| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Department of Pathology,*
Academic Medical
Center, University of Amsterdam, Amsterdam, the Department of Human
Genetics,
Leiden University Medical Center,
Leiden, and the Department of Immunology,
University Hospital, Utrecht, The Netherlands
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
CD44 is a family of cell-surface glycoproteins generated from a single gene by alternative splicing and differential glycosylation.12-15 Members of the CD44 family have been implicated in a number of important biological processes, including lymphocyte homing,12,16,17 hematopoiesis,18 and tumor progression and metastasis.14,19-26 In these processes, CD44 is believed to function as a cell adhesion receptor, linking extracellular matrix molecules, specifically hyaluronate, to the cell and the cytoskeleton.12,27-30 Furthermore, CD44 isoforms decorated with heparan sulfate side chains have been shown to bind growth factors and can promote growth factor receptor-mediated signaling.31-34 Studies from our own and other laboratories have shown that CD44 glycoproteins, which are normally expressed only in the lower crypt epithelium of the intestinal mucosa, are overexpressed in colorectal cancer and may play a role in the generation and turnover of epithelial cells.25,35-41 CD44 overexpression is an early event in the colorectal adenoma-carcinoma sequence,25,37 suggesting that CD44 expression is, directly or indirectly, regulated by ß-catenin/Tcf-4-mediated transcription. To explore the latter hypothesis, we analyzed CD44 expression in the normal and neoplastic intestinal mucosa of mice and humans with genetic defects in either APC or Tcf-4.
| Materials and Methods |
|---|
|
|
|---|
Normal and neoplastic small-intestinal tissue from C57BL/6JIco-Apc+/Apc1638N mice (Apc+/-) and wild-type C57BL/6 (Apc+/+) control mice was obtained from the Department of Human Genetics, University of Leiden, Leiden, The Netherlands. The Apc+/Apc1638N mice are heterozygous for an Apc chain-terminating mutation in Apc codon 1638, although the expected truncated protein is not detectable by conventional Western analysis.42 The mice were sacrificed between 6 and 12 month of age, after which the entire intestine was opened longitudinally and inspected for neoplastic lesions. Lesions with surrounding normal tissue were sampled for routine processing and fixed in formalin or Notox (Earth Safe Industries, Bellemead, NJ) and embedded in paraffin. Embryos of Tcf-4-/- and Tcf-4+/- mice43 were obtained from the Department of Immunology, University Hospital, Utrecht, The Netherlands, embedded in paraffin, and sectioned at 6 µm thickness.
FAP Patients
Colon mucosa biopsies from a 38-year-old male and a 30-year-old female FAP patient, taken at routine colonoscopy, were obtained from the files of the Department of Pathology, Academic Medical Center, University of Amsterdam. The biopsies were embedded in paraffin, and 6-µm sections were prepared.
Monoclonal Antibodies (MAbs)
The MAbs used were Hermes-3 against an epitope on the constant
part of the human CD44 molecule (CD44s),16
VFF18 against
human CD44v6,44
PGP-1 against mouse CD44s (Pharmingen, San
Diego, CA), 10D1 against mouse CD44v4,45
9A4 against mouse
CD44v6,45
and PCNA against proliferating cell nuclear
antigen (PCNA; Dako, Glostrup, Denmark) (Figure 1)
.
|
Detection of CD44 and PCNA in mouse and human paraffin-embedded tissue sections was performed as described previously,35 with the following modifications. In brief, the sections were deparaffinated, rehydrated, and boiled in a citrate buffer (0.01 mol/L, pH 6, Merck 6448) for antigen retrieval. On mouse and human tissue, biotinylated rabbit-anti-rat F(ab')2 (Dako) and rabbit-anti-mouse F(ab')2 (Dako) were used as secondary antibodies, respectively. For color development, 3,3-diaminobenzidine tetrachloride (DAB; Sigma, Bornem, Belgium) was used.
The immunohistochemical staining was scored semiquantitatively based on the staining intensity of positively stained tumor cells. The samples were scored as follows: -, negative; -/+, equivocal/very weak; +, weak; ++, moderate; +++, strong.
Reverse Transcription Polymerase Chain Reaction and Southern Blot Analysis
RNA isolation and first-strand cDNA synthesis were performed as described previously.46 Polymerase chain reaction (PCR) was performed with 1.5 U of Taq DNA polymerase (Gibco BRL/Life Technologies, Gaithersburg, MD), 300 µmol/L dNTPs (Pharmacia Biotech, Uppsala, Sweden), and 2 mmol/L MgCl2 in 1X PCR buffer (both Gibco BRL/Life Technologies). Primers used were M44CU (5'-CCCAGGTAGCTTCCTTAACCC-3') in combination with M44CD (5'-CGTAGAGAGGACCGTGACCGA-3'). PCR was started with a 5-minutes denaturation step at 95°C, after which amplification was performed at 35 cycles of denaturation at 95°C for 30 seconds, annealing at 55°C for 1 minute, and elongation at 72°C for 2 minutes. After a final elongation step for 10 minutes at 72°C, samples were cooled on ice. PCR products were resolved in 1.5% agarose/Tris-buffered ethanolamine gel and blotted on Hybond-N+ membranes (Amersham, Little Chalfont, UK).
To generate 32P-labeled exon-specific probes, we used the
plasmid pZeo SV mCD44v4-v10, containing the murine CD44 exon v4-v10 (a
kind gift from Dr. M. Hofmann from the Institut für Genetics,
Forschungszentrum, Karlsruhe, Germany). To generate a
32P-labeled exon-v3 probe, we used DNA from normal mouse
skin. For the generation of the CD44s probe we used the plasmid pZeo S
mCD44st, containing the murine CD44 standard region. The PCR mixtures
for the v3 and v9 exons contained 2 mmol/L MgCl2, 100
µmol/L dATP, dTTP, and dGTP, and 13.2 µmol/L dCTP. The mixtures for
the v6 exon contained 1 mmol/L MgCl2, 200 µmol/L
dATP, dTTP, and dGTP, and 26.4 µmol/L dCTP. The mixtures for
the standard region contained 2 mmol/L MgCl2, 300
µmol/L dATP, dTTP, and dGTP, and 39.6 µmol/L dCTP. In
addition, all PCR mixtures contained 0.22 MBq
[
-32P]dCTP, 10 pmol of each oligonucleotide primer,
and 1.5 U of Taq DNA polymerase. The primers used for v3
were MV3U (5' GTACGGAGTCAAATACCAAC3') and MV3D (5' TGGTACTGGAGATAAAATCT
3'), for v6 were MV6U (5' CTCCTAATAGTACAGCAGAA 3') and MV6D (5'
AGTTGTCCCTTCTGTCACAT 3'), and for v9 were MV9U (5' CACAGAGTCATTCTAGAAC
3') and MV9D (5' TGCTAGATGGCAGAATAGAA 3'). Samples were amplified for
35 cycles in a PTC-100 (MJ Research, Watertown, CA). Each cycle
consisted of denaturation at 95°C (for CD44s, v3, and v9) or at
96°C (for v6) for 30 seconds, annealing at 55°C (CD44s, v3, and v9)
or 50°C (V6) for 1 minute, and extension at 72°C for 2 minutes (for
CD44s, v3, and v9) or 1 minute (for V6), followed by a final elongation
step for 10 minutes at 72°C. The PCR products resulted in
32P-labeled exon-specific probes and were used to hybridize
the membranes according to standard procedures.
| Results |
|---|
|
|
|---|
CD44 expression in the epithelium of the histologically normal
small-intestinal mucosa of
Apc+/Apc1638N
(Apc+/-) mice and wild-type
(Apc+/+) mice was identical and was
restricted to the crypts (Figure 2A
;
Table 1
). In these crypt areas, CD44
expression was localized to the basolateral membranes of the cells.
Epitopes encoded by the constant (standard) part of the CD44 (CD44s)
and by the alternatively spliced exons CD44v4 and v6 were expressed in
a similar pattern. However, the intensity of staining differed; whereas
the MAbs against CD44s and CD44v6 stained with high intensity, staining
with the anti-CD44v4 MAb was weak (Table 1)
. In the lamina propria,
CD44s, but not CD44v4 or CD44v6 expression, was observed on stromal
cells, lymphocytes, and macrophages.
|
|
|
Previous studies in human colorectal cancer have shown that CD44
overexpression is present in adenomas as well as in invasive
carcinomas.25,35,37
Based on our present observations in
Apc-mutant mice, we explored whether dysplastic ACFs in
familial adenomatous polyposis (FAP) patients also overexpress CD44.
Indeed, a strong up-regulation of CD44, including both CD44s- and
CD44v6-encoded epitopes, was observed in ACFs (Figure 4, B and D
; Table 1
). Hence, as in
Apc+/- mice, in FAP patients, deregulation of
CD44 expression is present in the earliest detectable neoplastic
lesions of colorectal cancer.
|
The above data imply an intimate link between loss of Apc tumor
suppressor-protein function and CD44 overexpression in the intestinal
mucosa and suggest that CD44 expression is directly or indirectly
controlled by ß-catenin/Tcf-4 mediated transcription. To further
explore this hypothesis, we studied the expression of CD44 in the
intestinal mucosa of Tcf-4-/- mice. These mice
have a striking small-intestinal phenotype with a selective loss of
cycling intestinal crypt cells. As a result of tearing of the
intestinal epithelial lining and fluid imbalance, this leads to
perinatal death.43
In Figure 5
, this absence of cycling cells is
illustrated by using the proliferation marker PCNA; at day E18,
numerous proliferating cells were present in the intervillous
epithelium of (Tcf-4+/+ and
Tcf-4+/-) control mouse embryos (Figure 5A
;
Table 1
). By contrast, the epithelium of the small intestine of the
Tcf-4-/- embryos was devoid of proliferating
cells (Figure 5B)
. Proliferation of cells in the lamina propria
directly underneath the epithelium as well as in other organs (not
shown) was not affected by the Tcf-4 disruption. In the
(Tcf-4+/+ and
Tcf-4+/-) control mice, CD44s (not shown) as
well as CD44v6 expression (Figure 5C
; Table 1
) was readily
detectable at the basolateral surfaces of the pseudostratified
intervillous epithelium. In sharp contrast, the intestinal epithelium
of Tcf-4-/- mice did not show any CD44
staining (Figure 5D)
. This lack of CD44 expression was specific for the
epithelium of the small intestine, as Tcf-4-/-
and control mice showed identical expression of both CD44s and CD44v6
in all other tissues, including the lamina propria of the small and
large intestine, the epithelia of the large intestine, stomach, and
epidermis and in lymphoid organs (not shown).
|
| Discussion |
|---|
|
|
|---|
Previous studies have shown that CD44 is overexpressed in human
colorectal tumors.24,25,35-40
This aberrant expression of
CD44 occurs at an early point along the adenoma-carcinoma sequence;
CD44 overexpression was already observed in small (<1 cm)
adenomas,25,37
suggesting a possible causal relation with
loss of function of the APC tumor suppressor protein. Our present
study, for the first time, demonstrates that CD44 is also overexpressed
in intestinal tumors arising in Apc-mutant mice (Figures 2 and 3
; Table 1
). As in human colorectal cancer, this overexpression was
present in adenomas as well as in invasive carcinomas and was
accompanied by a deregulated splicing leading to a preferential
overexpression of large CD44 isoforms containing variant exon sequences
(Figure 3)
. Importantly, in both mice and humans, loss of APC function
and deregulation of CD44 were closely linked, as CD44 overexpression
was already present in the earliest detectable neoplastic lesions, ie,
in ACFs with dysplasia (Figures 2 and 4
; Table 1
). In humans, these
lesions contain APC but not K-ras
mutations.47
Similarly, the tumors of the
Apc-mutant mice used in our current studies showed loss of
the wild-type copy of the Apc gene but neither K-, N-,
H-ras, nor Tp53 mutations.48
The precise
mechanism by which the Wnt pathway regulates CD44 expression needs
further exploration. ß-catenin/Tcf-4 might directly interact with
promoter/enhancer regions regulating CD44 transcription or,
alternatively, involve intermediates, eg, c-Myc, a recently identified
Tcf-4 target gene.49
We observed that Tcf-4 knockout mice lack CD44 expression on
the epithelium of the small intestine (Figure 5)
. This loss of CD44
occurred in the context of a phenotype characterized by the absence of
a proliferative stem cell compartment in the crypt regions between the
villi (Figure 5)
. As a consequence, the epithelium was composed
entirely of nondividing cells that lack CD44. Although
CD44+ and cycling (PCNA+) cells co-localize at
the base of normal crypts, they represent overlapping but distinct cell
compartments, indicating that CD44 expression is not directly linked to
proliferation.50
The TCF-4 -/- phenotype, including the
loss of CD44, was unique for the small intestine; the crypt epithelium
in other parts of the intestine was not affected by the mutation
presumably as a result of redundancy with another member of the
Tcf family that is expressed in the gut, albeit at lower
levels, ie, Tcf-3.43
The observations in
Tcf-4 mutant mice indicate that the genetic program
controlled by Tcf-4 establishes the crypt stem cell compartment of the
small intestine and suggest that CD44 expression is part of this
program. According to this interpretation, overexpression of CD44, as
present in colorectal cancer, reflects the persistence of stem cell
characteristics by the tumor cells. Indeed, it has been proposed that
tumorigenesis in Min-mice is initiated in the multipotent
stem cell compartment in the intestinal crypt.51
Overexpression of CD44 glycoproteins in invasive human colorectal carcinomas is associated with the presence of (occult) metastases and with an unfavorable prognosis.36,38,39,41 Although the mechanism(s) by which CD44 promotes colorectal tumorigenesis have not yet been defined, the following routes could be involved. First, CD44 is the principle cell-surface receptor for hyaluronan (HA), a ubiquitous glycosaminoglycan (GAG) component of the extracellular and pericellular matrices.12,28 Interaction between CD44 and HA has been proposed to promote cell motility and, in some systems, enhances tumor growth and metastasis.12,52 Second, in a recent study by Yu and colleagues, disruption of CD44 in metastatic mammary carcinoma cells was found to induce apoptosis, implying a role for CD44 in the regulation of programmed cell death.53 CD44 overexpression may counteract apoptosis, leading to enhanced tumor growth and metastasis. Third, CD44 splice variants carrying exon v3 are decorated with heparan sulfate side chains and hence are heparan sulfate proteoglycans (HSPGs).31 HSPGs are believed to play an important regulatory role in cell growth and motility by binding growth factors and by presenting these factors to their high-affinity receptors.54,55 Indeed, CD44-HSPG has been shown to bind fibroblast growth factor (FGF)-2,32 heparin-binding epidermal growth factor,32 and hepatocyte growth factor/scatter factor (HGF/SF).33 The latter interaction is of great potential interest, as HGF/SF functions as a growth and motility factor and promotes metastasis.56-58 We recently demonstrated that binding of HGF/SF to CD44-HSPG strongly enhances signaling through the c-Met receptor tyrosine kinase,33 the high-affinity receptor for HGF/SF. This collaboration between CD44-HSPG and c-Met might be an important factor in tumorigenesis. By overexpressing CD44-HSPG tumor cells would acquire an increased sensitivity to HGF/SF-mediated signals, leading to a growth advantage and promoting metastasis. This scenario is supported by the fact that c-Met and HGF/SF are overexpressed in conjunction with CD44 in several tumors, including colorectal cancer.59-61 Except for binding of HGF/SF, crypt epithelial cells and tumor cells may also use CD44-HSPG to gather and present other heparin-binding growth factors. Interesting candidates are the ligands of the Wnt-Wingless pathway themselves, ie, the Wnt-like growth factors. In studies by Reichsman and co-workers, Wingless signaling was shown to be inhibited by removal of GAGs from cells,62 and recent studies by Binari et al63 and Haerry et al64 have provided genetic evidence for a role of heparan sulfate in wingless signaling. It is tempting to speculate that binding of mesenchymally derived growth factors, including HGF/SF and WNT factors, to CD44 might contribute to the conversion of embryonic intestinal cells into crypt stem cells, which takes place during intestinal morphogenesis.65,66
In conclusion, our data imply that CD44 expression in normal and malignant intestinal epithelium is regulated by the WNT pathway and suggest that CD44 expression is part of a genetic program controlled by the ß-catenin/Tcf-4 signaling pathway and plays a role in the generation and turnover of epithelial cells.
| Acknowledgements |
|---|
| Footnotes |
|---|
Supported by grants from the Praeventiefonds (project 282575), the Dutch Cancer Society (project UVA 981712 and RUL 94817), and the NWO (project 90101-166).
Accepted for publication November 5, 1998.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. Lukas, P. Mazna, T. Valenta, L. Doubravska, V. Pospichalova, M. Vojtechova, B. Fafilek, R. Ivanek, J. Plachy, J. Novak, et al. Dazap2 modulates transcription driven by the Wnt effector TCF-4 Nucleic Acids Res., May 1, 2009; 37(9): 3007 - 3020. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Takaishi, T. Okumura, S. Tu, S. S.W. Wang, W. Shibata, R. Vigneshwaran, S. A.K. Gordon, Y. Shimada, and T. C. Wang Identification of Gastric Cancer Stem Cells Using the Cell Surface Marker CD44 Stem Cells, May 1, 2009; 27(5): 1006 - 1020. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Alves, S. Yakovlev, L. Medved, and K. Konstantopoulos Biomolecular Characterization of CD44-Fibrin(ogen) Binding: DISTINCT MOLECULAR REQUIREMENTS MEDIATE BINDING OF STANDARD AND VARIANT ISOFORMS OF CD44 TO IMMOBILIZED FIBRIN(OGEN) J. Biol. Chem., January 9, 2009; 284(2): 1177 - 1189. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. R. Reed, D. Athineos, V. S. Meniel, J. A. Wilkins, R. A. Ridgway, Z. D. Burke, V. Muncan, A. R. Clarke, and O. J. Sansom B-catenin deficiency, but not Myc deletion, suppresses the immediate phenotypes of APC loss in the liver PNAS, December 2, 2008; 105(48): 18919 - 18923. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Goncalves, P. Matos, and P. Jordan The {beta}-catenin/TCF4 pathway modifies alternative splicing through modulation of SRp20 expression RNA, December 1, 2008; 14(12): 2538 - 2549. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Prasad, V. Paruchuri, A. Preet, F. Latif, and R. K. Ganju Slit-2 Induces a Tumor-suppressive Effect by Regulating {beta}-Catenin in Breast Cancer Cells J. Biol. Chem., September 26, 2008; 283(39): 26624 - 26633. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. W.J. Groen, M. E.C.M. Oud, E. J.M. Schilder-Tol, M. B. Overdijk, D. ten Berge, R. Nusse, M. Spaargaren, and S. T. Pals Illegitimate WNT Pathway Activation by {beta}-Catenin Mutation or Autocrine Stimulation in T-Cell Malignancies Cancer Res., September 1, 2008; 68(17): 6969 - 6977. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. A. Wilkins and O. J. Sansom C-Myc Is a Critical Mediator of the Phenotypes of Apc Loss in the Intestine Cancer Res., July 1, 2008; 68(13): 4963 - 4966. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. M. Boman and E. Huang Human Colon Cancer Stem Cells: A New Paradigm in Gastrointestinal Oncology J. Clin. Oncol., June 10, 2008; 26(17): 2828 - 2838. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zeilstra, S. P.J. Joosten, M. Dokter, E. Verwiel, M. Spaargaren, and S. T. Pals Deletion of the WNT Target and Cancer Stem Cell Marker CD44 in Apc(Min/+) Mice Attenuates Intestinal Tumorigenesis Cancer Res., May 15, 2008; 68(10): 3655 - 3661. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gaspar, J. Cardoso, P. Franken, L. Molenaar, H. Morreau, G. Moslein, J. Sampson, J. M. Boer, R. X. de Menezes, and R. Fodde Cross-Species Comparison of Human and Mouse Intestinal Polyps Reveals Conserved Mechanisms in Adenomatous Polyposis Coli (APC)-Driven Tumorigenesis Am. J. Pathol., May 1, 2008; 172(5): 1363 - 1380. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. B. Pearson, A. McCarthy, C. M.P. Collins, A. Ashworth, and A. R. Clarke Lkb1 Deficiency Causes Prostate Neoplasia in the Mouse Cancer Res., April 1, 2008; 68(7): 2223 - 2232. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Alves, M. M. Burdick, S. N. Thomas, P. Pawar, and K. Konstantopoulos The dual role of CD44 as a functional P-selectin ligand and fibrin receptor in colon carcinoma cell adhesion Am J Physiol Cell Physiol, April 1, 2008; 294(4): C907 - C916. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-T. Xu, Q. Wei, Y. Liu, L.-H. Yang, S.-D. Dai, Y. Han, J.-H. Yu, N. Liu, and E.-H. Wang Overexpression of Axin Downregulates TCF-4 and Inhibits the Development of Lung Cancer Ann. Surg. Oncol., November 1, 2007; 14(11): 3251 - 3259. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Saaf, J. M. Halbleib, X. Chen, S. T. Yuen, S. Y. Leung, W. J. Nelson, and P. O. Brown Parallels between Global Transcriptional Programs of Polarizing Caco-2 Intestinal Epithelial Cells In Vitro and Gene Expression Programs in Normal Colon and Colon Cancer Mol. Biol. Cell, November 1, 2007; 18(11): 4245 - 4260. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Gavert, M. Sheffer, S. Raveh, S. Spaderna, M. Shtutman, T. Brabletz, F. Barany, P. Paty, D. Notterman, E. Domany, et al. Expression of L1-CAM and ADAM10 in Human Colon Cancer Cells Induces Metastasis Cancer Res., August 15, 2007; 67(16): 7703 - 7712. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Dalerba, S. J. Dylla, I.-K. Park, R. Liu, X. Wang, R. W. Cho, T. Hoey, A. Gurney, E. H. Huang, D. M. Simeone, et al. Phenotypic characterization of human colorectal cancer stem cells PNAS, June 12, 2007; 104(24): 10158 - 10163. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Yu and J. M. Sen beta-Catenin Regulates Positive Selection of Thymocytes but Not Lineage Commitment J. Immunol., April 15, 2007; 178(8): 5028 - 5034. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.L. Dunn, E.O. Sekyere, Y. Suryo Rahmanto, and D.R. Richardson The function of melanotransferrin: a role in melanoma cell proliferation and tumorigenesis Carcinogenesis, November 1, 2006; 27(11): 2157 - 2169. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R.H. de Bruijn, S. V. Allander, A. H.A. van Dijk, M. P. Willemse, J. Thijssen, J. J.M. van Groningen, P. S. Meltzer, and A. Geurts van Kessel The Synovial Sarcoma-Associated SS18-SSX2 Fusion Protein Induces Epigenetic Gene (De)Regulation Cancer Res., October 1, 2006; 66(19): 9474 - 9482. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Kim, H. Koo, S. Yang, S. Bang, Y. Jung, Y. Kim, J. Kim, J. Park, R. T. Moon, K. Song, et al. TC1(C8orf4) Correlates with Wnt/{beta}-Catenin Target Genes and Aggressive Biological Behavior in Gastric Cancer. Clin. Cancer Res., June 1, 2006; 12(11): 3541 - 3548. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Lowy, W. M. Clements, J. Bishop, L. Kong, T. Bonney, K. Sisco, B. Aronow, C. Fenoglio-Preiser, and J. Groden {beta}-Catenin/Wnt Signaling Regulates Expression of the Membrane Type 3 Matrix Metalloproteinase in Gastric Cancer. Cancer Res., May 1, 2006; 66(9): 4734 - 4741. [Abstract] [Full Text] [PDF] |
||||
![]() |
K A Voutilainen, M A Anttila, S M Sillanpaa, K M Ropponen, S V Saarikoski, M T Juhola, and V-M Kosma Prognostic significance of E-cadherin-catenin complex in epithelial ovarian cancer J. Clin. Pathol., May 1, 2006; 59(5): 460 - 467. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chen, C. S. Park, and S.-J. Tang Activity-dependent Synaptic Wnt Release Regulates Hippocampal Long Term Potentiation J. Biol. Chem., April 28, 2006; 281(17): 11910 - 11916. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Qi, J. Wang, O. Romanyuk, and C.-H. Siu Involvement of Src Family Kinases in N-Cadherin Phosphorylation and beta-Catenin Dissociation during Transendothelial Migration of Melanoma Cells Mol. Biol. Cell, March 1, 2006; 17(3): 1261 - 1272. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Jung, S. Bang, K. Choi, E. Kim, Y. Kim, J. Kim, J. Park, H. Koo, R. T. Moon, K. Song, et al. TC1 (C8orf4) Enhances the Wnt/{beta}-Catenin Pathway by Relieving Antagonistic Activity of Chibby Cancer Res., January 15, 2006; 66(2): 723 - 728. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Singh, J. N. Artaza, W. E. Taylor, M. Braga, X. Yuan, N. F. Gonzalez-Cadavid, and S. Bhasin Testosterone Inhibits Adipogenic Differentiation in 3T3-L1 Cells: Nuclear Translocation of Androgen Receptor Complex with {beta}-Catenin and T-Cell Factor 4 May Bypass Canonical Wnt Signaling to Down-Regulate Adipogenic Transcription Factors Endocrinology, January 1, 2006; 147(1): 141 - 154. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Qi, N. Chen, J. Wang, and C.-H. Siu Transendothelial Migration of Melanoma Cells Involves N-Cadherin-mediated Adhesion and Activation of the {beta}-Catenin Signaling Pathway Mol. Biol. Cell, September 1, 2005; 16(9): 4386 - 4397. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Gavert, M. Conacci-Sorrell, D. Gast, A. Schneider, P. Altevogt, T. Brabletz, and A. Ben-Ze'ev L1, a novel target of {beta}-catenin signaling, transforms cells and is expressed at the invasive front of colon cancers J. Cell Biol., February 14, 2005; 168(4): 633 - 642. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. B. Madison, K. Braunstein, E. Kuizon, K. Portman, X. T. Qiao, and D. L. Gumucio Epithelial hedgehog signals pattern the intestinal crypt-villus axis Development, January 15, 2005; 132(2): 279 - 289. [Abstract] [Full Text] [PDF] |
||||
![]() |
M Brittan and N A Wright STEM CELL IN GASTROINTESTINAL STRUCTURE AND NEOPLASTIC DEVELOPMENT Gut, June 1, 2004; 53(6): 899 - 910. [Full Text] [PDF] |
||||
![]() |
P. W. B. Derksen, E. Tjin, H. P. Meijer, M. D. Klok, H. D. Mac Gillavry, M. H. J. van Oers, H. M. Lokhorst, A. C. Bloem, H. Clevers, R. Nusse, et al. Illegitimate WNT signaling promotes proliferation of multiple myeloma cells PNAS, April 20, 2004; 101(16): 6122 - 6127. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-P. G. Haramis, H. Begthel, M. van den Born, J. van Es, S. Jonkheer, G. J. A. Offerhaus, and H. Clevers De Novo Crypt Formation and Juvenile Polyposis on BMP Inhibition in Mouse Intestine Science, March 12, 2004; 303(5664): 1684 - 1686. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Kuhnert, C. R. Davis, H.-T. Wang, P. Chu, M. Lee, J. Yuan, R. Nusse, and C. J. Kuo Essential requirement for Wnt signaling in proliferation of adult small intestine and colon revealed by adenoviral expression of Dickkopf-1 PNAS, January 6, 2004; 101(1): 266 - 271. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Conacci-Sorrell, I. Simcha, T. Ben-Yedidia, J. Blechman, P. Savagner, and A. Ben-Ze'ev Autoregulation of E-cadherin expression by cadherin-cadherin interactions: the roles of {beta}-catenin signaling, Slug, and MAPK J. Cell Biol., November 24, 2003; 163(4): 847 - 857. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Nawrocki-Raby, C. Gilles, M. Polette, C. Martinella-Catusse, N. Bonnet, E. Puchelle, J.-M. Foidart, F. van Roy, and P. Birembaut E-Cadherin Mediates MMP Down-Regulation in Highly Invasive Bronchial Tumor Cells Am. J. Pathol., August 1, 2003; 163(2): 653 - 661. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Schwartz, R. Wu, S. L. R. Kardia, A. M. Levin, C.-C. Huang, K. A. Shedden, R. Kuick, D. E. Misek, S. M. Hanash, J. M. G. Taylor, et al. Novel Candidate Targets of {beta}-Catenin/T-cell Factor Signaling Identified by Gene Expression Profiling of Ovarian Endometrioid Adenocarcinomas Cancer Res., June 1, 2003; 63(11): 2913 - 2922. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Gilles, M. Polette, M. Mestdagt, B. Nawrocki-Raby, P. Ruggeri, P. Birembaut, and J.-M. Foidart Transactivation of Vimentin by {beta}-Catenin in Human Breast Cancer Cells Cancer Res., May 15, 2003; 63(10): 2658 - 2664. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. B. Tepera, P. D. McCrea, and J. M. Rosen A {beta}-catenin survival signal is required for normal lobular development in the mammary gland J. Cell Sci., March 15, 2003; 116(6): 1137 - 1149. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Xu and Q. Yu E-cadherin Negatively Regulates CD44-Hyaluronan Interaction and CD44-mediated Tumor Invasion and Branching Morphogenesis J. Biol. Chem., February 28, 2003; 278(10): 8661 - 8668. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Campbell and M. Szyf Human DNA methyltransferase gene DNMT1 is regulated by the APC pathway Carcinogenesis, January 1, 2003; 24(1): 17 - 24. [Abstract] [Full Text] [PDF] |
||||
![]() |
J R Jass, M Barker, L Fraser, M D Walsh, V L J Whitehall, B Gabrielli, J Young, and B A Leggett APC mutation and tumour budding in colorectal cancer J. Clin. Pathol., January 1, 2003; 56(1): 69 - 73. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. J. Boon, R. van der Neut, M. van de Wetering, H. Clevers, and S. T. Pals Wnt Signaling Regulates Expression of the Receptor Tyrosine Kinase Met in Colorectal Cancer Cancer Res., September 15, 2002; 62(18): 5126 - 5128. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. F. Weber, R. T. Bronson, J. Ilagan, H. Cantor, R. Schmits, and T. W. Mak Absence of the CD44 Gene Prevents Sarcoma Metastasis Cancer Res., April 1, 2002; 62(8): 2281 - 2286. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. C. S. Wong and M. Pignatelli {beta}-Catenin--A Linchpin in Colorectal Carcinogenesis? Am. J. Pathol., February 1, 2002; 160(2): 389 - 401. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Zhang, T. Otevrel, Z. Gao, Z. Gao, S. M. Ehrlich, J. Z. Fields, and B. M. Boman Evidence That APC Regulates Survivin Expression: A Possible Mechanism Contributing to the Stem Cell Origin of Colon Cancer Cancer Res., December 1, 2001; 61(24): 8664 - 8667. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Hlubek, A. Jung, N. Kotzor, T. Kirchner, and T. Brabletz Expression of the Invasion Factor Laminin {gamma}2 in Colorectal Carcinomas Is Regulated by {beta}-Catenin Cancer Res., November 1, 2001; 61(22): 8089 - 8093. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Brabletz, A. Jung, S. Reu, M. Porzner, F. Hlubek, L. A. Kunz-Schughart, R. Knuechel, and T. Kirchner Variable beta -catenin expression in colorectal cancers indicates tumor progression driven by the tumor environment PNAS, August 28, 2001; 98(18): 10356 - 10361. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. J. M. Wielenga, R. van der Voort, T. E. I. Taher, L. Smit, E. A. Beuling, C. van Krimpen, M. Spaargaren, and S. T. Pals Expression of c-Met and Heparan-Sulfate Proteoglycan Forms of CD44 in Colorectal Cancer Am. J. Pathol., November 1, 2000; 157(5): 1563 - 1573. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Brabletz, K. Herrmann, A. Jung, G. Faller, and T. Kirchner Expression of Nuclear {beta}-Catenin and c-myc Is Correlated with Tumor Size but Not with Proliferative Activity of Colorectal Adenomas Am. J. Pathol., March 1, 2000; 156(3): 865 - 870. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. G. Palmer, J. M. Gonzalez-Sancho, J. Espada, M. T. Berciano, I. Puig, J. Baulida, M. Quintanilla, A. Cano, A. G. de Herreros, M. Lafarga, et al. Vitamin D3 promotes the differentiation of colon carcinoma cells by the induction of E-cadherin and the inhibition of {beta}-catenin signaling J. Cell Biol., July 23, 2001; 154(2): 369 - 388. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |