements |
|---|
| Footnotes |
|---|
Supported by NIH grants MH47680 (J.G. Sutcliffe) and AI31583 and AI38375 (D. Lo).
Accepted for publication November 5, 1998.
| References |
|---|
|
|
|---|
-amylase genes. J Mol Biol 1980, 142:93-116[Medline]
and is defective in chronic progressive multiple sclerosis. J Clin Invest 1995, 95:2711-2719
This article has been cited by other articles:
![]() |
A. L. Zozulya, S. Ortler, J. Lee, C. Weidenfeller, M. Sandor, H. Wiendl, and Z. Fabry Intracerebral Dendritic Cells Critically Modulate Encephalitogenic versus Regulatory Immune Responses in the CNS J. Neurosci., January 7, 2009; 29(1): 140 - 152. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. C. Furtado, M. C. G. Marcondes, J.-A. Latkowski, J. Tsai, A. Wensky, and J. J. Lafaille Swift Entry of Myelin-Specific T Lymphocytes into the Central Nervous System in Spontaneous Autoimmune Encephalomyelitis J. Immunol., October 1, 2008; 181(7): 4648 - 4655. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Walter and M. L. Albert Cutting Edge: Cross-Presented Intracranial Antigen Primes CD8+ T Cells J. Immunol., May 15, 2007; 178(10): 6038 - 6042. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Goldmann, E. Kwidzinski, C. Brandt, J. Mahlo, D. Richter, and I. Bechmann T cells traffic from brain to cervical lymph nodes via the cribroid plate and the nasal mucosa J. Leukoc. Biol., October 1, 2006; 80(4): 797 - 801. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Barcia, C. E. Thomas, J. F. Curtin, G. D. King, K. Wawrowsky, M. Candolfi, W.-D. Xiong, C. Liu, K. Kroeger, O. Boyer, et al. In vivo mature immunological synapses forming SMACs mediate clearance of virally infected astrocytes from the brain J. Exp. Med., September 4, 2006; 203(9): 2095 - 2107. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Brisebois, S. P. Zehntner, J. Estrada, T. Owens, and S. Fournier A Pathogenic Role for CD8+ T Cells in a Spontaneous Model of Demyelinating Disease J. Immunol., August 15, 2006; 177(4): 2403 - 2411. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Curtin, G. D. King, C. Barcia, C. Liu, F. X. Hubert, C. Guillonneau, R. Josien, I. Anegon, P. R. Lowenstein, and M. G. Castro Fms-Like Tyrosine Kinase 3 Ligand Recruits Plasmacytoid Dendritic Cells to the Brain J. Immunol., March 15, 2006; 176(6): 3566 - 3577. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Hatterer, N. Davoust, M. Didier-Bazes, C. Vuaillat, C. Malcus, M.-F. Belin, and S. Nataf How to drain without lymphatics? Dendritic cells migrate from the cerebrospinal fluid to the B-cell follicles of cervical lymph nodes Blood, January 15, 2006; 107(2): 806 - 812. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Friese and L. Fugger Autoreactive CD8+ T cells in multiple sclerosis: a new target for therapy? Brain, August 1, 2005; 128(8): 1747 - 1763. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bradl, J. Bauer, A. Flugel, H. Wekerle, and H. Lassmann Complementary Contribution of CD4 and CD8 T Lymphocytes to T-Cell Infiltration of the Intact and the Degenerative Spinal Cord Am. J. Pathol., May 1, 2005; 166(5): 1441 - 1450. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Grois, D. Prayer, H. Prosch, H. Lassmann, and the CNS LCH Co-operative Group Neuropathology of CNS disease in Langerhans cell histiocytosis Brain, April 1, 2005; 128(4): 829 - 838. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Karman, C. Ling, M. Sandor, and Z. Fabry Initiation of Immune Responses in Brain Is Promoted by Local Dendritic Cells J. Immunol., August 15, 2004; 173(4): 2353 - 2361. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. G. Stevenson, J. M. Austyn, and S. Hawke Uncoupling of virus-induced inflammation and anti-viral immunity in the brain parenchyma J. Gen. Virol., June 1, 2002; 83(7): 1735 - 1743. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Serafini, S. Columba-Cabezas, F. Di Rosa, and F. Aloisi Intracerebral Recruitment and Maturation of Dendritic Cells in the Onset and Progression of Experimental Autoimmune Encephalomyelitis Am. J. Pathol., December 1, 2000; 157(6): 1991 - 2002. [Abstract] [Full Text] [PDF] |
||||
![]() |
, von, , , , and In Situ Tolerance within the Central Nervous System As a Mechanism for Preventing J. Exp. Med., September 18, 2000; 192(6): 871 - 880. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |