help button home button Am J Pathol Epitomics, Inc.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Carnemolla, B.
Right arrow Articles by Zardi, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carnemolla, B.
Right arrow Articles by Zardi, L.
(American Journal of Pathology. 1999;154:1345-1352.)
© 1999 American Society for Investigative Pathology


Technical Advance

Identification of a Glioblastoma-Associated Tenascin-C Isoform by a High Affinity Recombinant Antibody

Barbara Carnemolla*, Patrizia Castellani*, Marco Ponassi*, Laura Borsi*, Stefania Urbini*, Guido Nicolo*, Alessandra Dorcaratto§, Giuseppe Viale§, Greg Winter{dagger}, Dario Neri{dagger}{ddagger} and Luciano Zardi*

From the Laboratory of Cell Biology and Laboratory of Anatomic Pathology,*
Istituto Nazionale per la Ricerca sul Cancro, Genoa, Italy; the Cambridge Centre for Protein Engineering,{dagger}
MRC Centre, Cambridge, United Kingdom; the Institut fur Molekularbiologie und Biophysik,{ddagger}
ETH Honggerberg, Zürich, Switzerland; and the Institute of Neurosurgery,§
University of Genoa Medical School, Genoa, Italy.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tenascin-C exists in several polymorphic isoforms due to alternative splicing of nine fibronectin-like type III repeats. Large Tenascin-C isoforms are present in almost all normal adult tissues but are upregulated in fetal, regenerating, and neoplastic tissues. Here, we report a human antibody fragment, TN11, derived from a phage library with high affinity for the spliced repeat C and demonstrate that this repeat is undetectable in normal adult tissues, barely detectable or undetectable in breast, lung and gastric carcinomas, meningioma, and low grade astrocytoma, but extremely abundant in high grade astrocytoma (grade III and glioblastoma), especially around vascular structures and proliferating cells. The antibody appears to have potential for development of a therapeutic agent for patients with high grade astrocytoma.



    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
During tumor progression, the extracellular matrix (EM) of the tissues in which a tumor grows is remodeled through proteolytic degradation and through neosynthesis of new EM components by both neoplastic cells and stromal cells. The EM generated by these processes differs from that found in normal tissues and seems to provide an environment that is more conducive for tumor progression (inductive and/or instructive), of which angiogenesis is a crucial step.1-4 The tumoral EM contains several tumor-associated antigens that are generally more abundant and possibly more stable than those of the cell surface.5-7 Consequently, these antigens represent valuable targets for tumor imaging and therapy.8-11 Some of these tumor-associated EM molecules are isoforms of proteins with a wide distribution in normal adult tissues, such as fibronectin and tenascin, which are generated by deregulation of the mechanisms of alternative splicing of their primary transcripts.

Tenascin-C (TN-C) is a glycoprotein composed of six similar subunits joined at their NH2 terminus by disulphide bonds. Each human TN-C subunit includes three types of structural modules: 14.5 epidermal growth factor-like repeats, 17 type III homology repeats, and a COOH-terminal knob made up of a sequence with homology to the globular domain of the ß and {gamma} chains of human fibrinogen.12-15 TN-C is coded for by a single gene and its expression is regulated by a single promoter.16 Structurally and functionally different human TN-C isoforms are generated by the alternative splicing of the TN-C transcript, nine type III repeats being included or omitted in the mRNA.17-20 We have previously demonstrated that in neoplastic tissues the alternative splicing of the TN-C pre-mRNA is deregulated and is cell cycle-dependent.21-23 In order to obtain highly specific human antibodies to tumor-associated TN-C isoform we have attempted to use phage antibody libraries.24,25


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell lines, TN-C Purification, Monoclonal Antibodies, and TN-C Recombinant Fragments

SK-MEL-28 human melanoma and GM6114 normal human cell lines were purchased from American Type Culture Collection (ATCC, Manassas, VA). BHK cells transfected with two cDNA constructs in pNUT expression vector and producing the large and the small TN-C splice variants (TN Large and TN Small) were a gift of Dr. H. P. Erickson.26 TN-C was purified from the various conditioned media as previously reported.27 The mAb specific for proliferating cells, KI-67, was purchased from Dako (Carpinteria, CA). The recombinant TN A-D, B-D, C and B fragments, and fusion proteins {lambda}TN27 and {lambda}TNBC were prepared as reported by Balza et al.27 SDS-PAGE and immunoblotting were carried out as previously reported.28

Antibody Fragment Isolation and scFv Purification

A human scFv phage library25 and TN Large, as antigen, were used for the selection of recombinant antibodies. The selection was performed as previously reported.8 Enzyme-linked immunosorbent assay (ELISA) screening of bacterial supernatants using TN large and TN small as antigens allowed the identification of the TN large-specific clone TN11, which was then selected for further characterization. Single bacterial colonies were grown as reported by Carnemolla et al8 and supernatants containing scFv TN11 or TN12 were purified using the recombinant TN A-D fragment or TN-C conjugated to Sepharose 4B (Pharmacia, Uppsala, Sweden), respectively. Real-time interaction analysis with surface plasmon resonance detection of the affinity and kinetic constants of the scFv was carried out as previously described.10

RNA Extraction, Northern Blot Analysis, RT-PCR, and Immunohistochemical Procedure

Total RNA was isolated from human glioblastoma tissues or from human fibroblast cell line as reported.5 RNAs from heart, brain, placenta, lung, liver, skeletal muscle, kidney, pancreas, spleen, thymus, prostate, testis, ovary, small intestine, colon (no mucosa), and peripheral blood leukocyte and fetal brain, lung, liver, and kidney blotted on a nylon membrane (Hybridization-ready Human Multiple Tissues Blots) were purchased from Clontech Laboratories Inc. (Palo Alto, CA) and the hybridization was carried out as reported.5 For the identification of TN-C mRNA containing the type C repeat, we used a 32P-labeled DNA probe of 1078 bp containing 270 bp of human TN-C (4630–4899 bp of the sequence) of Siri et al18 plus 801 bp of {lambda}gt11 vector. For the identification of all the different TN-C mRNAs we used the HT11 cDNA probe,18 and to normalize Northern blots, the human glyceraldehyde 3-phosphate dehydrogenase (G3PDH) cDNA probe (Clontech). Reverse transcriptase-polymerase chain reactions (RT-PCR) were performed using 100 ng of total RNA, oligonucleotides BC-482 (5'GCTACCCCCTAGTACTGATTTTATTGTCTA, position: bases 4542-4571 of the TN-C sequence (Siri et al18) and BC-485 (5'TTTCCAGTGGCTCAGACTGC, complementary sequence, position: bases 5028-5047) or BC-482 and BC-484 (5'CTGGTCTGAGTCTTGGTTCCGTCC, complementary sequence, position: bases 5322-5345) and Titan One Tube RT-PCR system (Boehringer Mannheim, Mannheim, Germany) following the manufacturer's manual. Normal and neoplastic tissues were obtained from specimens taken during the course of therapeutic surgical procedures. Immunohistochemical studies were carried out as previously described.29

In Situ Hybridization

For the in situ hybridization we used a modification of the Schaeren-Wiemers and Gerfin-Moser method30 as previously described by Ponassi et al.31 Briefly, paraformaldeheyde-fixed cryostat sections were hybridized for 16–20 hours at 68°C with digoxigenin-labeled cRNA probes generated from templates obtained by PCR. The templates carried the T3 or T7 RNA polymerase promoters included before their transcription start sites. The visualization of the signal was accomplished by a color reaction with 4-nitrobluetetrazolium chloride (NBT) (Boehringer Mannheim) and 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Boehringer Mannheim) via an anti-DIG antibody conjugated to alkaline phosphatase (AP) (Boehringer Mannheim). Both sense and antisense probes entirely covered the TN repeat C, but only the last gave hybridization signal. The specificity of the probe was established by Southern blot using different DNA fragments, some including and others not including the repeat C, of TN-C (Figure 1) using the same stringency conditions used in the in situ hybridization experiment.



View larger version (59K):
[in this window]
[in a new window]
 
Figure 1. Confirmation by Southern blot analysis of the specificity of the cRNA probe used for in situ hybridization experiments. Bottom: ethidium bromide staining of the agarose gel. Lane 1: TNfnALL (including human tenascin DNA from type III repeat 2 to type III repeat 7, including all the alternatively spliced type III repeats). Lane 2: TNfn 1-8 (same sequence as TNfnALL but lacking all the alternatively spliced repeats). Lane 3: All TNegf like repeats. Lane 4: Alternatively spliced type III repeat D. Lane 5: Alternatively spliced type III repeat C. Lane 6: type III repeat 1. Lane 7: TNegf like repeats from 8 to 10. Lane 8: 1-Kb standard. Above: Southern blot showing DIG-hybrids detection. The numbers on the right are expressed in kilobases.

 

    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Isolation of Two Human Antibody Fragments against the Large and Small Human TN-C Isoforms

The phage antibody library25 was selected using recombinant human large TN-C. Several clones (including TN12) exhibited a strong reactivity with large and small TN-C isoforms in ELISA assays. One clone (TN11) gave a strong ELISA signal only with the large TN-C isoform. Antibodies TN11 and TN12 were therefore selected for further characterization. The binding affinity of TN11 and TN12 to the TN Large recombinant protein was determined by real-time interaction analysis with surface plasmon resonance detection (see Materials and Methods) and the dissociation constants of TN11 ad TN12 were 1.3 x 10-10 and 2.7 x 10-8 mmol/L respectively. Sequencing of the V-gene of TN11 and comparison of the sequences with VBASE (the complete collection of human V-gene segments at http://www.mrc-cpe.cam.ac.uk/imt-doc) identified human VH segment DP10 and VL segment DPL11/10 with VH CDR3 sequence of SRRITIFGGGAFDI and VL CDR3 sequence of SSYTTRSTRV, and sequencing of the V-gene of TN12 identified human VH segment DP38 and VL segment DPL12 with VH CDR3 sequence of ALPYYYYGMDV and VL CDR3 sequence of AAWDDSLSEFL.

TN11 Reacts with the Spliced Repeat C whereas TN12 Reacts with the EGF-Like Repeats

The binding of TN11 and TN12 to human TN-C recombinant fragments was analysed by immunoblotting (Figure 2) . TN12 reacted with both the large and small recombinant isoforms, as well as with a TN-C fusion protein containing only the EGF-like repeats in the NH2 terminus part of the molecule. TN12 did not react with any other TN-C fusion proteins or recombinant fragments tested or with purified human FN (data not shown). Thus, the epitope recognized by TN12 is located within the EGF-like repeats.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 2. A: Model of the domain structure of a human TN-C subunit. The ovals and the squares represent the EGF-like and FN-like repeats, respectively. The globular N-terminal knob and the fibrinogen-like C-terminal domain are also depicted. The FN-like repeats A1 to D, whose expression is regulated by the alternative splicing of the pre-mRNA, are shaded. The upper part of the figure also shows the TN-C-ß-galactosidase fusion proteins or recombinant proteins used. The arrows show the sequence in which each epitope of recombinant or monoclonal antibodies was localised. {wedge} indicates contiguity. B: Sodium dodecyl sulfate polyacryl-amide gel electro-phoresis (4-18%) of recombinant Large TN-C (containing repeats from A1 to D) and Small TN-C (without repeats from A1 to D) stained with Coomassie blue and immunoblots stained with scFv TN11 and TN12. C: Immunoblots of different fusion and recombinant proteins (A) using the scFv TN11 and TN12. Values on the left indicate molecular masses (in kilodaltons) of the standards.

 
TN11 reacted with the large recombinant TN-C but not with the small isoform, and also reacted only with the recombinant fragments TNA-D, TNB-D, TNC, and fusion protein {lambda}TN BC (Figure 2) . These findings demonstrated that the epitope recognized by TN11 is localized within the TN-C repeat C (cTN-C). Using this scFv in Western blot experiments, we observed that the repeat C was undetectable in the large isoform of purified TN-C from cultured normal human fibroblasts and a melanoma cell line, SKMEL 28 (data not shown). These results were confirmed by RT-PCR experiments using RNA from the same cell lines (data not shown). The RT-PCR experiments also revealed that the repeat C was present in almost all the mRNA samples from glioblastoma, whereas it was undetectable in RNA samples from meningioma specimens. These data were confirmed by Western blotting using the recombinant antibodies TN11 and TN12 and TN-C from human glioblastoma and meningioma specimens. While TN12 reacted with both the TN-C preparations, TN11 reacted only with the TN-C preparation from glioblastoma (data not shown).

Northern Blot of TN-C mRNA in Normal and Fetal Tissues

Northern blot was performed to study the levels of the mRNAs of total TN-C and of the cTN-C using the probes described in Materials and Methods and the RNA from various normal adult tissues (heart, brain, placenta, lung, liver, skeletal muscle, kidney, pancreas, spleen, thymus, prostate, testis, ovary, small intestine, colon (no mucosa), and peripheral blood leukocytes) and from four different fetal tissues (brain, lung, liver, and kidney). The results demonstrated the presence of large amounts of the cTN-C in fetal brain, lung, and kidney, whereas this mRNA was undetectable or barely detectable in all the adult tissues tested (Figure 3) . By contrast, total TN-C mRNA was present in almost all the tissues tested, as previously reported (Figure 3) .5



View larger version (36K):
[in this window]
[in a new window]
 
Figure 3. Northern blots of poly(A)-rich RNA from human adult heart (1), brain (2), placenta (3), lung (4), liver (5), skeletal muscle (6), kidney (7), and pancreas (8) tissues and fetal brain (1), lung (2), liver (3), and kidney (4) tissues using the cDNA probe (see Materials and Methods) specific for c-TN-C isoform, the HT11 probe that recognizes all TN-C isoforms, and the human G3PDH cDNA to normalize the blots (see Materials and Methods). Numbers on the left are the size, in kb, of the standards.

 
Distribution of the cTN-C in Normal and Neoplastic Tissues

Immunohistochemical analyses of a variety of normal adult tissues (brain (2 specimens), lung (4), breast (4), stomach (1), endometrium (2), prostate (1), skin (2), tyroid (1), fallopian tubes (1), vein (1), kidney (1), spleen (1), didymous (1), liver (1), adrenal cortex (1), thymus (1), striate muscle (1), colon (1), prostate (1), and peripheral nerve (1)) using the scFv TN11, which is specific for the type III repeat C, and the scFv TN12, which recognizes all different TN isoforms, showed that in normal adult tissues, although total TN-C had a widespread distribution, the presence of the repeat C was undetectable by immunohistochemistry in all the tissues tested with exception of lymph node and thymus, in which very rare focal staining was observed, mainly in vascular structures.

Furthermore, we analyzed the distribution of total TN-C and of the cTN-C in 92 human tumors of different histotypes using the scFv TN12 and TN11, respectively. Glioblastoma expressed the highest levels of the repeat C, with 14 out of 15 specimens showing strong positivity (Table 1 and Figure 4 ). Presence of this TN-C isoform was detected mainly around vascular structures, surrounding areas with high proliferative activity, in the stroma of tumor nests (Figure 4, A, B, C, E, and G) , and within proliferating cells (Figure 4F) , as demonstrated by double staining using the mAb KI67 and TN11. By contrast, no positive staining was seen in other brain tumors, with the exception of two meningiomas out of 23 that were weakly positive around vascular structures (Table 1 and Figure 5 ). Furthermore, some rare focal positivity was found in 7 of 15 brain metastases from lung and breast carcinomas (see Figure 4D ). Twenty-seven specimens from patients with invasive breast carcinoma were examined, and some very weak positivity was seen in 3 cases (Table 1 and Figure 5 ).


View this table:
[in this window]
[in a new window]
 
Table 1.

Reactivity of the scFv TN11 and TN12 with Primary Tumors of Various Histotypes

 


View larger version (151K):
[in this window]
[in a new window]
 
Figure 4. Immunohistochemical experiments on sections of glioblastoma stained using scFv TN11 (A and B) and double-stained using scFv TN11 (red) and mAbKI67 (brown) (C, E, F, and G); a section of a brain metastasis from lung carcinoma stained using scFv TN11 (D). Scale bar, 10 µm.

 


View larger version (149K):
[in this window]
[in a new window]
 
Figure 5. Immunohistochemical experiments on serial sections of invasive ductal breast carcinoma stained using scFv TN12 (A and C) and scFv TN11 (B and D) and on serial sections of meningioma stained using scFv TN12 (E) and scFv TN11 (F). Scale bar, 10 µm.

 
To establish which kind of cells were responsible for the production of the cTN-C isoform, we prepared a DIG-labeled cRNA probe specific for the cTN-C (see Figure 1 and the Materials and Methods section) and performed in situ hybridization on glioblastoma cryostat sections (Figure 6, A and B) . The results demonstrate that the cTN-C isoform was produced by tumoral cells, even though not all tumoral cells produce the cTN-C isoform.



View larger version (153K):
[in this window]
[in a new window]
 
Figure 6. Two different magnifications of an in situ hybridization experiment using human glioblastoma cryostat sections with the DIG-labeled cRNA repeat C probe (see Material and Methods section). Positive signal was visible only in some tumoral cells with large nuclei.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The large TN-C isoform is expressed in many normal adult tissues but it is expressed at higher levels in neoplastic tissues, particularly glioblastoma. Glioblastomas are usually highly invasive but well compartmentalised, and in general do not metastasize. Nevertheless, due to the lack of specific therapeutic agents, the prognosis of patients with glioblastoma is very poor. With current treatment, which includes palliative surgical resection together with radiotherapy and steroids, the mean length of survival after diagnosis is only 8–10 months, with fewer than 10% of patients alive after 2 years. Glioblastomas have already responded to clinical approaches with TN-C monoclonals (mAbs) and two mAbs, BC-2 and 81C6, both specific for the large TN-C isoform, have found clinical application.9,11,32-35 In fact, the expression of the large TN-C isoform is the most constant feature of glioblastoma. Using a monoclonal antibody specific for the large TN-C isoform (BC-2), staining of the extracellular stroma and around the walls of hyperplastic blood vessels was reported.36 On the contrary, TN-C is barely or not present in the white matter and meninges of different areas of normal adult cerebrum, cerebellum, and spinal cord, whereas only focal and weak staining is reported in the cerebral cortical matrix. Furthermore, the large TN-C isoform is not detectable in normal brain tissues. However, these mouse mAbs used in the radioimmunotherapy (RIT) of glioblastoma are of very limited specificity because they react with a number of normal adult tissues.

Using phage display technology we isolated human antibody fragments binding to human TN-C and identified a fragment directed against the type III repeat C of the large TN-C isoform (TN11). This revealed that the repeat C appeared to be absent from all the normal adult human tissues tested. Likewise, the repeat C was undetectable in the mRNA of normal adult tissues but present in fetal lung, kidney and brain; this finding is consistent with earlier reports showing the presence of the repeat C in fetal tissues but not in adult tissues.37,38 However, the antibody revealed the presence of the repeat C (confirmed by mRNA studies) in anaplastic astrocytoma and glioblastoma, mostly associated with vascular structures and around proliferating cells. This suggests that this TN-C isoform could be produced mainly by proliferating cells. Seven cases out of 15 brain metastases from lung and breast carcinoma showed positive staining for cTN-C, although this isoform was barely detectable in the primary tumors. The mechanisms responsible for the expression of the cTN-C isoform in these metastases are, at present, only a matter of speculation. However, one explanation could be the different environment in which tumoral cells are located and that could induce the expression of the cTN-C isoform. In fact, we have previously demonstrated that environmental conditions, such as the extracellular pH,23 play an important role in controlling the alternative splicing of the TN-C pre mRNA. We are presently investigating the mechanism regulating the expression of the cTN-C in brain metastasis.

The type III repeat C of TN-C appears to be a highly specific target for therapy of glioblastoma, and the human antibody fragment TN11 an attractive candidate for scintigraphic and therapeutic applications. In fact, small human antibody fragments are rapidly cleared from circulation, do not accumulate in the liver, are not immunogenic, and exhibit improved tissue penetration compared to conventional immunoglobulins.39,40 Further studies on the biological activities of the c-TN-C may help to identify new potential targets for therapeutic intervention.


    Acknowledgements
 
We thank Tristan Vaughan at Cambridge Antibody Technology for supplying the human scFv phage library and Mr. Thomas Wiley for manuscript revision.


    Footnotes
 
Address reprint requests to Luciano Zardi, Laboratory of Cell Biology, Istituto Nazionale per la Ricerca sul Cancro, Largo Rosanna Benzi 10, 16132 Genoa, Italy. E-mail: lzardi{at}cisi.unige.it

Supported in part by funds of the Associazione Italiana per la Ricerca sul Cancro (AIRC), by European Union BIOTEC-2 project "Novel Markers of Angiogenesis," by the ETH (Zurich, Switzerland), and by the Stiftung zur Krebsbekampfung.

Accepted for publication February 3, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Folkman J: Angiogenesis in cancer, vascular, rheumathoid and other diseases. Nat Med 1995, 1:27-31[Medline]
  2. Van den Hoff A: Stromal involvement in malignant growth. Adv Cancer Res 1988, 50:159-196[Medline]
  3. Risau W, Lemmon V: Changes in the vascular extracellular matrix during embryonic vasculogenesis and angiogenesis. Devel Biol 1988, 125:441-450[Medline]
  4. Ingber D, Folkman J: How does extracellular matrix control capillary morphogenesis? Cell 1989, 58:803-805[Medline]
  5. Borsi L, Carnemolla B, Nicoló G, Spina B, Tanara G, Zardi L: Expression of different tenascin isoforms in normal, hyperplastic and neoplastic human breast tissues. Int J Cancer 1992, 52:688-692[Medline]
  6. Kaczmarek J, Castellani P, Nicoló G, Spina B, Allemanni G, Zardi L: Distribution of oncofetal fibronectin isoforms in normal, hyperplastic and neoplastic human breast tissues. Int J Cancer 1994, 58:11-16
  7. Leprini A, Querzè G, Zardi L: Tenascin isoforms: possible targets for diagnosis and therapy of cancer and mechanisms regulating their expression. Perspect Devel Neurobiol 1994, 2:117-123
  8. Carnemolla B, Neri D, Castellani P, Leprini A, Neri G, Pini A, Winter G, Zardi L: Phage antibodies with pan-species recognition of the oncofoetal angiogenesis marker fibronectin ED-B domain. Int J Cancer 1996, 68:397-405[Medline]
  9. Riva P, Arista A, Sturiale C, Moscatelli G, Tison V, Mariani M, Seccamani E, Lazzari S, Fagioli L, Franceschi G, Sarti G, Riva N, Natali PG, Zardi L, Scassellati GA: Treatment of intracranial human glioblastoma by direct intratumoral administration of 131 I-labelled anti-tenascin monoclonal antibody BC-2. Int J Cancer 1992, 51:1-7[Medline]
  10. Neri D, Carnemolla B, Nissim A, Leprini A, Querzè G, Balza E, Pini A, Tarli L, Halin C, Neri P, Zardi L, Winter G: Targeting by affinity-matured recombinant antibody fragments of an angiogenesis associated fibronectin isoform. Nat Biotech 1997, 15:1271-1275[Medline]
  11. Merlo A, Jermann E, Hausmann O, Chiquet-Ehrismann R, Probst A, Landolt H, Maecke HR, Mueller-Brand J, Gratzl O: Biodistribution of 111 In-labelled SCN-bz-DTPA-BC-2 Mab following loco-regional injection into glioblastomas. Int J Cancer 1997, 71:810-816[Medline]
  12. Chiquet-Ehrismann R: Tenascin and other adhesion-modulating proteins in cancer. Semin Biol 1993, 4:301-310
  13. Erickson HP, Bourdon MA: Tenascin: an extracellular matrix protein prominent in specialized embryonic tissues and tumors. Annu Rev Cell Biol 1989, 5:71-92
  14. Edelman GM, Jones FS: Cytotactin- a morphoregulatory molecule and a target for regulation by homeobox gene products. Trends Biochem Sci 1992, 17:228-232[Medline]
  15. Erickson HP: Tenascin-C, Tenascin-R and Tenascin-X: a family of talented proteins in search of functions. Curr Opin Cell Biol 1993, 5:869-876[Medline]
  16. Gherzi R, Carnemolla B, Siri A, Ponassi M, Balza E, Zardi L: Human tenascin gene. J Biol Chem 1995, 270:3429-3434[Abstract/Free Full Text]
  17. Gulcher JR, Nies DE, Marton LS, Stefanssonn K: An alternatively spliced region of the human hexabrachion contains a repeat of potential N-glycosylation sites. Proc Natl Acad Sci USA 1989, 86:1588-1592[Abstract/Free Full Text]
  18. Siri A, Carnemolla B, Saginati M, Leprini A, Casari G, Baralle F, Zardi L: Human tenascin: primary structure, pre-mRNA splicing patterns and localization of the epitopes recognized by two monoclonal antibodies. Nucleic Acids Res 1991, 19:525-531[Abstract/Free Full Text]
  19. Sriramarao P, Bourdon MA: A novel tenascin type III repeat is part of a complex of tenascin mRNA alternative splices. Nucleic Acids Res 1993, 21:163-168[Abstract/Free Full Text]
  20. Mighell AJ, Thompson J, Hume WJ, Markham AF, Robinson PA: Human tenascin-C: Identification of a novel type III repeat in oral cancer and of novel splice variants in normal, malignant and reactive oral mucosae. Int J Cancer 1997, 72:236-240[Medline]
  21. Borsi L, Balza E, Castellani P, Carnemolla B, Ponassi M, Querzé G, Zardi L: Cell-Cycle dependent alternative splicing of the tenascin primary transcript. Cell Adhes Commun 1994, 1:307-317[Medline]
  22. Borsi L, Balza E, Gaggero B, Allemanni G, Zardi L: The alternative splicing pattern of the tenascin-C pre-mRNA is controlled by the extracellular pH. J Biol Chem 1995, 11:6243-6245
  23. Borsi L, Allemanni G, Gaggero B, Zardi L: Extracellular pH controls pre-mRNA alternative splicing of tenascin-C in normal, but not in malignantly transformed cells. Int J Cancer 1996, 66:632-635[Medline]
  24. Winter G, Griffiths AD, Hawkins RE, Hoogenboom HR: Making antibodies by phage display technology. Annu Rev Immunol 1994, 12:433-455[Medline]
  25. Vaughan TJ, Williams AJ, Pritchard K, Osbourn JK, Pope AR, Earnshaw JC, McCafferty J, Hodits RA, Wilton J, Johnson KS: Human antibodies with sub-nanomolar affinities isolated from a large non-immunized phages display library. Nat Biotechnol 1996, 14:309-314[Medline]
  26. Aukhil I, Joshi P, Yan Y, Erickson P: Cell- and heparin-binding domains of the hexabrachion arm identified by tenascin expression proteins. J Biol Chem 1993, 268:2542-2553[Abstract/Free Full Text]
  27. Balza E, Siri A, Ponassi M, Caocci F, Linnala A, Virtanen I, Zardi L: Production and characterization of monoclonal antibodies specific for different epitopes of human tenascin. FEBS Lett 1993, 332:39-43[Medline]
  28. Carnemolla B, Balza E, Siri A, Zardi L, Nicotra MR, Bigotti A, Natali PG: A tumor-associated fibronectin isoform generated by alternative splicing of messenger RNA precursors. J Cell Biol 1989, 108:1139-1148[Abstract/Free Full Text]
  29. Castellani P, Viale G, Dorcaratto A, Nicolò G, Kaczmarek J, Querzé G, Zardi L: The fibronectin isoform containing the ED-B oncofetal domain: a marker of angiogenesis. Int J Cancer 1994, 59:612-618[Medline]
  30. Schaeren-Wiemers N, Gerfin-Moser A: A single protocol to detect transcripts of various sizes and expression levels in neural tissue and cultured cells: in situ hybridization using digoxigenin-labelled cRNA probes. Histochemistry 1993, 100:431-440[Medline]
  31. Ponassi M, Jacques ST, Ciani L, ffrench-Constant C: Expression of the rat homologue of the Drosophila fat tumour suppressor gene. Mech Dev 1999, 80:207-212[Medline]
  32. Riva P, Arista A, Tison V, Sturiale C, Franceschi G, Spinelli A, Riva N, Casi M, Moscatelli G, Frattarelli M: Intralesional radio-immunotherapy of malignant gliomas. Cancer 1994, 73:1076-1082[Medline]
  33. Bourdon MA, Wikstrand CJ, Furthmayr H, Matthews TJ, Bigner DD: Human glioma-mesenchymal extracellular matrix antigen defined by monoclonal antibody. Cancer Res 1983, 43:2796-2805[Abstract/Free Full Text]
  34. Riva P, Franceschi G, Arista A, Frattarelli M, Riva N, Cremonini AM, Giuliani G, Casi M: Local application of radiolabeled monoclonal antibodies in the treatment of high grade malignant gliomas. Cancer 1997, 80:2733-2742[Medline]
  35. Paganelli G, Magnani P, Zito F, Lucignani G, Sudati F, Truci G, Motti E, Terreni M, Pollo B, Giovannelli M, Canal N, Scotti G, Comi G, Koch P, Maecke HR, Fazio F: Pre-targeted immunodetection in glioma patients: tumour localization and single-photon emission tomography imaging of [99mTc]PnAO-biotin. Eur J Nuclear Med 1994, 21:314-321[Medline]
  36. Carnemolla B, Siri A, Borsi L, Zardi L: Tenascin in disease. Crossin KL eds. Tenascin and Counteradhesive Molecules of the Extracellular Matrix. 1996, :pp 89-108 Harwood Academic Publishers, Amsterdam
  37. Dörries U, Schachner M: Tenascin mRNA isoforms in the developing mouse brain. J Neurosci Res 1994, 37:336-347[Medline]
  38. Tucker RP, Spring J, Baumgartner S, Martin D, Hagios C, Poss PM, Chiquet-Ehrismann R: Novel tenascin variants with a distinctive pattern of expression in the avian embryo. Development 1994, 120:637-647[Abstract]
  39. Yokota T, Milenic DE, Whitlow M, Schlom J: Rapid tumor penetration of single-chain Fv and comparison with other immunoglobulin forms. Cancer Res 1992, 52:3402-3408[Abstract/Free Full Text]
  40. Yokota T, Milenic DE, Whitlow M, Wood JF, Hubert SL, Schlom J: Microautoradiographic analysis of the normal organ distributions of radioiodinated scFv and other immunoglobulin forms. Cancer Res 1993, 53:3776-3783[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Clin. Cancer Res.Home page
J. Marlind, M. Kaspar, E. Trachsel, R. Sommavilla, S. Hindle, C. Bacci, L. Giovannoni, and D. Neri
Antibody-Mediated Delivery of Interleukin-2 to the Stroma of Breast Cancer Strongly Enhances the Potency of Chemotherapy
Clin. Cancer Res., October 15, 2008; 14(20): 6515 - 6524.
[Abstract] [Full Text] [PDF]


Home page
JNMHome page
T. von Lukowicz, M. Silacci, M. T. Wyss, E. Trachsel, C. Lohmann, A. Buck, T. F. Luscher, D. Neri, and C. M. Matter
Human Antibody Against C Domain of Tenascin-C Visualizes Murine Atherosclerotic Plaques Ex Vivo
J. Nucl. Med., April 1, 2007; 48(4): 582 - 587.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. von Holst, U. Egbers, A. Prochiantz, and A. Faissner
Neural Stem/Progenitor Cells Express 20 Tenascin C Isoforms That Are Differentially Regulated by Pax6
J. Biol. Chem., March 23, 2007; 282(12): 9172 - 9181.
[Abstract] [Full Text] [PDF]


Home page
Protein Eng Des SelHome page
M. Silacci, S. S. Brack, N. Spath, A. Buck, S. Hillinger, S. Arni, W. Weder, L. Zardi, and D. Neri
Human monoclonal antibodies to domain C of tenascin-C selectively target solid tumors in vivo
Protein Eng. Des. Sel., October 1, 2006; 19(10): 471 - 478.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. S. Brack, M. Silacci, M. Birchler, and D. Neri
Tumor-targeting properties of novel antibodies specific to the large isoform of tenascin-C.
Clin. Cancer Res., May 15, 2006; 12(10): 3200 - 3208.
[Abstract] [Full Text] [PDF]


Home page
JNMHome page
M. Ferrari, M. Cremonesi, M. Bartolomei, L. Bodei, M. Chinol, M. Fiorenza, G. Tosi, and G. Paganelli
Dosimetric Model for Locoregional Treatments of Brain Tumors with 90Y-Conjugates: Clinical Application with 90Y-DOTATOC
J. Nucl. Med., January 1, 2006; 47(1): 105 - 112.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
J. Smith, R. E. Kontermann, J. Embleton, and S. Kumar
Antibody phage display technologies with special reference to angiogenesis
FASEB J, March 1, 2005; 19(3): 331 - 341.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. P. Venables
Aberrant and Alternative Splicing in Cancer
Cancer Res., November 1, 2004; 64(21): 7647 - 7654.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
L. Borsi, E. Balza, B. Carnemolla, F. Sassi, P. Castellani, A. Berndt, H. Kosmehl, A. Biro, A. Siri, P. Orecchia, et al.
Selective targeted delivery of TNF{alpha} to tumor blood vessels
Blood, December 15, 2003; 102(13): 4384 - 4392.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
T. Tsunoda, H. Inada, I. Kalembeyi, K. Imanaka-Yoshida, M. Sakakibara, R. Okada, K. Katsuta, T. Sakakura, Y. Majima, and T. Yoshida
Involvement of Large Tenascin-C Splice Variants in Breast Cancer Progression
Am. J. Pathol., June 1, 2003; 162(6): 1857 - 1867.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
P. Castellani, L. Borsi, B. Carnemolla, A. Biro, A. Dorcaratto, G. L. Viale, D. Neri, and L. Zardi
Differentiation between High- and Low-Grade Astrocytoma Using a Human Recombinant Antibody to the Extra Domain-B of Fibronectin
Am. J. Pathol., November 1, 2002; 161(5): 1695 - 1700.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
C. Halin, L. Zardi, and D. Neri
Antibody-Based Targeting of Angiogenesis
Physiology, August 1, 2001; 16(4): 191 - 194.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
H. Maseruka, A. Ridgway, A. Tullo, and R. Bonshek
Developmental Changes in Patterns of Expression of Tenascin-C Variants in the Human Cornea
Invest. Ophthalmol. Vis. Sci., December 1, 2000; 41(13): 4101 - 4107.
[Abstract] [Full Text]


Home page
J. Neurol. Neurosurg. PsychiatryHome page
A. PAU, A DORCARATTO, G L VIALE, P CASTELLANI, A SIRI, and L ZARDI
Oncofetal matrix glycoproteins in cerebral arteriovenous malformations and neighbouring vessels
J. Neurol. Neurosurg. Psychiatry, January 1, 2000; 68(1): 101 - 102.
[Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Carnemolla, B.
Right arrow Articles by Zardi, L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carnemolla, B.
Right arrow Articles by Zardi, L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS