| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Laboratoire d'Endocrinologie de la
Reproduction*
and Unité de Recherche en
Génétique Humaine et
Moléculaire,
Centre de Recherche,
Pavillon Saint-François d'Assise, Centre Hospitalier
Universitaire de Québec, Université Laval,
Québec, Canada
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The biological properties of ectopic endometrial cells have been poorly investigated, mainly due to the rare availability of endometriotic tissue required for cell culture and the limited number of cells, particularly those of epithelial type, that could be isolated from the tissue.
In this report, we describe the development of a human endometriotic cell line that was immortalized by the simian virus (SV)40. The cell line has a polyploid karyotype, is of epithelial-like nature, and was maintained in culture for over 80 passages without any sign of senescence. All immortalized cells express T-antigen as seen by indirect immunofluorescence staining and contain SV40 DNA in an episomal form. They also express receptors for ovarian steroids, retain differentiated functions, and respond to these latter and to the pro-inflammatory cytokine IL-1ß by secreting MCP-1 in a manner comparable to that of primary endometriotic epithelial cells.
| Materials and Methods |
|---|
|
|
|---|
Tissue specimens used in this study were obtained from three women
with endometriosis who had given informed consent before laparoscopy.
Two women had revised American Fertility Society (rAFS) stage II and
one had stage III endometriosis. Age, cycle phase (determined according
to the regularity of the cycle and the date of the previous menses),
infertility, pain, stage of endometriosis, and location of
endometriotic tissue were the main clinical characteristics listed in
Table 1
. Ovarian endometrioma cyst lining
and endometriotic foci were placed at 4°C in sterile Hanks' balanced
salt solution (HBSS) containing 100 U/ml penicillin, 100 µg/ml
streptomycin, and 0.25 µg/ml amphotericin and were transported to the
laboratory.
|
Endometriotic tissue was minced into small pieces and treated with collagenase to dissociate epithelial glands from fibroblast-like cells, which were further separated by differential sedimentation and adhesion as previously described.11 The purity of epithelial cells was assessed morphologically by light microscopy and immunocytochemically with specific monoclonal antibodies to cytokeratins as described below. Cells in primary cultures were propagated and maintained in Dulbecco's modified Eagle's medium (DMEM)-F12 medium containing antibiotics and 10% fetal bovine serum (FBS).
Establishment of SV40-Immortalized Cell Lines
Primary cultures of endometriotic epithelial cells isolated from
patient 1 (Table 1)
and grown in a 16-mm-diameter well (24-well plate;
Costar Corp., Bedford, MA) were infected with SV40 wild-type strain
(SV40 wt 776) at an input multiplicity of 25 to 50 plaque-forming units
(PFU) per cell as used for infection of nonpermissive mouse
cells14
and maintained without FBS for 48 hours.
Thereafter, cultures were passaged at a split ratio of 1:5, subcultures
were maintained for 6 weeks in DMEM-F12 containing 10% FBS, and the
medium was changed at 3-day intervals. Surviving cells from individual
foci were cloned by limiting dilution in microtiter wells. Each clonal
stock was then passaged through at least two single-cell isolation
procedures, and cells were grown into continuous cell lines after being
passaged with a 1:5 split ratio. Finally, six cell lines were retained,
and only one, called clone 3 (Clo03), has been selected for the present
investigation.
Southern Blot Analysis
High-molecular-weight DNA was isolated from SV40-immortalized
endometrial cells after purification of nuclei in the presence of 0.5%
Nonidet P-40 followed by digestion with 20 mg/ml proteinase K in the
presence of 1% SDS according to the method of Gross-Bellard et
al.15
To isolate episomal SV40 DNA, purified nuclei were
resuspended in an isotonic buffer composed of 20 mmol/L Tris/HCl, pH
7.4, 136 mmol/L NaCl, 5 mmol/L KCl, and 1 mmol/L
Na2HPO4, and viral DNA was extracted after
vigorous homogenization with a Dounce homogenizer using 30 to 40
strokes followed by elimination of nuclei after centrifugation at low
speed.16
The supernatant containing the viral DNA was then
digested with proteinase K, phenol extracted, and precipitated with 2
vol of ethanol at -20°C for 18 hours. Approximately 10 µg of DNA
was digested overnight at 37°C with the appropriate restriction
enzyme following the manufacturer's recommendations (New England
BioLabs, Beverly, MA). Restriction products were resolved by
electrophoresis through 0.8% agarose gels in TAE (40 mmol/L Tris/HCl,
pH 7.9, 20 mmol/L sodium acetate, 10 mmol/L EDTA) buffer, and the DNA
fragments were transferred onto Qiabrane positively charged Nylon Plus
membranes (Qiagen, Mississauga, Ontario, Canada) by vacuum blotting and
fixed to the membrane by ultraviolet irradiation.17
Hybridization was performed using SV40 DNA extracted from virions and
purified by CsCl/ethidium bromide gradient and labeled to high specific
activity with [
32P]dCTP using the
T7QuickPrime kit (Pharmacia Biotech, Piscataway, NJ) in the
conditions described previously,17
and the membranes were
exposed to Kodak X-OMAT AR films (Eastman Kodak Co., Rochester, NY) in
the presence of an intensifying screen at -70°C.
Analysis of the SV40 Replication Origin (Ori) Sequence
Ori was amplified by the polymerase chain reaction (PCR) using DNA extracted from the immortalized endometriotic cells and from purified SV40 DNA. Either 500 ng of cell DNA or 200 ng of SV40 DNA was used as template for amplification in a final volume of 100 µl containing 2 mmol/L MgCl2, 5 U of Taq polymerase, 0.2 mmol/L dNTPs, and 100 nmol/L of each primer (5'AAATACCTCAGTTGCATCCCAGAAGCCTCC3' and 5'AATGTGTGTCAGTTAGGGTGTGGAAAGTCC3'; amplimer size, 538 bp). DNA was first denatured for 3 minutes at 98°C, and amplification carried out for 35 cycles of 2 minutes annealing at 58°C, 3 minutes extension at 74°C, and 1 minute denaturation at 98°C followed by a final extension of 10 minutes at 74°C. PCR products were analyzed by agarose gel electrophoresis and detected after ethidium bromide staining. The generated fragments were purified using the QIAquick gel extraction kit (Qiagen) and sequenced using an automated sequencer (373 DNA Sequencer Stretch with 8XL upgrade, Applied Biosystems, Perkin Elmer, Foster City, CA) and BigDye Terminator Cycle Sequencing Ready Reaction kit (Applied Biosystems, Perkin Elmer).
Immunofluorescence Analyses
Cells grown on coverslips were fixed in a mixture of acetone, methanol and formaldehyde (19:19:2 v/v) for 10 minutes at -20°C and exposed to the first antibody for 1 hour at room temperature. Antigen-antibody complexes were revealed by incubation for 1 hour at room temperature with fluorescein isothiocyanate (FITC)-conjugated goat anti-mouse immunoglobulins (1/50 dilution in PBS). SV40 large T-antigen expression in immortalized endometriotic cells was detected using mouse monoclonal antibodies PAb 414 or 419.18 The phenotype of immortalized cells was examined using mouse monoclonal antibodies specific to cytokeratins (AE1:AE3 Mix, ICN Biomedicals, St.-Laurent, Quebec, Canada), vimentin (Sigma), and a 200-kd glycoprotein expressed by endometrial/endometriotic epithelial cells19 (BMA 180 mAb, also known as BW 495/36, a gift from Dr. Peter Gronski, Centeon Pharma, Marburg, Germany). In each series of analysis, specimens incubated without the primary antibody were included as controls. Samples were mounted in Mowiol-0.1% p-phenylenediamine and observed with a Leica microscope (Leica Mikroskopie und Systeme, Wetzlar, Germany) equipped for epifluorescence illumination.
Western Blot Analysis
Total proteins were extracted in SDS sample buffer (68 mmol/L Tris/HCl, pH 9.0, 2% ß-mercaptoethanol, 0.01% bromophenol blue, and 15% glycerol) and heat denatured in a boiling bath for 3 minutes. Proteins were separated by SDS-polyacrylamide gel electrophoresis (PAGE) in 7.5% to 15% acrylamide linear gradient slab gels and then electrotransferred onto 0.45-µm nitrocellulose membranes. T-antigen was detected using monoclonal antibodies PAb 414 or 419 followed by horseradish-peroxidase-conjugated sheep anti-mouse immunoglobulins (Amersham Canada, Ockville, Ontario, Canada), and the immunocomplexes were revealed by chemiluminescence (RPN 2109, Amersham) as previously described.20 Membranes were exposed to Kodak XAR films for 1 to 3 minutes.
Chromosome Analysis
Cells at the exponential phase of growth were arrested by adding 0.03 µg/ml colchicine for 2 to 4 hours and treated with 10 µg/ml ethidium bromide to prevent chromosome condensation and to increase banding resolution.21 Cells were then harvested, treated with a hypotonic solution (75 mmol/L KCl) at pH 8.0 for 20 minutes at 37°C, and fixed three times in cold Carnoy's fixative (3 vol of methanol/1 vol of acetic acid) for 15 minutes.22 For cells at culture passage 13, chromosomes of 113 mitoses were counted after GTG banding (G-bands by Trypsin using Giemsa),22 and 30 metaphases were photographed and analyzed. For passage 78, chromosomes of 55 metaphases were counted.
Molecular Cytogenetics
The following probes were used: digoxigenin-labeled coatasome 6, 11, and 19 total chromosome probes (Oncor, Gaithersburg, MD). The slides containing chromosome spreads were soaked in 2X SSC (0.15 mol/L sodium chloride, 0.015 mol/L sodium citrate) pH 7, at 37°C for 1 hour and dehydrated in a 70%/80%/100% ethanol series. Just before hybridization the chromosome preparation was denatured in 70% (v/v) formamide/2X SSC, pH 7, for 90 seconds at 70°C and then dehydrated in ethanol at 4°C. The hybridization mixture (total volume of 10 µl containing the specific probe) was then denatured at 70°C for 10 minutes and incubated for 2 hours at 37°C before being incubated overnight in a humidified chamber at 37°C with the chromosome preparation. Slides were then washed at 43°C with 50% formamide/2X SSC for 10 minutes then with 2X SSC for 10 minutes and finally twice in PBD (Oncor) for 5 minutes at room temperature. Sites of hybridization were visualized by indirect immunofluorescence. First, 100 µl of a 1:50 dilution of mouse monoclonal anti-digoxigenin antibody (Boehringer Mannheim, Laval, Quebec, Canada) for coatasome detection was added, followed by incubation in a humidified chamber at 37°C for 45 minutes. Slides were washed twice for 5 minutes in PBD at room temperature. A second incubation was carried out for 30 minutes at 37°C with 100 µl of a 1:50 dilution of digoxigenin-conjugated sheep anti-mouse IgG (Boehringer Mannheim) and biotin-conjugated goat anti-rabbit IgG (Vector Laboratories, Burlingame, CA), followed by two washes. Slides were then incubated for 30 minutes at 37°C with 100 µl of a 1:100 dilution of sheep anti-digoxigenin-rhodamine Fab fragments (Boehringer Mannheim) and streptavidin-FITC (Gibco BRL, Burlington, Ontario, Canada), followed by two washes. The slides were then stained with 125 ng/ml 4,6-diamino-2-phenylindole (DAPI) II (Vysis, Downers Grove, IL) for 5 minutes at room temperature. All pictures were taken with an Olympus BX60 microscope equipped with an image analysis system using a black and white digital camera (IMAC-CCD 930) coupled with the in situ imaging system (ISIS 2) software version 2.5 (Metasystems, Belmont, MA). Separate filter sets were used to view hybridization signals of chromosomes, and the images were merged using the image analysis system.
Estimation of Doubling Time
Cells were seeded at an initial concentration of 15 x 103 cells/cm2 in six-well multiplates and cultured in DMEM-F12 medium supplemented with 10% FBS, 10 µg/ml insulin, and 5 µg/ml transferrin. The culture medium was refreshed 2 hours after plating (to discard non-adhering cells) and every 48 hours. Cells were dissociated with trypsin/EDTA and counted in triplicate, first after the 2-hour adhesion (t = 0) and then at different time intervals for a total of 168 hours.
Culture Stimulation and MCP-1 Secretion
For stimulation with IL-1ß cells were seeded at 50,000 cells/well in 24-well tissue culture plates (Costar) and allowed to grow to confluence in RPMI medium containing 10 µg/ml insulin and 5 µg/ml transferrin and supplemented with 10% dextran-coated charcoal-treated FBS (FBS-DC). MCP-1 secretion was evaluated by immunoprecipitation and SDS-PAGE after metabolic labeling with [35S]cysteine (Amersham) and by enzyme-linked immunosorbent assay (ELISA) according to our previously reported procedures.11,17
For treatment with progesterone (P; 4-pregnen-3,20-dione) and estradiol (E2; (1,3,5,(10)-estratrien-3,17ß-diol 3-benzoate) (Sigma), cells were seeded at 20 x 104 cells/well in 24-well plates and allowed to adhere for 2 hours at 37°C/5% CO2. The culture medium was then removed and replaced with a fresh medium containing different concentrations of hormones. Cells were maintained in culture for 7 to 8 days (until confluence), and the media were changed every 2 days. At confluence, cells were washed with serum-free RPMI, and incubation with hormones was pursued in this medium for an additional 42 hours. Finally, cells were exposed or not to IL-1ß, which was added to the culture medium to reach a final concentration of 1 ng/ml. Six hours later, the culture supernatants were collected and kept in small aliquots at -80°C until use for MCP-1 assay by ELISA.
For treatment with dexamethasone (Sigma), cells grown to confluence were incubated with serum-free RPMI for 18 hours and then with dexamethasone for 24 hours in the serum-free RPMI before exposure to IL-1ß for an additional 6 hours. Culture supernatants were then recovered, and MCP-1 levels were measured by ELISA.
Expression of P and E2 Receptors by Immortalized Endometriotic Cells
The level of P and E2 receptors was determined
according to a ligand technique previously reported by Asselin et al,
with slight modifications.23
The assays were performed in
triplicate. Briefly, cells (13 x 106) were diluted in
2 ml of buffer A (25 mmol/L Tris/HCl, 1.5 mmol/L EDTA, 10 mmol/L
-monothioglycerol, 10% glycerol, 10 mmol/L sodium molybdate, pH
7.4), sonicated on ice, and centrifuged at 105,000 x g
for 90 minutes, and the supernatant (cytosol) was immediately used for
assay. P binding was measured using the dextran-coated charcoal (DCC)
adsorption technique. A 100-µl volume of cytosol was mixed with 100
µl of buffer B (10 mmol/L Tris/HCl, 1.5 mmol/L EDTA, 10 mmol/L
-monothioglycerol, pH 7.4) and 100 µl of
[17
-methyl-3H]promegestone ([3H]R5020;
specific activity, 84 Ci/mmol; New England Nuclear, Lachine, Quebec,
Canada), which was used at a final concentration of 5 nmol/L in
combination with 1 µmol/L dexamethasone to mask the glucocorticoid
receptors. Nonspecific binding was determined by incubating 100 µl of
cytosol with 100 µl of [3H]R5020 and 100 µl of
unlabeled R5020 (3 µmol/L in buffer B). The assay was ended by adding
300 µl of DCC (1% Norit A and 0.1% dextran T-70 in buffer B), and
after 10 minutes of incubation, tubes were centrifuged at 2000 x
g for 10 minutes, the supernatant was recovered, and
radioactivity was measured by liquid scintillation spectrometry using a
Beckman counter with a counting efficiency of 35%.
For E2 receptors, [2,4,6,7-3H]17ß-estradiol ([3H]E2; specific activity, 85 Ci/mmol; New England Nuclear) was added to the cytosol solution at a final concentration of 5 nmol/L, and unlabeled E2 was used to determine nonspecific binding as described earlier for P receptors. Unbound steroids were separated by adding 300 µl of hydroxylapatite (HAP; 0.25 g/ml of 50 mmol/L Tris/HCl, 10 mmol/L KH2PO4 buffer, pH 7.4). After 40 minutes of incubation at room temperature, tubes were centrifuged, the pellet was washed in the Tris buffer, and the radioactivity from the HAP pellet was then extracted twice with 1 ml of ethanol and counted using a Beckman counter with a counting efficiency of 35%.
The number of P and E2 receptors was calculated with the following equation: (SB x V x N x 10-15)/(CE x 2.22 x SA x v x n), where SB is specific binding (cpm), V is total cytosol volume (2 ml), N is Avogadro's number (6.023 x 1023), CE is counting efficiency (0.35), SA is specific activity of [3H]P or [3H]E2 (85 Ci/mmol), v is cytosol sample volume (0.1 ml), and n is cell number (13 x 106); 10-15 is used to transform femtomoles into moles, and 2.22 is a coefficient used to convert cpm into Ci.
Statistical Analyses
The results of MCP-1 secretion were expressed as mean ± SEM. A one-way analysis of variance (ANOVA) was used to determine whether there were any differences in MCP-1 levels found in the culture medium of cells after treatment with different concentrations of a cytokine or a hormone or after exposure to a cytokine for different periods of time. The Tukey's honestly significant difference test (HSD) was used post hoc for multiple comparisons. A probability level of less than 0.05 was considered as statistically significant.
| Results |
|---|
|
|
|---|
Human endometriotic tissue was isolated from the peritoneum of
women with endometriosis, and primary cultures of endometriotic
epithelial cells were maintained as described in Materials and Methods.
To establish stable epithelial cell lines that might maintain some
differentiated characteristics of primary cultures, the SV40 large
T-antigen was chosen as an immortalizing agent. Infection with SV40 was
used for immortalization as our previous attempts to immortalize
endometriotic cells with different vectors encoding large T-antigen
have failed. We infected subconfluent cultures to allow several rounds
of cellular division to occur after infection to increase the
probability of viral integration into the host genome. Discernible
colony outgrowths were observed 4 weeks after infection, and clones
were derived from emerging foci. Clonal expansion of individual single
variant cells were subcultured, and six individual cell lines were
retained. Among the six cell lines isolated, only one (Clo03) was
selected for additional genetic and physiological characterization, on
the basis of the clear polygonal epithelial-like morphology that these
cells displayed in culture (see below). We first determined whether the
endometriotic transformed cells expressed the SV40 early genes. All
nuclei of Clo03 cells were shown to contain T-antigen as revealed by
indirect immunofluorescence staining (Figure 1A)
. Also, immunoblot analysis showed the
presence of large T-antigen whereas a minor band corresponding to small
T-antigen was also present (Figure 1B)
. We next analyzed the general
pattern of SV40-specific DNA sequences in the transformed cells.
High-molecular-weight cell DNA was extracted from Clo03 at passage 78
and analyzed by digestion with restriction endonucleases possessing
different specificities for SV40 DNA. The results of these analyses are
shown in Figure 2
, and an unexpected
observation was made. After digestion of genomic DNA with
BamHI restriction enzyme, which cleaves SV40 DNA at one
point of the viral genome, a major band with a molecular weight of 5.2
kb was observed. Digestion with EcoRI, with one single
restriction site in SV40, also exhibited a single band migrating at 5.2
kb. To determine whether this 5.2-kb band was generated from viral DNA
molecules that were not integrated, the genomic DNA was digested with
XbaI restriction enzyme, which lacks specificity for the
SV40 genome but cleaves human cellular DNA. As illustrated in Figure 2A
, a major hybridization signal (indicated by a star) with a faster
electrophoretical mobility than would be expected for linearized SV40
was observed, suggesting a supercoiled close circular DNA. Additional
evidence that the viral SV40 DNA existed in a free state was obtained
by double digestion of the DNA with three combinations of two
restriction enzymes, each of them cutting once in the viral genome:
HpaII plus BglI digestion resulted in 4.9- and
0.3-kb fragments; BamHI plus BglI in 2.7- and
2.5-kb fragments; and BglI plus EcoRI in 3.4- and
1.7-kb fragments, as would be expected for restriction of full-length
viral DNA. Finally, the presence of episomal SV40 DNA was confirmed by
releasing these structures from isolated nuclei after mechanical
homogenization in an isotonic buffer.16
Southern blot
analyses (Figure 2B)
showed indeed that the major band detected
co-migrated with authentic supercoiled SV40 (form I) whereas a fainter
band co-migrated as a nick circular DNA (form II). This latter form,
which was not detected in total DNA (Figure 2A)
, could have been
generated by relaxation of the supercoiled form after the extensive
sharing forces necessary to make these molecules diffuse outside the
nucleus. These results clearly indicated that SV40 DNA was present in a
free state, implicating an autonomous mode of replication. Indeed,
sequence analyses of the DNA fragment corresponding to the origin of
replication present in the transformed cells showed identity with that
of wild-type SV40 (nucleotides 5191 to 5243/1 to 31).24
The same results were observed whether DNA was extracted from cell
cultures at early (13th) or late (78th) passages.
|
|
|
Chromosome analysis of 113 metaphases at passage 13 revealed that
96% of immortalized endometriotic cells had a polyploid karyotype. The
distribution of chromosome number illustrated in Figure 4A
shows a peak in the hypotetraploid
region with 78% of metaphases containing 78 to 88 chromosomes. From
the 113 metaphases counted, 30 were photographed and analyzed. Figure 5A
shows a GTG-banded polyploid karyotype
of an immortalized cell from passage 13. The average percentage of
mitoses with 1, 2, 3, or 4 copies of each autosome and X chromosome is
shown in Figure 6
. As can be seen, the
mitoses analyzed have mainly three or four copies for most chromosomes.
However, one or two copies of the autosomes 10, 11, 15, and 17 are
found in more than 65% of the mitoses. Cytogenetic analysis also
revealed chromosomal rearrangements, as shown in Table 2
, which often involved autosomes 11 and
19.
|
|
|
|
Doubling Time
Immortalized endometriotic cells maintained in DMEM-F12 medium
supplemented with 10% FBS-DC follow an exponential pattern of growth
(Figure 7)
with a comparable doubling
time of 29 to 32 hours at early (15th) and late (78th) passages,
estimated from direct viable cell count.
|
According to the equation described in Materials and Methods, the number of E2 and P receptors/cell, expressed as mean of triplicate determinations ± SE (SD), was 2656 ± 92 and 1799 ± 326, respectively, at passage 15 and 3034 ± 286 and 1873 ± 106, respectively, at passage 78.
Stimulation of MCP-1 Secretion by IL-1ß
We have recently shown that endometriotic cells secrete high
levels of MCP-1 in response to pro-inflammatory cytokines, such as
IL-1ß,11
which are found in elevated levels in the
peritoneal fluid of patients having endometriosis.3,5
This
factor may play a significant role in monocyte recruitment into the
peritoneal cavity and their activation. The objective of these
experiments was therefore to assess the ability of an endometriotic
cell line to respond to the pro-inflammatory cytokine IL-1ß by
secreting MCP-1. As shown in Figure 8
,
IL-1ß induced MCP-1 secretion in a time- and dose-dependent manner.
MCP-1 secretion was detectable as early as 2 hours after incubation
with 1 ng/ml IL-1ß and reached its highest level after 18 hours
(Figure 8A)
. Culture stimulation with different concentrations of
IL-1ß (0.01 to 10 ng/ml) during 6 hours resulted in a virtually
linear elevation of MCP-1 concentrations measured in the culture
supernatant (Figure 8B)
. The IL-1ß-induced MCP-1 secretion was
significantly inhibited in a dose-dependent manner by dexamethasone
(10-9 to 10-6 mol/L), a steroid
anti-inflammatory agent that has been reported to inhibit MCP-1
secretion in a variety of cells (Figure 8C)
.
|
and -1ß.26
Co-incubation of cells with
IL-1ß (1 ng/ml) and cycloheximide (50 µg/ml), an inhibitor of
protein synthesis, resulted in an effective inhibition of MCP-1
expression (Figure 9)
|
It is known that endometriosis is dependent on ovarian steroids
for its maintenance and development,27
and numerous
observations indicate that endometriotic tissue expresses ovarian
steroid receptors, although at a lower level than the corresponding
uterine endometrium.28,29
Based on this and on our
results, described earlier, showing that immortalized cells express
both E2 and P receptors, we examined the responsiveness of
an endometriotic cell line to ovarian hormones and the ability of these
latter to modulate MCP-1 secretion by immortalized cells. Ovarian
steroid doses (10-8 mol/L for E2 and
10-6 mol/L for P) used in this study were selected on the
basis of previous reports showing that ovarian steroid concentrations
in the peritoneal fluid after ovulation are more elevated than those
normally found in the peripheral blood.30,31
Treatment of
immortalized cells with E2 and P resulted in a significant
increase of spontaneous secretion of MCP-1 in culture (Figure 10A)
. This effect was more obvious when
MCP-1 secretion was amplified by IL-1ß stimulation (Figure 10B)
.
Co-incubation of cells with E2 and P resulted in an
additional increase of MCP-1 secretion compared with each hormone
alone. This was also observed with primary endometriotic epithelial
cell cultures (Figure 10C)
, indicating that the endometriotic cell line
retains differentiated functions and reacts to IL-1ß and to ovarian
hormones by secreting MCP-1 in a manner comparable to parental cells.
It is worthy of note that the effect of ovarian hormones on MCP-1
secretion by primary cultures was investigated only with
cytokine-stimulated cells because of the low number of epithelial cells
that can be isolated from endometriotic biopsies.
|
| Discussion |
|---|
|
|
|---|
We report here a cytogenetic and physiological study of an
endometriotic cell line that was immortalized by viral infection of
primary epithelial endometriotic cell cultures with SV40. As previous
attempts to immortalize endometriotic cell with different vectors have
failed, we used in a last attempt viral infection that has been
successfully used to establish human cell lines.35,36
Six
lines derived from six individual foci were isolated. Taking into
account that the establishment of permanently transformed cell lines
after infection with SV40 is a very rare event and requires nonlethal
insertion of viral genetic material into host chromosomal DNA and
expression of a functional SV40 early gene,36-38
it is
puzzling that starting with only 10 x 104
endometrial
cells in our transformation assays as many as six clones were obtained.
Three hypotheses can be proposed to explain such a high rate of
success. First, endometriotic cells may be particularly sensitive to
SV40 transformation. However, attempts to transform several other
primary endometriotic cell cultures from different patients have
failed. Alternatively, it is possible that the particular explant of
patient 1 was in a physiological state in the proliferative phase of
the menstrual cycle that might have rendered cells susceptible to viral
infection (Table 1)
. Finally, the six clones may in fact not be
independent and would rather emerge from a single transformed cell.
Work is in progress to determine whether the other selected clones,
namely, 06, 11, 12, 14, 15, and 16 are sister lines or not of Clo03.
Our Southern blot analyses clearly showed that SV40 DNA is episomal in Clo03 cells. The possibility that the linear 5.2-kb SV40 fragment results from an integrated double dimers of SV40 is ruled out by the digestion with the non-cutter restriction enzyme XbaI, which does not result in high-molecular-weight DNA as is the case in SV40-induced mesotheliomas in hamsters.39 In addition, no convincing hybridization signals for integrated SV40 molecules could be shown using the different cutter and non-cutter SV40-specific restriction enzymes. However, it is widely believed that SV40 DNA must be integrated into the host cell DNA to transform human cell lines,36-38 and it is inferred that episomal SV40, as seen in rodent cells and human keratinocytes,40,41 might be the consequence of extensive post-integration lability of the viral genome leading to the excision of the integrated fragment by recombination mechanisms37,42 and might be considered as an epiphenomenon.37 Recently, SV40-like sequences have been found associated with several types of human tumors: mesotheliomas, osteosarcomas, ependymomas, and brain tumors (reviewed in Ref. 43 ). The possibility that SV40 played a causative role in these human malignancies has been considered,43-45 and the presence of episomal SV40 DNA in some of these tumors has been reported.46-49 The persistence of free viral forms as observed in Clo03 endometriotic cells at early as well as at late passages is puzzling and may indicate that the free DNA has acquired an apparent stable state in these cell lines. It is therefore tempting to conclude that our in vitro experiment substantiates the possibility that episomal SV40 could indeed transform human cells and that this phenomenon might be cell type dependent. This of course does not rule out the possibility that during the very initial steps of transformation, the viral DNA has once been integrated and that the free viral DNA arises from excision of molecules from the host genome as is observed in non-permissive rodent cells.42
At an early passage of culture, the cells exhibited an overall hypotetraploid karyotype with a frequent presence of only one or two copies for chromosomes 10, 11, 15, and 17 in the mitoses analyzed. At a late passage, the cells showed a hypertriploid karyotype, but cytogenetic analyses revealed comparable chromosome rearrangements, mainly involving the same chromosomes. T-antigen has been reported to induce successive rounds of DNA synthesis without intervening mitosis in transformed cells, leading to polyploidy,50,51 and to cause karyotypic destabilization and instability.35,52 However, to explain the low number of copies for chromosomes 10, 11, 15, and 17, the following hypotheses could be put forward: 1) these chromosomes were involved in the early stages of chromosome rearrangements; 2) they were preferentially lost because they contain genes deleterious for cell growth when present in too many copies; or 3) the endometriotic cells that became immortalized had only one copy of those chromosomes.
Immortalized cells showed a strong positive immunoreactivity for cytokeratins, which are known to be expressed only by epithelial cells, and reacted positively with an antibody that specifically recognizes a 200-kd glycoprotein expressed by epithelial endometrial/endometriotic cells.19 This suggests that the cell line is of epithelial-like nature. However, like primary endometriotic epithelial cells, immortalized cells were also immunoreactive with anti-vimentin. Available data regarding the specificity of vimentin as a marker for stromal cells in culture are contradictory.13,53-55 However, initiation of vimentin expression seems to be an adaptation to cell culture conditions rather than being indicative of mesenchymal cell origin.56
The endometriotic cell line showed the ability to spontaneously secrete MCP-1, a potent monocyte chemoattractant and activating factor. That secretion was significantly enhanced by IL-1ß, a major pro-inflammatory cytokine found in elevated concentrations in the peritoneal cavity of patients with endometriosis,3,5 and was inhibited by dexamethasone, an anti-inflammatory steroid hormone that also inhibits MCP-1 secretion by primary endometriotic cell cultures (A. Akoum, unpublished results). These results are in line with our previous studies showing that after stimulation with pro-inflammatory cytokines in vitro, ectopic as well as eutopic primary endometrial cells of women with endometriosis secrete increased amounts of MCP-1.11,57 This factor may play an important role in the activation of peripheral blood monocytes and peritoneal macrophages in endometriosis,7,58 and, according to our recent findings, the up-regulation of its expression arises even in situ in the intrauterine endometrium of endometriosis patients.59 Three electrophoretically distinct species of MCP-1 with estimated molecular weights of 9, 13, and 15 kd were detected in the culture medium, which is also consistent with our previous data regarding MCP-1 expression by primary cultures of endometriotic and endometrial cells.11,57 On SDS-PAGE, MCP-1 behaves as multiple species with molecular weights ranging from 8 to 18 kd. The core protein of approximately 8 kd may be synthesized by all cells that produce MCP-1. However, this protein undergoes glycosylation, which, according to the cell type, results in the appearance of proteins having different molecular weights.25
We have also shown that immortalized endometriotic cells express P and E2 receptors. Furthermore, they were directly stimulated to secrete MCP-1 by ovarian steroids, a response that was enhanced in IL-1ß-treated cells. The cytokine-induced secretion of MCP-1 was significantly increased by E2 (10-8 mol/L) and also by P (10-6 mol/L), although to a lesser extent, a response that, interestingly, was observed with primary endometriotic epithelial cells as well. Moreover, both in immortalized and primary endometriotic cells, MCP-1 secretion was further enhanced by E2 and P together. These findings clearly show that ovarian hormones exert a synergistic action on MCP-1 secretion by endometriotic cells and suggest a cycle-dependent control of MCP-1 expression by endometriotic lesions. They also provide for the first time evidence that ovarian steroids may contribute to the liberation of a potent and specific mediator of monocyte chemoattraction and activation into the peritoneal cavity of patients with endometriosis. On the other hand, these findings indicate that the cell line is responsive to ovarian steroids and to pro-inflammatory stimuli, which, interestingly, was observed even after a long-term cell culture. They also indicate that, at least with regard to the IL-1ß-dependent and the ovarian-hormone-dependent MCP-1 secretion, the line reacts in a manner comparable to that of normal non-immortalized endometriotic cells and retains differentiated functions. Although interesting, this nevertheless was surprising in view of the polyploidy of the cell line and cannot be explained with certainty. One potential explanation might presumably lie in the fact that the MCP-1 gene is located on chromosome 17 (17q11.2-q21.1),60 which, according to our cytogenetic analysis, did not show detectable structural rearrangements. On the other hand, numerous cell lines immortalized with SV40 T-antigen have been reported to retain differentiated functions as compared with the parental cells.61-64
The cell line Clo03 has been maintained in culture for over 80 passages with no evidence of cell crisis. Cells were still proliferating without any noticeable change in the population doubling time or in cell morphology, suggesting that they are immortal, and cytogenetic analysis of cells from passage 78 showed deletions in the long arm of chromosome 6, which has recently been shown to harbor growth suppressor or senescence-related genes65,66 and could therefore account for the immortalization of the endometriotic cell line.
In summary, the findings reported in the present study support the view that the immortalized Clo03 cell line may be an interesting tool for the study of the pathophysiology of endometriosis. In addition, finding episomal SV40 in an SV40-transformed human cell line, and finding the characteristic markers of SV40-mediated transformation in the same line with nuclear T-antigen expression and genetic alterations, including that of 6q, may be of great interest for the understanding of SV40 transformation of human cells.
| Acknowledgements |
|---|
| Footnotes |
|---|
Supported by grants MT-12541 and MT-14638 from the Medical Research Council of Canada to A. Akoum. J. Lavoie holds a studentship from a shared contribution from the Division of Pathology of the Department of Medical Biology and the Faculty of Medicine, Laval University, and R. Drouin is a research scholar of the Cancer Research Society Inc./Medical Research Council of Canada program. A. Akoum is a Chercheur-Boursier Senior of the Fonds de la Recherche en Santé du Québec.
Accepted for publication December 22, 1998.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
L. Ricciardiello, M. Baglioni, C. Giovannini, M. Pariali, G. Cenacchi, A. Ripalti, M. P. Landini, H. Sawa, K. Nagashima, R. J. Frisque, et al. Induction of Chromosomal Instability in Colonic Cells by the Human Polyomavirus JC Virus Cancer Res., November 1, 2003; 63(21): 7256 - 7262. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Zeitvogel, R. Baumann, and A. Starzinski-Powitz Identification of an Invasive, N-Cadherin-Expressing Epithelial Cell Type in Endometriosis Using a New Cell Culture Model Am. J. Pathol., November 1, 2001; 159(5): 1839 - 1852. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yang, P. Degranpré, A. Kharfi, and A. Akoum Identification of Macrophage Migration Inhibitory Factor as a Potent Endothelial Cell Growth-Promoting Agent Released by Ectopic Human Endometrial Cells J. Clin. Endocrinol. Metab., December 1, 2000; 85(12): 4721 - 4727. [Abstract] [Full Text] |
||||
![]() |
M. Bocchetta, I. Di Resta, A. Powers, R. Fresco, A. Tosolini, J. R. Testa, H. I. Pass, P. Rizzo, and M. Carbone Human mesothelial cells are unusually susceptible to simian virus 40-mediated transformation and asbestos cocarcinogenicity PNAS, August 17, 2000; (2000) 170207097. [Abstract] [Full Text] |
||||
![]() |
J. Gogusev, J. B. de Joliniere, L. Telvi, M. Doussau, A. Stojkoski, and M. Levradon Cellular and Genetic Constitution of Human Endometriosis Tissues Reproductive Sciences, March 1, 2000; 7(2): 79 - 87. [Abstract] [PDF] |
||||
![]() |
J. S. Butel Viral carcinogenesis: revelation of molecular mechanisms and etiology of human disease Carcinogenesis, March 1, 2000; 21(3): 405 - 426. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Butel and J. A. Lednicky RESPONSE: Re: Cell and Molecular Biology of Simian Virus 40: Implications for Human Infections and Disease J Natl Cancer Inst, July 7, 1999; 91(13): 1166a - 1167a. [Full Text] [PDF] |
||||
![]() |
M. Bocchetta, I. Di Resta, A. Powers, R. Fresco, A. Tosolini, J. R. Testa, H. I. Pass, P. Rizzo, and M. Carbone From the Cover: Human mesothelial cells are unusually susceptible to simian virus 40-mediated transformation and asbestos cocarcinogenicity PNAS, August 29, 2000; 97(18): 10214 - 10219. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |