help button home button Am J Pathol sign up for etoc
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fayyazi, A.
Right arrow Articles by Zwirner, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fayyazi, A.
Right arrow Articles by Zwirner, J.
(American Journal of Pathology. 1999;154:495-501.)
© 1999 American Society for Investigative Pathology


Regular Articles

C5a Receptor and Interleukin-6 Are Expressed in Tissue Macrophages and Stimulated Keratinocytes but not in Pulmonary and Intestinal Epithelial Cells

Afshin Fayyazi* , Raoul Sandau{dagger} , Le Quynh Duong* , Otto Götze{dagger} , Heinz Joachim Radzun* , Stefan Schweyer* , Afsaneh Soruri{dagger} and Jörg Zwirner{dagger}

From the Departments of Pathology* and Immunology,{dagger} University of Göttingen, Göttingen, Germany


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The anaphylatoxin derived from the fifth component of the human complement system (C5a) mediates its effects by binding to a single high-affinity receptor (C5aR/CD88), the expression of which has been traditionally thought to be restricted to granulocytes, monocytes, macrophages (M{varphi}), and cell lines of myeloid origin. Recent immunohistochemical data suggested that human bronchial and alveolar cells express C5aR as well. To reexamine the tissue distribution of human C5aR expression, transcription of the C5aR gene was investigated in normal and pathologically affected human lung (bronchopneumonia, tuberculosis), large intestine (acute appendicitis, Crohn's disease), and skin (pyogenic granuloma, lichen planus) using in situ hybridization. In contrast to previous evidence, C5aR mRNA could not be detected in pulmonary or intestinal epithelial cells, whereas keratinocytes in inflamed but not in normal skin revealed detectable levels of C5aR transcripts. Additionally, it could be documented that only migrating M{varphi} express C5aR mRNA, whereas sessile M{varphi} in normal tissues and epithelioid/multinucleated M{varphi} found in granulomatous lesions do not. Because C5a has been demonstrated to upregulate the expression of interleukin (IL)-6 in human monocytes, we also studied IL-6 gene transcription in parallel to the C5aR. IL-6 mRNA was detectable in many tissue M{varphi}. Surprisingly, a tight co-expression of C5aR and IL-6 mRNA was observed in keratinocytes from lesions of pyogenic granuloma and lichen planus. These results point to an as yet unknown role for C5a in the pathogenesis of skin disorders beyond its well-defined function as a chemoattractant and activator of leukocytes.



    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
C5a, a 74-amino acid peptide cleaved from the complement protein C5, represents the most potent anaphylatoxin. At nanomolar levels, C5a leads to a complex pathophysiological response including cellular migration into inflammatory sites, changes in blood flow, and impairment of vascular integrity associated with edema.1,2 In addition, C5a possesses immunoregulatory activities through the induction of cytokines (tumor necrosis factor, IL-1, IL-6, and IL-8) in human monocytes.3-6

C5a mediates its effects by binding to a specific high-affinity receptor, C5aR/CD88, a member of the G-protein-coupled rhodopsin receptor family with seven transmembrane segments.7-9 A wealth of functional and binding data suggested that expression of the C5aR was limited to leukocytes and leukocyte-derived cell lines.10 By flow cytometry, immunohistochemistry, and Western blotting, Gasque et al11 showed recently that human astrocytes also express the C5aR. At the same time, Haviland et al12 reported that several non-myeloid-derived tissue cells including liver parenchymal cells, bronchial and alveolar epithelial cells, lung vascular smooth muscle, and endothelial cells also express the C5aR. In that study the cellular localization of C5aR production within the liver was demonstrated by immunohistochemistry and in situ hybridization, whereas C5aR expression in the lung was determined by immunohistochemistry.12 Although antibodies against C5aR/CD88 are valuable tools for investigating the C5aR on hemopoietic cells, results with nonmyeloid cells should be considered with caution. All antibodies presently available have been raised against synthetic peptides of the aminoterminal receptor portion and may bind to other antigens such as desmosomal antigens localized on human keratinocytes.13 To exclude false positive immunohistochemical signals within the human lung or other tissues, it is therefore important to apply in situ hybridization for C5aR mRNA detection.

In the present study, we have sought to map the cellular expression of C5aR mRNA, investigate the expression of C5aR mRNA in migrating as compared to sessile M{varphi}, and find in situ evidence for the effects of C5a on IL-6 induction. The investigations were performed on specimens of normal human lung, large intestine, and skin, and on samples of these tissues with granulocyte/monocyte- or lymphocyte-mediated inflammatory reactions.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tissue Samples

Studies were performed on surgically removed lung, large intestine, and skin biopsy specimens (i) without any pathological disorder, (ii) with granulocyte/monocyte-mediated inflammatory reactions (bronchopneumonia, acute appendicitis, and pyogenic granuloma), and (iii) with lymphocyte-mediated reactions (pulmonary tuberculosis, Crohn's disease of the vermiform appendix, and lichen planus of the skin). The tissue samples (n = 3 for each category of specimens) were fixed in 4% formaldehyde and embedded in paraffin. Five- to 10-µm-thick sections were mounted on silanized slides (Perkin Elmer, Langen, Germany). After deparaffinization, the sections were stained histochemically with hematoxylin and eosin. In addition, the tissues were analyzed by in situ hybridization (ISH), in situ reverse transcription-polymerase chain reaction (in situ RT-PCR), and indirect immunofluorescence (IF).

Detection of C5aR mRNA by Nonradioactive in Situ Hybridization

cRNA probes for the human C5aR were synthesized from PCR-generated cDNA as described.14 In brief, total RNA was isolated from peripheral blood mononuclear cells and subjected to a reverse transcriptase reaction as described previously.15 Amplification of a 409-bp cDNA fragment of the human C5aR (position 373-782 of the coding cDNA) was performed in an OmniGene Thermocycler (Hybaid, Middlesex, UK). Reaction mixtures of 50 µl contained cDNA corresponding to 4 ng RNA, 100 pmol of each C5aR specific primer including an additional sequence at the 5'-end complementary to promotors of T3-polymerase (antisense primer: 5' cagagatgcaattaaccctcactaaa gggaga-GTCACCTGGTAGGGCAACCAGAAG 3'), and T7-polymerase (sense primer: 5' ccaagcttctaatacgactcactatagggaga-CTGCTCCTGGCCACCATCA 3') (MWG Biotech, Ebersberg, Germany), 10 nmol of desoxynucleotides (dATP, dCTP, dGTP, dTTP), 5 µl Taq PCR buffer x10, and 1 U Taq polymerase (Pharmacia, Freiburg, Germany). After an initial 95°C denaturation step of 2 minutes, 35 PCR cycles were carried out at 95°C (60 seconds), 55°C (60 seconds) and 72°C (60 seconds), followed by a final extension cycle of 10 minutes at 72°C. Amplification products were separated on a 1% agarose gel and visualized by ethidium bromide staining. After purification, PCR-generated cDNA fragments were subjected to in vitro transcription. In this process, Digoxigenin-11-dUTP-labeled antisense and sense probes were generated using T3- and T7-polymerases, respectively, according to the manufacturer's instructions (Boehringer Mannheim, Mannheim, Germany). The amount of transcripts was monitored by 1% agarose gel electrophoresis. Labeling efficiency was controlled by dot blot analysis of serial dilutions of the probes.

ISH was performed according to a modified method published by Breitschopf et al.16 In brief, tissue sections were deparaffinized and rehydrated in serial dilutions of ethanol. Samples were permeabilized using proteinase K (10 µg/ml) for 10–30 minutes at 37°C. Digestion was stopped by washing the samples in Tris-buffered saline (TBS). Tissue specimens were then incubated in 0.25% acetic anhydride and dehydrated in serial dilutions of ethanol. Digoxigenin-labeled riboprobes were diluted in hybridization solution containing 50% deionized formamide, 5 x SSC, 1% sodium dodecyl sulfate (SDS), 50 µg/ml t-RNA, and 50 µg/ml heparin. After application of antisense or sense probes the samples were covered with sterile coverslips and placed on a hot plate at 85°C for 5 minutes for probe and target denaturation. Hybridization was performed overnight at 55°C in a sealed humid chamber containing 50% formamide. After hybridization the sections were submerged in 2 x SSC to remove the coverslips. Nonspecifically bound and unbound probes were removed by the following post-hybridization washes: 1 x SSC/1% SDS at room temperature (3 x 5 minutes), 0.2 x SSC/1% SDS at 55°C (2 x 10 minutes). Finally, the sections were washed in TBS (50 mmol/L Tris-HCl, 0.15 mol/L NaCl, pH 7.5) containing 0.1% (v/v) Tween-20 (Boehringer Mannheim) (3 x 5 minutes).

Signals were detected using a sheep polyclonal antibody F(ab)2 fragment against digoxigenin conjugated with alkaline phosphatase (1:500) (Boehringer Mannheim). Alkaline phosphatase activity was detected using 5-bromo-4-chloro-3-indolyl phosphate as substrate and nitro blue tetrazolium chloride as coupler (Boehringer Mannheim). Specimens were either counterstained with Mayer's hematoxylin or nuclear fast red and mounted in Aquamount (BDH Laboratories, Poole, UK) or subjected to indirect immunofluorescence.

A light microscopic examination followed. Positive cells showed strong cytoplasmic staining around the clearly demarcated nuclei.

For each tissue sample sense riboprobes were used as controls and proved to be negative.

Detection of IL-6 mRNA by in Situ RT-PCR

Tissue sections were incubated three times for 5 minutes in 0.01 mol/L citrate buffer (pH 6.0) in a microwave oven set to high power (600–700 W). Thereafter, in situ cycling and labeling of the PCR products were performed as described.17 Finally, signals were detected using a sheep polyclonal antibody F(ab)2 fragment against digoxygenin conjugated with alkaline phosphatase (1:500) (Boehringer Mannheim). Alkaline phosphatase activity was visualized by applying 5-bromo-4-chloro-3-indolyl phosphate as substrate and nitro blue tetrazolium chloride as coupler (Boehringer Mannheim). All specimens were mounted in Aquamount (BDH Laboratories).

Light microscopic examination followed. Positive cells showed strong cytoplasmic staining around the clearly demarcated nuclei.

Two slides were run as controls for each in situ RT-PCR experiment. Lymph node sections served as positive controls run under cycling conditions as described above. They exhibited positive signals in the compartments described by Peters et al.17 Sections from the materials subjected to in situ RT-PCR were run without primers serving as controls and proved to be negative.

Indirect Immunofluorescence

The primary monoclonal antibody Ki-M1P (anti-CD68) recognizing all populations of monocytes and M{varphi}18 was obtained from the Department of Pathology, University of Kiel, Germany.

Indirect immunofluorescence with the antibody Ki-M1P was performed on the same sections immediately after ISH or, in the case of IL-6 mRNA detection, on serial sections from the materials subjected to in situ RT-PCR. Sections were incubated for 2 hours with the monoclonal antibody Ki-M1P (hybridoma culture supernatant diluted 1:2000). Thereafter, samples were incubated with FITC-labeled goat anti-mouse IgG for 1 hour (working dilution 1:50) (Dako, Hamburg, Germany). An examination by fluorescence microscopy followed.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Investigation of C5aR and IL-6 mRNA Expression in Human Lung

In normal human lung specimens, C5aR mRNA was detected in all small Ki-M1P-positive M{varphi} localized in the subepithelial connective tissue of the bronchial mucous membrane and within the alveolar walls. IL-6 mRNA was detectable in many Ki-M1P-positive M{varphi} and in lymphocytes infiltrating the alveolar walls. In contrast, C5aR or IL-6 mRNA expression could not be observed in bronchial and alveolar epithelial cells, in large Ki-M1P-positive M{varphi} within the alveolar airspace, or in vascular smooth muscle or endothelial cells (Figures 1, a and b, and 2, a–d) .



View larger version (117K):
[in this window]
[in a new window]
 
Figure 1. Bronchial epithelial cells express neither C5aR nor IL-6 mRNA. C5aR mRNA was detected by in situ hybridization followed by counterstaining with Mayer's hematoxylin (a), whereas IL-6 mRNA was detected by in situ RT-PCR without nuclear counterstaining (b). C5aR and IL-6 mRNA could be noted in leucocytes localized in the subepithelial connective tissue of the bronchial mucous membrane (filled arrows), but not within bronchial epithelial cells (open arrows). Original magnification, x400.

 


View larger version (106K):
[in this window]
[in a new window]
 
Figure 2. C5aR and IL-6 mRNA expression in the normal human lung parenchyma. C5aR mRNA was detected by in situ hybridization (a) combined with indirect immunofluorescent labeling (Ki-M1P) of M{varphi} on the same section (b). IL-6 mRNA was detected by in situ RT-PCR (c) followed by indirect immunofluorescent labeling (Ki-M1P) of M{varphi} on the serial section (d). In lung parenchyma C5aR and IL-6 mRNA expression could be noted in leucocytes localized within alveolar walls (filled arrows) (a and c). Whereas C5aR expression was restricted to small M{varphi} (filled arrows) (a and b), IL-6 mRNA was noted not only in M{varphi} but also in lymphocytes. Filled arrows denote some IL-6 mRNA-expressing M{varphi} (c and d). Note that alveolar epithelial cells (open arrows) and large M{varphi} within the alveolar airspace (arrowheads) fail to express C5aR or IL-6 mRNA (a-d). Original magnification, x400 (a, b) and x250 (c, d).

 
In human lung biopsy specimens from bronchopneumonia with abundant scarring, C5aR mRNA was noted in all small, infiltrating Ki-M1P-positive M{varphi} localized within the bronchial walls and fibrous septa. IL-6 mRNA was detected in many small macrophages, in lymphocytes infiltrating the alveolar walls, and also in the endothelium of many capillaries. In contrast, C5aR or IL-6 mRNA expression could not be detected in large, Ki-M1P-positive M{varphi} found within the alveolar airspace (data not shown).

In tissue samples from pulmonary tuberculosis, C5aR mRNA was detected in all small infiltrating Ki-M1P-positive M{varphi} localized within the fibrous septa. IL-6 transcripts were detected in many small infiltrating M{varphi} and in lymphocytes infiltrating alveolar walls and those surrounding epithelioid granulomas, as well as within endothelium of some capillaries. In contrast, C5aR or IL-6 mRNA expression could not be noted in epithelioid or multinucleated, Ki-M1P-positive M{varphi} present in granulomas (Figure 3, a–d) .



View larger version (114K):
[in this window]
[in a new window]
 
Figure 3. C5aR and IL-6 mRNA expression in human lung from pulmonary tuberculosis. C5aR mRNA was detected by in situ hybridization (a) combined with immunofluorescent labeling (Ki-M1P) of M{varphi} on the same section (b). IL-6 mRNA was detected by in situ RT-PCR (c) followed by indirect immunofluorescent labeling (Ki-M1P) of M{varphi} on the serial section (d). Whereas C5aR expression (black) (a) was restricted to small M{varphi} (green) (b), IL-6 mRNA was noted not only in M{varphi} but also in lymphocytes (black) (c). Filled arrows denote some IL-6 mRNA-expressing M{varphi} (c and d), whereas the open arrow denotes two lymphocytes expressing IL-6 mRNA (c). Note that M{varphi} arranged in epithelioid granulomas (G) do not express C5aR (a) or IL-6 (c), but are Ki-M1P positive (green) (b and d). Arrowheads denote multinucleated M{varphi}, which fail to express C5aR or IL-6. Original magnification, x400.

 
Investigation of C5aR and IL-6 mRNA Expression in Human Large Intestine

In the normal human large intestine, C5aR mRNA was detected in all small Ki-M1P-positive M{varphi} localized in the subepithelial connective tissue of the intestinal mucous membrane. Positive cytoplasmic staining for IL-6 mRNA was seen in many small M{varphi} and interfollicular lymphocytes, some germinal center cells, many interfollicular lymphocytes, and several fibroblasts localized within the subserosa. In contrast, C5aR or IL-6 mRNA expression could not be observed in epithelial cells, vascular smooth muscle, or endothelial cells (Figure 4, a–b) .



View larger version (115K):
[in this window]
[in a new window]
 
Figure 4. Epithelial cells of the large intestine express neither C5aR nor IL-6 mRNA. C5aR mRNA was detected by in situ hybridization followed by counterstaining with Mayer's hematoxylin (a) whereas IL-6 mRNA was detected by in situ RT-PCR without nuclear counterstaining (b). In the human large intestine C5aR or IL-6 mRNA could be noted in leucocytes localized in the subepithelial connective tissue (filled arrows), but not within epithelial cells (open arrows). Original magnification, x400.

 
In vermiform appendices from patients with acute appendicitis, C5aR mRNA was noted in all small infiltrating Ki-M1P-positive M{varphi} scattered through the appendix wall. IL-6 mRNA was detected in many small infiltrating M{varphi} and interfollicular lymphocytes, some germinal center cells, and in the endothelium of many capillaries (data not shown).

In vermiform appendices from patients with Crohn's disease, C5aR mRNA was detected in all small infiltrating Ki-M1P-positive M{varphi} scattered through the appendix wall. IL-6 transcripts were detected in many small M{varphi} and interfollicular lymphocytes, some germinal center cells, and in the endothelium of many capillaries. In contrast, neither C5aR nor IL-6 mRNA expression was detected in epithelioid and multinucleated Ki-M1P-positive M{varphi} present in granulomas (data not shown).

Investigation of C5aR and IL-6 mRNA in Human Skin

In normal human skin, C5aR and IL-6 mRNA could not be detected in any tissue compartment. In skin from pyogenic granuloma, both C5aR and IL-6 mRNA expression were detectable in the basal and suprabasal cell layer of the epidermis. In addition, all small infiltrating Ki-M1P-positive M{varphi} expressed C5aR mRNA and many of them expressed IL-6 mRNA. IL-6 mRNA was also expressed in many infiltrating small lymphocytes and some endothelial cells. In skin from lichen planus, C5aR mRNA (Figure 5, a -c) and IL-6 mRNA (Figure 6) were detected within the basal and suprabasal cell layers of the epidermis and also within the infiltrating Ki-M1P-positive M{varphi} scattered through the subepidermal connective tissue. Infiltrating small lymphocytes and some vascular endothelial cells revealed IL-6 mRNA expression as well.



View larger version (145K):
[in this window]
[in a new window]
 
Figure 5. C5aR mRNA expression in human skin from lichen planus. C5aR mRNA was detected by in situ hybridization followed by counterstaining with nuclear fast red. Small infiltrating M{varphi} within the subepidermal connective tissue (a) (arrowheads) and basal/suprabasal keratinocytes (a and b) (filled arrows) show strong cytoplasmic staining, whereas superficially localized keratinocytes (b) (open arrow) remain negative for C5aR mRNA. By applying sense riboprobes, no staining could be noted in basal/suprabasal keratinocytes (c) (filled arrow), or superficially localized keratinocytes (c) (open arrow). Original magnification, x125 (a), x1000 (b), and x500 (c).

 


View larger version (116K):
[in this window]
[in a new window]
 
Figure 6. IL-6 mRNA expression in human skin from lichen planus. IL-6 mRNA was detected by in situ RT-PCR without nuclear counterstaining. Almost all basal and suprabasal keratinocytes from affected lichen planus express IL-6 mRNA. Original magnification, x400.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cellular Expression of C5aR mRNA

Originally it was postulated that C5aR expression is restricted to peripheral blood leukocytes and related cell lines.10 However, by applying immunohistochemistry, Haviland et al12 demonstrated that bronchial and alveolar epithelial cells, as well as lung vascular smooth muscle and endothelial cells, may express the C5aR. In the present study, we investigated the cellular expression of C5aR mRNA by applying in situ hybridization. In the normal human lung and large intestine and in specimens from those tissues with granulocyte/monocyte or lymphocyte infiltrations, C5aR mRNA could not be detected in the epithelium (bronchial epithelium, alveolar lining cells, and enterocytes), in vascular muscle, or in endothelial cells. The immunohistochemical findings reported by Haviland et al12 could therefore possibly be a consequence of antibody binding to antigens other than CD88. This interpretation is in accordance with evidence reported by Werfel et al13 that specific binding of anti-C5aR monoclonal antibodies to desmosomal antigens is the cause of false positive immunohistochemical signals within the human epidermis. We next asked whether human keratinocytes more closely resemble C5aR-negative pulmonary/intestinal epithelial cells or epithelial liver cells shown to express the C5aR constitutively. To our surprise, we could not observe any C5aR mRNA in the normal epidermis, whereas in those specimens from inflammatory lesions (pyogenic granuloma and lichen planus) keratinocytes as well as tissue-infiltrating M{varphi} revealed strong C5aR mRNA expression. This finding demonstrates that in skin disorders, keratinocyte stimulation may not only modulate the functions of migrating inflammatory cells via the production of cytokines,19-20 but may also lead to the expression of receptors, eg, for IL-821 and C5a, thereby rendering these cells responsive to signals from the cutaneous microenviroment.

Heterogeneous Expression of C5aR mRNA in Tissue Macrophages

In the normal lung all small Ki-M1P-positive M{varphi} localized in subepithelial connective tissue of the bronchial mucous membrane and within the alveolar walls revealed C5aR mRNA expression, whereas receptor transcripts could not be detected in large Ki-M1P-positive M{varphi} localized within the alveolar airspace. This evidence suggests that newly arrived M{varphi} still express the C5aR, whereas older M{varphi}, which have transversed alveolar walls and entered into the alveolar airspace, down-regulate their receptor expression. The same phenomenon was observed in tissue samples of bronchopneumonia and pulmonary tuberculosis, in which freshly immigrated small M{varphi} found within the bronchial wall or fibrous septa expressed C5aR transcripts, whereas M{varphi} localized within the airspace or present in granulomas did not reveal any detectable C5aR expression. In line with these observations, we did not observe C5aR expression in epithelioid/multinucleated M{varphi} found within granulomas in Crohn's disease. Considering the role of C5aR as a chemoattractant receptor, these findings suggest that tissue M{varphi} cease to express C5aR when they stop migrating.

Co-expression of C5aR and IL-6 mRNA

Using a double staining method based on a combination of ISH and indirect immunofluorescence on the same section, it could be demonstrated that in biopsy specimens of normal tissues and also in those of pathological disorders, all migrating but not resident M{varphi} express C5aR mRNA. However, technical reasons such as the denaturation of CD68 after 60 cycles of PCR excluded the detection of CD68 and IL-6 mRNA on the same section. Because serial sections 5–10 µm apart from each other were used, we found it difficult to locate unequivocally the Ki-M1P- and the IL-6 mRNA-derived signals to the same cells in the tissues examined. We estimate that 10 to 40% of the CD68 and C5aR mRNA-positive infiltrating M{varphi} coexpress IL-6 mRNA. This is in line with recently published data showing that about 20% of Ki-M1P-positive M{varphi} in lymph nodes express IL-6 mRNA.17 Surprisingly, a close correlation of C5aR and IL-6 mRNA expression was found in almost all basal and suprabasal keratinocytes from pyogenic granuloma and lichen planus, but not in keratinocytes from normal skin.

IL-6 is a cytokine with multiple growth and differentiation activities,22 the expression of which has been demonstrated in cultured monocytes and keratinocytes following stimulation.23,24 Previously, Scholz et al25 showed that recombinant human C5a induces IL-6 production in monocytes. Subsequently, Höpken et al26 reported that anti-C5a monoclonal antibodies significantly lower peripheral blood IL-6 concentrations in pigs infused with E. coli. They concluded that C5a plays a key role for the expression of IL-6 during the early phase of acute inflammatory reactions. Our observation that in situ, both C5aR and IL-6 are coexpressed in 10–40% of migrating M{varphi} and in almost all stimulated keratinocytes may be in line with the regulatory role of C5a on IL-6 expression in cell types that express the C5aR constitutively or upon stimulation.

Further studies will need to address the nature of the stimuli leading to C5aR upregulation in keratinocytes, the relationship between the pro-inflammatory mediators C5a and IL-6 in dermatoses, and the mechanisms leading to down-regulation of C5aR in older M{varphi} after their migration into tissue lesions.


    Acknowledgements
 
We thank Dr. R. Parwaresch and Dr. J. Peters from the University of Kiel Department of Pathology for expert advice on performing in situ RT-PCR experiments. We also thank Mrs. Adriana Soto for skillful technical assistance.


    Footnotes
 
Address reprint requests to Dr. Jörg Zwirner, Abteilung Immunologie, Universität Göttingen, Kreuzbergring 57, D-37075 Göttingen, Germany.

Supported by grants from the Stiftung der Universität Göttingen and the Deutsche Forschungsgemeinschaft, projects Go 410/7-2 and SFB 402-B5.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Schulman ES, Post TJ, Henson PM, Giclas PC: Differential effects of the complement peptides, C5a and C5a des Arg. J Clin Invest 1988, 81:918-923
  2. Werfel T, Oppermann M, Schulze M, Krieger G, Weber M, Götze O: Binding of fluorescein-labeled anaphylatoxin C5a to human peripheral blood, spleen, and bone marrow leukocytes. Blood 1992, 79:151-160
  3. Cavaillon JM, Fitting C, Haeffner-Cavaillon N: Recombinant C5a enhances interleukin 1 and tumor necrosis factor release by lipopolysaccharide-stimulated monocytes and macrophages. Eur J Immunol 1990, 20:253-257[Medline]
  4. Schindler R, Gelfand JA, Dinarello CA: Recombinant C5a stimulates transcription rather than translation of interleukin-1 (IL-1) and tumor necrosis factor: translational signal provided by lipopolysaccharide or IL-1 itself. Blood 1990, 76:1631-1638[Abstract/Free Full Text]
  5. Montz H, Koch KC, Ziers R, Götze O: The role of C5a in interleukin-6 production induced by lipopolysaccharide or interleukin-1. Immunology 1991, 74:373-379[Medline]
  6. Ember JA, Sanderson SD, Hugli TE, Morgan EL: Induction of interleukin-8 synthesis from monocytes by human C5a anaphylatoxin. Am J Pathol 1994, 144:393-403[Abstract]
  7. Siciliano SJ, Rollins TE, Springer MS: Interaction between the C5a receptor and Gi in both the membrane-bound and detergent-solubilized states. J Biol Chem 1990, 265:19568-19574[Abstract/Free Full Text]
  8. Gerard NP, Gerard C: The chemotactic receptor for human C5a anaphylatoxin. Nature 1991, 349:614-617[Medline]
  9. Boulay F, Mery L, Tardif M, Brouchon L, Vignais P: Expression cloning of a receptor for C5a anaphylatoxin on differentiated HL-60 cells. Biochemistry 1991, 30:2993-2999[Medline]
  10. Huey R, Hugli TE: C5a receptor. Methods Enzymol 1987, 150:615-627[Medline]
  11. Gasque P, Chan P, Fontaine M, Ischenko A, Lamacz M, Götze O, Morgan BP: Identification and characterization of the complement C5a anaphylatoxin receptor on human astrocytes. J Immunol 1995, 155:4882-4889[Abstract]
  12. Haviland DL, McCoy RL, Whitehead WT, Akama H, Molmenti EP, Brown A, Haviland JC, Parks WC, Perlmutter DH, Westel RA: Cellular expression of the C5a anaphylatoxin receptor (C5aR): Demonstration of C5aR on non-myeloid cells of the liver and lung. J Immunol 1995, 154:1861-1869[Abstract]
  13. Werfel T, Zwirner J, Oppermann M, Sieber A, Begemann G, Drommer W, Kapp A, Götze O: CD88 antibodies specifically bind to C5aR on dermal CD117+ and CD14+ cells and react with a desmosomal antigen in human skin. J Immunol 1996, 157:1729-1735[Abstract]
  14. Logel J, Dill D, Leonard S: Synthesis of cRNA probes from PCR-generated DNA. Biotechniques 1992, 13:604-610[Medline]
  15. Mihm M, Hutschenreiter A, Fayyazi A, Pingel S, Ramadori G: High inflammatory activity is associated with an increased amount of IFN-gamma transcripts in peripheral blood cells of patients with chronic hepatitis C virus infection. Med Microbiol Immunol 1996, 185:95-102[Medline]
  16. Breitschopf H, Suchanek G, Gould RM, Colman DR, Lassmann H: In situ hybridization with digoxigenin-labeled probes: sensitive and reliable detection method applied to myelinating rat brain. Acta Neuropathol 1992, 84:581-587[Medline]
  17. Peters J, Krams M, Wacker HH, Carstens A, Weisner D, Hamann K, Menke M, Harms D, Parwaresch R: Detection of rare RNA sequences by single-enzyme in situ reverse transcription-polymerase chain reaction. Am J Pathol 1997, 150:469-476[Abstract]
  18. Radzun HJ, Hansmann ML, Heidebrecht HJ, Bodewadt-Radzun S, Wacker HH, Kreipe H, Lumbeck H, Hernandez C, Kuhn C, Parwaresch MR: Detection of a monocyte/macrophage differentiation antigen in routinely processed paraffin-embeded tissues by monoclonal antibody Ki-M1P. Lab Invest 1991, 65:306-315[Medline]
  19. Matsue H, Cruz PD, Jr, Bergstresser PR, Takashima A: Cytokine expression by epidermal cell subpopulations. J Invest Dermatol 1992, 99:42S-45S[Medline]
  20. Takashima A, Bergstresser PR: Cytokine-mediated communication by keratinocytes and Langerhans cells with dendritic epidermal cells. Semin Immunol 1996, 8:333-339[Medline]
  21. Kemeny L, Ruzicka T, Dobozy A, Michel G: Role of interleukin-8 receptors in human skin. Int Arch Allergy Immunol 1994, 104:317-322[Medline]
  22. Le J, Vilcek J: Biology of disease. Interleukin 6: a multifunctional cytokine regulating immune reactions and the acute phase protein response. Lab Invest 1989, 61:588-602[Medline]
  23. Li J, Farthing PM, Ireland GW, Thornhill MH: IL-1 alpha and IL-6 production by oral and skin keratinocytes: similarities and differences in response to cytokine treatment in vivo. J Oral Pathol Med 1996, 25:157-162[Medline]
  24. Van Snick J: Interleukin-6: an overview. Ann Rev Immunol 1990, 8:253-278[Medline]
  25. Scholz W, McClurg MR, Cardenas GJ, Smith M, Noonan DJ, Hugli TE, Morgan EL: C5a-mediated release of interleukin 6 by human monocytes. Clin Immunol Immunopathol 1990, 57:297-307[Medline]
  26. Höpken U, Mohr M, Strüber A, Montz H, Burchardi H, Götze O, Oppermann M: Inhibition of interleukin-6 synthesis in an animal model of septic shock by anti-C5a monoclonal antibodies. Eur J Immunol 1996, 26:1103-1109[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
I. J. Laudes, J. C. Chu, M. Huber-Lang, R.-F. Guo, N. C. Riedemann, J. V. Sarma, F. Mahdi, H. S. Murphy, C. Speyer, K. T. Lu, et al.
Expression and Function of C5a Receptor in Mouse Microvascular Endothelial Cells
J. Immunol., November 15, 2002; 169(10): 5962 - 5970.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. C. Riedemann, R.-F. Guo, V. J. Sarma, I. J. Laudes, M. Huber-Lang, R. L. Warner, E. A. Albrecht, C. L. Speyer, and P. A. Ward
Expression and Function of the C5a Receptor in Rat Alveolar Epithelial Cells
J. Immunol., February 15, 2002; 168(4): 1919 - 1925.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. M. Drouin, J. Kildsgaard, J. Haviland, J. Zabner, H. P. Jia, P. B. McCray Jr., B. F. Tack, and R. A. Wetsel
Expression of the Complement Anaphylatoxin C3a and C5a Receptors on Bronchial Epithelial and Smooth Muscle Cells in Models of Sepsis and Asthma
J. Immunol., February 1, 2001; 166(3): 2025 - 2032.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. L. Schieferdecker, G. Schlaf, M. Koleva, O. Gotze, and K. Jungermann
Induction of Functional Anaphylatoxin C5a Receptors on Hepatocytes by In Vivo Treatment of Rats with IL-6
J. Immunol., May 15, 2000; 164(10): 5453 - 5458.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fayyazi, A.
Right arrow Articles by Zwirner, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fayyazi, A.
Right arrow Articles by Zwirner, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS