| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Departments of Pathology* and
Immunology, University of Göttingen,
Göttingen, Germany
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
), and cell lines of
myeloid origin. Recent immunohistochemical data suggested that human
bronchial and alveolar cells express C5aR as well. To reexamine the
tissue distribution of human C5aR expression, transcription of
the C5aR gene was investigated in normal and pathologically affected
human lung (bronchopneumonia, tuberculosis), large
intestine (acute appendicitis, Crohn's disease), and
skin (pyogenic granuloma, lichen planus) using in
situ hybridization. In contrast to previous evidence,
C5aR mRNA could not be detected in pulmonary or intestinal epithelial
cells, whereas keratinocytes in inflamed but not in normal skin
revealed detectable levels of C5aR transcripts. Additionally,
it could be documented that only migrating M express C5aR
mRNA, whereas sessile M in normal tissues and
epithelioid/multinucleated M found in granulomatous lesions do not.
Because C5a has been demonstrated to upregulate the expression of
interleukin (IL)-6 in human monocytes, we also studied IL-6
gene transcription in parallel to the C5aR. IL-6 mRNA was detectable in
many tissue M. Surprisingly, a tight co-expression of C5aR
and IL-6 mRNA was observed in keratinocytes from lesions of pyogenic
granuloma and lichen planus. These results point to an as yet unknown
role for C5a in the pathogenesis of skin disorders beyond its
well-defined function as a chemoattractant and activator of
leukocytes.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
C5a mediates its effects by binding to a specific high-affinity receptor, C5aR/CD88, a member of the G-protein-coupled rhodopsin receptor family with seven transmembrane segments.7-9 A wealth of functional and binding data suggested that expression of the C5aR was limited to leukocytes and leukocyte-derived cell lines.10 By flow cytometry, immunohistochemistry, and Western blotting, Gasque et al11 showed recently that human astrocytes also express the C5aR. At the same time, Haviland et al12 reported that several non-myeloid-derived tissue cells including liver parenchymal cells, bronchial and alveolar epithelial cells, lung vascular smooth muscle, and endothelial cells also express the C5aR. In that study the cellular localization of C5aR production within the liver was demonstrated by immunohistochemistry and in situ hybridization, whereas C5aR expression in the lung was determined by immunohistochemistry.12 Although antibodies against C5aR/CD88 are valuable tools for investigating the C5aR on hemopoietic cells, results with nonmyeloid cells should be considered with caution. All antibodies presently available have been raised against synthetic peptides of the aminoterminal receptor portion and may bind to other antigens such as desmosomal antigens localized on human keratinocytes.13 To exclude false positive immunohistochemical signals within the human lung or other tissues, it is therefore important to apply in situ hybridization for C5aR mRNA detection.
In the present study, we have sought to map the cellular expression of
C5aR mRNA, investigate the expression of C5aR mRNA in migrating as
compared to sessile M, and find in situ evidence for the
effects of C5a on IL-6 induction. The investigations were performed on
specimens of normal human lung, large intestine, and skin, and on
samples of these tissues with granulocyte/monocyte- or
lymphocyte-mediated inflammatory reactions.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Studies were performed on surgically removed lung, large intestine, and skin biopsy specimens (i) without any pathological disorder, (ii) with granulocyte/monocyte-mediated inflammatory reactions (bronchopneumonia, acute appendicitis, and pyogenic granuloma), and (iii) with lymphocyte-mediated reactions (pulmonary tuberculosis, Crohn's disease of the vermiform appendix, and lichen planus of the skin). The tissue samples (n = 3 for each category of specimens) were fixed in 4% formaldehyde and embedded in paraffin. Five- to 10-µm-thick sections were mounted on silanized slides (Perkin Elmer, Langen, Germany). After deparaffinization, the sections were stained histochemically with hematoxylin and eosin. In addition, the tissues were analyzed by in situ hybridization (ISH), in situ reverse transcription-polymerase chain reaction (in situ RT-PCR), and indirect immunofluorescence (IF).
Detection of C5aR mRNA by Nonradioactive in Situ Hybridization
cRNA probes for the human C5aR were synthesized from PCR-generated cDNA as described.14 In brief, total RNA was isolated from peripheral blood mononuclear cells and subjected to a reverse transcriptase reaction as described previously.15 Amplification of a 409-bp cDNA fragment of the human C5aR (position 373-782 of the coding cDNA) was performed in an OmniGene Thermocycler (Hybaid, Middlesex, UK). Reaction mixtures of 50 µl contained cDNA corresponding to 4 ng RNA, 100 pmol of each C5aR specific primer including an additional sequence at the 5'-end complementary to promotors of T3-polymerase (antisense primer: 5' cagagatgcaattaaccctcactaaa gggaga-GTCACCTGGTAGGGCAACCAGAAG 3'), and T7-polymerase (sense primer: 5' ccaagcttctaatacgactcactatagggaga-CTGCTCCTGGCCACCATCA 3') (MWG Biotech, Ebersberg, Germany), 10 nmol of desoxynucleotides (dATP, dCTP, dGTP, dTTP), 5 µl Taq PCR buffer x10, and 1 U Taq polymerase (Pharmacia, Freiburg, Germany). After an initial 95°C denaturation step of 2 minutes, 35 PCR cycles were carried out at 95°C (60 seconds), 55°C (60 seconds) and 72°C (60 seconds), followed by a final extension cycle of 10 minutes at 72°C. Amplification products were separated on a 1% agarose gel and visualized by ethidium bromide staining. After purification, PCR-generated cDNA fragments were subjected to in vitro transcription. In this process, Digoxigenin-11-dUTP-labeled antisense and sense probes were generated using T3- and T7-polymerases, respectively, according to the manufacturer's instructions (Boehringer Mannheim, Mannheim, Germany). The amount of transcripts was monitored by 1% agarose gel electrophoresis. Labeling efficiency was controlled by dot blot analysis of serial dilutions of the probes.
ISH was performed according to a modified method published by Breitschopf et al.16 In brief, tissue sections were deparaffinized and rehydrated in serial dilutions of ethanol. Samples were permeabilized using proteinase K (10 µg/ml) for 10–30 minutes at 37°C. Digestion was stopped by washing the samples in Tris-buffered saline (TBS). Tissue specimens were then incubated in 0.25% acetic anhydride and dehydrated in serial dilutions of ethanol. Digoxigenin-labeled riboprobes were diluted in hybridization solution containing 50% deionized formamide, 5 x SSC, 1% sodium dodecyl sulfate (SDS), 50 µg/ml t-RNA, and 50 µg/ml heparin. After application of antisense or sense probes the samples were covered with sterile coverslips and placed on a hot plate at 85°C for 5 minutes for probe and target denaturation. Hybridization was performed overnight at 55°C in a sealed humid chamber containing 50% formamide. After hybridization the sections were submerged in 2 x SSC to remove the coverslips. Nonspecifically bound and unbound probes were removed by the following post-hybridization washes: 1 x SSC/1% SDS at room temperature (3 x 5 minutes), 0.2 x SSC/1% SDS at 55°C (2 x 10 minutes). Finally, the sections were washed in TBS (50 mmol/L Tris-HCl, 0.15 mol/L NaCl, pH 7.5) containing 0.1% (v/v) Tween-20 (Boehringer Mannheim) (3 x 5 minutes).
Signals were detected using a sheep polyclonal antibody F(ab)2 fragment against digoxigenin conjugated with alkaline phosphatase (1:500) (Boehringer Mannheim). Alkaline phosphatase activity was detected using 5-bromo-4-chloro-3-indolyl phosphate as substrate and nitro blue tetrazolium chloride as coupler (Boehringer Mannheim). Specimens were either counterstained with Mayer's hematoxylin or nuclear fast red and mounted in Aquamount (BDH Laboratories, Poole, UK) or subjected to indirect immunofluorescence.
A light microscopic examination followed. Positive cells showed strong cytoplasmic staining around the clearly demarcated nuclei.
For each tissue sample sense riboprobes were used as controls and proved to be negative.
Detection of IL-6 mRNA by in Situ RT-PCR
Tissue sections were incubated three times for 5 minutes in 0.01 mol/L citrate buffer (pH 6.0) in a microwave oven set to high power (600–700 W). Thereafter, in situ cycling and labeling of the PCR products were performed as described.17 Finally, signals were detected using a sheep polyclonal antibody F(ab)2 fragment against digoxygenin conjugated with alkaline phosphatase (1:500) (Boehringer Mannheim). Alkaline phosphatase activity was visualized by applying 5-bromo-4-chloro-3-indolyl phosphate as substrate and nitro blue tetrazolium chloride as coupler (Boehringer Mannheim). All specimens were mounted in Aquamount (BDH Laboratories).
Light microscopic examination followed. Positive cells showed strong cytoplasmic staining around the clearly demarcated nuclei.
Two slides were run as controls for each in situ RT-PCR experiment. Lymph node sections served as positive controls run under cycling conditions as described above. They exhibited positive signals in the compartments described by Peters et al.17 Sections from the materials subjected to in situ RT-PCR were run without primers serving as controls and proved to be negative.
Indirect Immunofluorescence
The primary monoclonal antibody Ki-M1P (anti-CD68) recognizing all
populations of monocytes and M18
was obtained from the
Department of Pathology, University of Kiel, Germany.
Indirect immunofluorescence with the antibody Ki-M1P was performed on the same sections immediately after ISH or, in the case of IL-6 mRNA detection, on serial sections from the materials subjected to in situ RT-PCR. Sections were incubated for 2 hours with the monoclonal antibody Ki-M1P (hybridoma culture supernatant diluted 1:2000). Thereafter, samples were incubated with FITC-labeled goat anti-mouse IgG for 1 hour (working dilution 1:50) (Dako, Hamburg, Germany). An examination by fluorescence microscopy followed.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In normal human lung specimens, C5aR mRNA was detected in all
small Ki-M1P-positive M localized in the subepithelial connective
tissue of the bronchial mucous membrane and within the alveolar walls.
IL-6 mRNA was detectable in many Ki-M1P-positive M and in
lymphocytes infiltrating the alveolar walls. In contrast, C5aR or IL-6
mRNA expression could not be observed in bronchial and alveolar
epithelial cells, in large Ki-M1P-positive M within the alveolar
airspace, or in vascular smooth muscle or endothelial cells
(Figures 1, a and b, and 2, a–d)
.
|
|
localized within the bronchial walls and fibrous
septa. IL-6 mRNA was detected in many small macrophages, in lymphocytes
infiltrating the alveolar walls, and also in the endothelium of many
capillaries. In contrast, C5aR or IL-6 mRNA expression could not be
detected in large, Ki-M1P-positive M found within the alveolar
airspace (data not shown).
In tissue samples from pulmonary tuberculosis, C5aR mRNA was detected
in all small infiltrating Ki-M1P-positive M localized within the
fibrous septa. IL-6 transcripts were detected in many small
infiltrating M and in lymphocytes infiltrating alveolar walls and
those surrounding epithelioid granulomas, as well as within endothelium
of some capillaries. In contrast, C5aR or IL-6 mRNA expression could
not be noted in epithelioid or multinucleated, Ki-M1P-positive
M present in granulomas (Figure 3, a–d)
.
|
In the normal human large intestine, C5aR mRNA was detected in all
small Ki-M1P-positive M localized in the subepithelial connective
tissue of the intestinal mucous membrane. Positive cytoplasmic staining
for IL-6 mRNA was seen in many small M and interfollicular
lymphocytes, some germinal center cells, many interfollicular
lymphocytes, and several fibroblasts localized within the subserosa. In
contrast, C5aR or IL-6 mRNA expression could not be observed in
epithelial cells, vascular smooth muscle, or endothelial cells (Figure 4, a–b)
.
|
scattered
through the appendix wall. IL-6 mRNA was detected in many small
infiltrating M and interfollicular lymphocytes, some germinal center
cells, and in the endothelium of many capillaries (data not shown).
In vermiform appendices from patients with Crohn's disease, C5aR mRNA
was detected in all small infiltrating Ki-M1P-positive M scattered
through the appendix wall. IL-6 transcripts were detected in many small
M and interfollicular lymphocytes, some germinal center cells, and
in the endothelium of many capillaries. In contrast, neither C5aR nor
IL-6 mRNA expression was detected in epithelioid and multinucleated
Ki-M1P-positive M present in granulomas (data not shown).
Investigation of C5aR and IL-6 mRNA in Human Skin
In normal human skin, C5aR and IL-6 mRNA could not be detected in
any tissue compartment. In skin from pyogenic granuloma, both C5aR and
IL-6 mRNA expression were detectable in the basal and suprabasal cell
layer of the epidermis. In addition, all small infiltrating
Ki-M1P-positive M expressed C5aR mRNA and many of them expressed
IL-6 mRNA. IL-6 mRNA was also expressed in many infiltrating small
lymphocytes and some endothelial cells. In skin from lichen planus,
C5aR mRNA (Figure 5, a
-c) and IL-6 mRNA
(Figure 6)
were detected within the basal
and suprabasal cell layers of the epidermis and also within the
infiltrating Ki-M1P-positive M scattered through the subepidermal
connective tissue. Infiltrating small lymphocytes and some vascular
endothelial cells revealed IL-6 mRNA expression as well.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Originally it was postulated that C5aR expression is restricted to
peripheral blood leukocytes and related cell lines.10
However, by applying immunohistochemistry, Haviland et
al12
demonstrated that bronchial and alveolar epithelial
cells, as well as lung vascular smooth muscle and endothelial cells,
may express the C5aR. In the present study, we investigated the
cellular expression of C5aR mRNA by applying in situ
hybridization. In the normal human lung and large intestine and in
specimens from those tissues with granulocyte/monocyte or lymphocyte
infiltrations, C5aR mRNA could not be detected in the epithelium
(bronchial epithelium, alveolar lining cells, and enterocytes), in
vascular muscle, or in endothelial cells. The immunohistochemical
findings reported by Haviland et al12
could therefore
possibly be a consequence of antibody binding to antigens other than
CD88. This interpretation is in accordance with evidence reported by
Werfel et al13
that specific binding of anti-C5aR
monoclonal antibodies to desmosomal antigens is the cause of false
positive immunohistochemical signals within the human epidermis. We
next asked whether human keratinocytes more closely resemble
C5aR-negative pulmonary/intestinal epithelial cells or epithelial liver
cells shown to express the C5aR constitutively. To our surprise, we
could not observe any C5aR mRNA in the normal epidermis, whereas in
those specimens from inflammatory lesions (pyogenic granuloma and
lichen planus) keratinocytes as well as tissue-infiltrating M
revealed strong C5aR mRNA expression. This finding demonstrates that in
skin disorders, keratinocyte stimulation may not only modulate the
functions of migrating inflammatory cells via the production of
cytokines,19-20
but may also lead to the expression of
receptors, eg, for IL-821
and C5a, thereby rendering these
cells responsive to signals from the cutaneous microenviroment.
Heterogeneous Expression of C5aR mRNA in Tissue Macrophages
In the normal lung all small Ki-M1P-positive M localized in
subepithelial connective tissue of the bronchial mucous membrane and
within the alveolar walls revealed C5aR mRNA expression, whereas
receptor transcripts could not be detected in large Ki-M1P-positive
M localized within the alveolar airspace. This evidence suggests
that newly arrived M still express the C5aR, whereas older M,
which have transversed alveolar walls and entered into the alveolar
airspace, down-regulate their receptor expression. The same phenomenon
was observed in tissue samples of bronchopneumonia and pulmonary
tuberculosis, in which freshly immigrated small M found within the
bronchial wall or fibrous septa expressed C5aR transcripts, whereas
M localized within the airspace or present in granulomas did not
reveal any detectable C5aR expression. In line with these observations,
we did not observe C5aR expression in epithelioid/multinucleated M
found within granulomas in Crohn's disease. Considering the role of
C5aR as a chemoattractant receptor, these findings suggest that tissue
M cease to express C5aR when they stop migrating.
Co-expression of C5aR and IL-6 mRNA
Using a double staining method based on a combination of ISH and
indirect immunofluorescence on the same section, it could be
demonstrated that in biopsy specimens of normal tissues and also in
those of pathological disorders, all migrating but not resident M
express C5aR mRNA. However, technical reasons such as the denaturation
of CD68 after 60 cycles of PCR excluded the detection of CD68 and IL-6
mRNA on the same section. Because serial sections 5–10 µm apart from
each other were used, we found it difficult to locate unequivocally the
Ki-M1P- and the IL-6 mRNA-derived signals to the same cells in the
tissues examined. We estimate that 10 to 40% of the CD68 and C5aR
mRNA-positive infiltrating M coexpress IL-6 mRNA. This is in line
with recently published data showing that about 20% of Ki-M1P-positive
M in lymph nodes express IL-6 mRNA.17
Surprisingly, a
close correlation of C5aR and IL-6 mRNA expression was found in almost
all basal and suprabasal keratinocytes from pyogenic granuloma and
lichen planus, but not in keratinocytes from normal skin.
IL-6 is a cytokine with multiple growth and differentiation
activities,22
the expression of which has been
demonstrated in cultured monocytes and keratinocytes following
stimulation.23,24
Previously, Scholz et al25
showed that recombinant human C5a induces IL-6 production in monocytes.
Subsequently, Höpken et al26
reported that anti-C5a
monoclonal antibodies significantly lower peripheral blood IL-6
concentrations in pigs infused with E. coli. They concluded
that C5a plays a key role for the expression of IL-6 during the early
phase of acute inflammatory reactions. Our observation that in
situ, both C5aR and IL-6 are coexpressed in 10–40% of migrating
M and in almost all stimulated keratinocytes may be in line with the
regulatory role of C5a on IL-6 expression in cell types that express
the C5aR constitutively or upon stimulation.
Further studies will need to address the nature of the stimuli leading
to C5aR upregulation in keratinocytes, the relationship between the
pro-inflammatory mediators C5a and IL-6 in dermatoses, and the
mechanisms leading to down-regulation of C5aR in older M after their
migration into tissue lesions.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Supported by grants from the Stiftung der Universität Göttingen and the Deutsche Forschungsgemeinschaft, projects Go 410/7-2 and SFB 402-B5.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  I. J. Laudes, J. C. Chu, M. Huber-Lang, R.-F. Guo, N. C. Riedemann, J. V. Sarma, F. Mahdi, H. S. Murphy, C. Speyer, K. T. Lu, et al. Expression and Function of C5a Receptor in Mouse Microvascular Endothelial Cells J. Immunol., November 15, 2002; 169(10): 5962 - 5970. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. C. Riedemann, R.-F. Guo, V. J. Sarma, I. J. Laudes, M. Huber-Lang, R. L. Warner, E. A. Albrecht, C. L. Speyer, and P. A. Ward Expression and Function of the C5a Receptor in Rat Alveolar Epithelial Cells J. Immunol., February 15, 2002; 168(4): 1919 - 1925. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Drouin, J. Kildsgaard, J. Haviland, J. Zabner, H. P. Jia, P. B. McCray Jr., B. F. Tack, and R. A. Wetsel Expression of the Complement Anaphylatoxin C3a and C5a Receptors on Bronchial Epithelial and Smooth Muscle Cells in Models of Sepsis and Asthma J. Immunol., February 1, 2001; 166(3): 2025 - 2032. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. L. Schieferdecker, G. Schlaf, M. Koleva, O. Gotze, and K. Jungermann Induction of Functional Anaphylatoxin C5a Receptors on Hepatocytes by In Vivo Treatment of Rats with IL-6 J. Immunol., May 15, 2000; 164(10): 5453 - 5458. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
