| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |


From the Unité INSERM 370,*
CHU Necker and INSERM
U 257,
Institut Cochin de
Génétique Moléculaire, Paris, France
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
By differential screening of a human hepatocellular carcinoma cDNA library, we previously identified a gene named hepatocarcinoma-intestine-pancreas (HIP) whose expression was elevated in 25% of human primary liver cancers and was not detected in nontumoral liver tissues.4 By Northern analysis of a series of human adult tissues, we only found HIP expression in small intestine and pancreas. The HIP protein belongs to the C-type lectin family according to sequence homologies and its ability to bind lactose residues.5 Recently, we have shown that this protein is able to promote adhesion of hepatocytes and to bind laminin, an extracellular matrix protein.6 In contrast to the other C-type lectins that are multifunctional proteins, HIP is comprised of a single CRD linked to a signal peptide. Therefore, we previously proposed that HIP and related proteins belong to a new family of C-type lectins,4 and this protein family is now classified as the free CRD lectins (group VII).1 Several other proteins exhibiting the same structural features were isolated from pancreas and included in this group. In rat, three members of this lectin group are highly expressed during acute pancreatitis and called pancreatitis-associated protein (PAP1, PAP2, PAP3). Human and mouse cDNA encoding proteins homologous to rat PAP1 were isolated,7,8 and sequence identity research showed that human HIP and PAP genes were identical.9 We will thus refer to this gene as HIP/PAP. In addition, a rat putative growth factor peptide 23, identical to rat PAP1, is secreted by pituitary cells under the influence of growth-hormone-releasing hormone (GHRH).10 Thus, the same protein has been identified using several independent approaches. Although several roles have been proposed such as bacterial agglutination,11 cell adhesion,6 cell proliferation,10,4 and resistance to apoptosis,12 the in vivo function of HIP/PAP remains unclear.
In this view, it is important to investigate whether overexpression of HIP/PAP during hepatocarcinogenesis results of the reexpression of a fetal liver marker in tumorous cells as shown for alphafetoprotein,13 glutamin synthetase,14 and insulin-like growth factor II.15 The tissue specificity of HIP/PAP expression should be indeed interpretated taking into account the common embryonic origin of liver, pancreas, and intestine. In addition, the so-called oval liver cells, presumably of ductal origin, proliferate in rodents in response to various chemical carcinogens and are "pretumorous candidate cells" during liver carcinogenesis. They can differentiate into both pancreatic cells and hepatocytes16 and in certain conditions give rise to intestinal metaplasia.17 Conversely, rat pancreatic ductular cells can differentiate into hepatocytes following a copper-depletion regimen.18,19 We have therefore investigated by in situ hybridization the cell types involved in overexpression of HIP/PAP in liver tumor. We have also examined the pattern of expression of HIP/PAP in both mouse adult tissues (liver, intestine, and pancreas) and in postimplantation mouse embryos. We show that HIP/PAP gene is not broadly expressed during development but instead, presents a remarkably restricted expression pattern. In particular, we provide evidence of its expression in developing nervous system in addition to pancreas and small intestine. In contrast, we never detected HIP/PAP mRNA in fetal liver. Our results are therefore consistent with a role for HIP/PAP in neuronal as well as intestinal and pancreatic cell development.
| Materials and Methods |
|---|
|
|
|---|
Mouse HIP/PAP clone was obtained by reverse transcription (RT) of mouse small intestine RNA and amplification by polymerase chain reaction (PCR). The primers were derived from the mouse HIP/PAP sequence of Itoh and Terakoa8 and numbered as in this publication. A 488-bp fragment was amplified by Taq polymerase using a sense (5'TGGATGCTGCTCTCCTGCCT3', nt 3757) and an antisense (5'TTGCCCTATGTCTGCAAATTT3', nt 505525) primers. Samples were heated for 5 minutes at 94°C, and 40 cycles of amplification were performed with denaturation at 94°C for 1 minute, annealing at 55°C for 1 minute, and extended at 72°C for 1 minute, and the final cycle was identical except for 10 minutes extension. Reaction product was digested with EcoR1 and HindIII, subcloned into SK +pBluescript vector, and sequenced using T7/T3 primers. The sequence is identical to that previous published sequence.8 High specific activity RNA probes were synthetized using 35S-UTP (specific activity above 1000 Ci/mmol, Amersham, UK) and T3 RNA polymerase for antisense mouse and human HIP/PAP5 probes and T7 RNA polymerase for antisense Galectin 120 and sense mouse HIP/PAP probes.
In Situ Hybridization
Embryo and adult tissues were fixed overnight in 4% (w/w) paraformaldehyde, dehydrated, and embedded in paraffin wax; 7-µm sections were cut and hybridized with 35S-labeled antisense RNA probes using the procedure of Wilkinson et al21 with some modifications. Tissues and embryo sections were deparaffined in histoclear (twice for 10 minutes), rehydrated through a graded series of ethanol solutions (100 to 30%), rinsed in 0.85% saline solution (5 minutes), lx phosphate-buffered saline (PBS) (5 minutes), and postfixed in a freshly prepared solution of 4% paraformaldehyde in 1x PBS (20 minutes). Slides carrying sections were then rinsed in PBS (twice for 10 minutes) and treated with a fresh solution of proteinase K (20 µg/ml) in 50 mmol/L Tris Hcl, 5 mmol/L EDTA, pH 7.2) for 7.5 minutes. Slides were then rinsed in PBS (3 minutes), refixed in 4% paraformaldehyde solution in PBS, dipped in distilled water, and acetylated in 0.1 mol/L solution of triethanolamine and acetic anhydre (1:400 v/v) for 10 minutes. Slides were subsequently rinsed in 1x PBS and 0.85% saline solution (5 minutes each) and quickly dehydrated through a series of ethanol solutions (30 to 100%). Probes were applied directly to tissue sections (40 µl) at a final concentration of 100,000 cpm/µl in hybridization buffer (50% formamide, 0.3 mol/L NaCl, 10 mmol/L Tris HCL (pH 8), 5 mmol/L EDTA, 10 mmol/L NaPO4 (pH 8), 50 mmol/L dithiothreitol (DTT), 10% dextran sulfate, 1x Denhart's, 0.5 mg/ml of total yeast RNA). Hybridization was carried out at 52°C for 16 hours in a humid chamber. Coverslips were gently floated off in a solution of 5x SSC, 10 mmol/L DTT at 50°C, and the slides were then rinsed at 60°C in a stringent washing solution of 50% formamide, 2x SSC, 20 mmol/L DTT, treated with RNAse A (20 µg/ml) for 30 minutes at 37°C. After washes at 55°C in 2x SSC and 0.1x SSC (15 minutes each) sides were dehydrated in a series of ethanol containing 0.3 mol/L ammonium acetate and dipped in Ilford K5 emulsion. Exposure times varied from 6 to 15 days.
Northern Blot
Human small intestine obtained at surgery was immediately frozen in liquid nitrogen and stored at -80°C until used. Total RNA was extracted using the hot phenol method. Human liver fetal RNA was kindly provided by Clare Selden (Hammersmith Hospital, London, UK). RNA samples were run on a denaturing formaldehyde gel and transferred onto Hybond-C-extra nirocellulose membranes (Amersham, UK). The probe used to hybridize the filter was a DNA fragment corresponding to the human HIP/PAP gene coding sequence cloned in pBluescript in SmaI and EcorI sites.5 The insert was isolated before labeling. Filters were hybridized as previously described15 and washed in 2x SSC, 0.1% (w/w) sodium dodecyl sulfate at 42°C for 30 minutes. Human glucose 6 phosphate dehydrogenase cDNA was used as reference probe to verify the quantity of RNA transferred to the filters.
Reverse Transcription (RT) and Polymerase Chain Reaction (PCR)
RNA was extracted from embryonic tissues using a Promega kit following the recommended procedure. For adult tissues, RNA was extracted according to TRIZOL (Life Technology) supplied instructions. Primer used for RT and PCR were derived from the mouse published sequence of Itoh and Terakoa.8 To evaluate the amplifiability of RNA, RT was also performed with ß-actin primer. One microgram of RNA was reverse transcribed at 37°C for 60 minutes in 25 µl of final volume with 10 pmol of primer, 10 U of RNasin, 1x buffer supplied with the enzyme, 40 mmol/L of the four deoxynucleotides, and 20 U of Moloney murine leukemia virus reverse transcriptase (Life Technologies; Gibco BRL). Two antisense primers were used in the same reaction, the first is specific of mouse HIP/PAP (5'GACATGTGAGGTGAAGTTGCC3', nt 490510), whereas the second is specific of ß-actin (5'TTGGCCTTAGGGTTCAGGGGGG3'). Five microliters of cDNA were then amplified by two PCR assays performed in parallel, one for HIP/PAP and one for ß-actin, in a final volume of 100 µL containing 2.5 U of Taq polymerase (Life Technologies; Gibco BRL), 1x supplied buffer, 1.5 mmol/L MgCl2, 0.2 mmol/L each deoxyribonucleotide. HIP/PAP primers were sense (5'TCCAACAGCCTGCTCCGTCATG3', nt 1333) and antisense (5'CAGAAGCTCTTGACAAGCTGCCAC3', nt 457477). ß actin primers were antisense (5'TTGGCCTTAGGGTTCAGGGGGG3') and sense (5'CGTGGGCCGCCCTAGGCACCA3'). Samples were subjected to 40 cycles of PCR amplification (1 minute at 94°C, 1 minute at 58°C, 1 minute at 72°C). PCR products were transferred to a nylon membrane and hybridized with specific 32P-labeled oligonucleotide probes: 5'AAGGACTCCTATGTGGGTGACG3' for ß actin and '5'TCTACTGCCTTAGACCGTG3' (nt 416435) for HIP/PAP.
Neural tube was excised from 16.5 dpc embryos. RNA extraction and RT-PCR assays were performed as above. For nested PCR, two microliters of the amplification product obtained by HIP/PAP RT-PCR was reamplified with the inner primers (sense 5'ATGCTCTTATCTCAGGTTCAAG3', nt 5981) and antisense (5'TCTACTGCCTTAGACCGTG3', nt 416435) with the same protocol for a further 40 cycles. Nested PCR product was sequenced using the same primers.
All experiments were approved by local ethical committee.
| Results |
|---|
|
|
|---|
We have shown previously by Northern blot that the
HIP/PAP gene is not expressed in human adult liver, whereas
it is abundantly expressed in primary liver tumors. In order to
identify cells overexpressing HIP/PAP mRNHA in liver tumors,
we performed an in situ hybridization analysis of three
tumors that exhibit a strong expression of HIP/PAP transcripts. The
probe used in this experiment was the original human HIP/PAP
clone.4,5
We examined three human hepatocellular carcinomas
by in situ hybridization and in all cases we found that 10
to 50% of tumorous hepatocytes were intensely labeled, whereas no
signal was detected in adjacent nontumorous areas (Figure 1A)
. We also performed a Northern blot
analysis of HIP/PAP mRNA expression in several human fetal
liver samples from 9.6 to 21.5 weeks of pregnancy. The results shown in
Figure 1B
indicate that there is no detectable expression of
HIP/PAP in fetal liver, whereas a strong expression of this
gene is readily observed in human intestine.
|
We have previously reported by Northern blot analysis that at least in human tissues HIP/PAP transcripts distribution presents some degree of tissue-specificity. Thus, we found HIP/PAP mRNA in small intestine and pancreas but not in liver, colon, brain, kidney, or lung.4 In order to perform a more extensive and more sensitive analysis of HIP/PAP expression, we used in situ hybridization and RT-PCR methods on embryonic and adult mouse tissues. Primers used for RT-PCR were derived from the mouse cDNA HIP/PAP published sequence of Itoh and Terakoa.8 For in situ hybridization, a cDNA clone was amplified from mouse small intestine by RT-PCR and subcloned in pBLuescript vector; its sequence was done and found identical to the mouse cDNA HIP/PAP published sequence.8
No expression was detected by RT-PCR in embryos at days 8.5 (E8.5) and
10.5 (E10.5) (Figure 2
, lanes 1 and 2).
At E14.5 and E16.5, a strong signal was detected at the expected size
of 440 bp (Figure 2
, lanes 4 and 5). At E12.5 a weak signal was
detected in Southern blot autoradiography of the RT-PCR products
(Figure 2
, lane 3). Thus, HIP/PAP mRNA expression is
initiated at late stages of development.
|
In embryonic intestine, a strong punctate signal appeared (Figure 3, A and B)
at E16.5. At birth,
HIP/PAP expression was localized to epithelial villi cells
(Figure 3, C and D)
. In adults, we observed a strong signal in three
segments of small intestine: duodenum, jejunum, and ileum. The positive
cells were identified as enterocytes (Figure 3, E and F)
. Location of
HIP/PAP expression in villi cells was previously described
in rat adult intestine by immunocytochemistry.22
To
characterize the cell type expressing HIP/PAP in E16.5,
sections adjacent to those hybridized with the HIP/PAP probe
were stained with gremilius, a histological marker of goblet cells, and
with PAS-blue alcyan, a marker of neuroendocrine cells. The comparison
of neuroendocrine, goblet cells, and HIP/PAP expressing
cells distribution suggested that the small number of cells expressing
HIP/PAP might be neurodendocrine cells (data not shown).
This result is consistent with our previous observation of HIP/PAP
immunocytolocalisation in human intestine neuroendocrine
cells.6
It is interesting that unlike the mouse
HIP/PAP gene, the human homolog is mainly expressed in
Paneth cells.6
HIP/PAP mRNA was also detected by
RT-PCR assay in both E16.5 and adult intestine (Figure 2B
, lane 12 and
13).
|
|
|
HIP/PAP transcripts were first observed in the
developing nervous system from E14.5 onwards in the neural tube and the
spinal and trigeminal ganglia. On transverse sections, a strong
hybridization signal was detected in the ventral horns of the spinal
cord in a region that is occupied by motor neurons. This signal was
restricted to a very small number of cells, distributes all along the
anteroposterior axis in cervical (Figure 5, A and B)
as well as lumbar regions
(Figure 5, E and F)
. To better characterize the cells expressing
HIP/PAP mRNA, we hybridized adjacent sections with mouse
galectin 1 probe, a gene expressed in many tissues but specific for
motor neurons within the spinal cord.20
Figure 5
shows a
comparison of HIP/PAP and galectin 1 mRNA distribution in
E16.5 spinal cord at the lumbosacral level. The cluster of cells
expressing HIP/PAP (Figure 5, E and F)
was included in the
region positively stained for galectin 1 (Figure 5, G and H)
but
appeared to be restricted to a subpopulation of motor neurons. No
HIP/PAP signal was found in adult spinal cord regions highly
labeled with galectin 1 probe (data not shown). However, weak
HIP/PAP signals were revealed by Southern blotting of RT-PCR
products from newborn and adult spinal cord RNA (Figure 2
, lane 9 and
10). With E16.5 spinal cord, a strong RT-PCR signal was easily
detectable without autoradiography (Figure 2
, lane 8). To definitively
establish that HIP/PAP is expressed in the developing spinal
cord, we performed a nested PCR from an aliquot of the RT-PCR product
obtained using E16.5 neural tube RNA. As expected, the sequence of the
nested PCR product was identical to that previously reported by Itoh
and Terakoa.8
Thus, we clearly demonstrate that
HIP/PAP transcripts are present in the neurons of the late
gestation mouse embryo.
Finally, HIP/PAP transcripts were also detected in some
sensory neurons of the dorsal root ganglia (DRG) of E14.5 (data not
shown) and E16.5 (Figure 5, C and D)
. Figure 6
shows that in brain HIP/PAP
gene was very restrictively expressed in neural crest derivatives such
as trigeminal ganglia, whereas in other cerebral tissues such as
cerebral hemispheres, midbrain, and pituitary gland no signal was
detected (Figure 6, A and B)
. Moreover, higher magnification of
longitudinal section showed that, in trigeminal ganglia, only a few
cells, most likely sensory neurons, were intensively labeled (Figure 6, E and F)
.
|
| Discussion |
|---|
|
|
|---|
1-antitrypsin,28
(1,2)-fucosyltransferase,29
L -isoform of
carnitine palmitoyltransferase (CPT).30 The embryonic and adult expression profiles suggest a role for HIP/PAP in development and differentiation of intestinal epithelial cells. The epithelial cells lining the small intestine mucosa are renewed every 2 to 3 days in rodents. This renewal occurs by continuous division of a stem cell population located in intestinal crypt followed by migration and differentiation of daughter cells along the villus and final extrusion of senescent cells into the intestinal lumen. At E14.5 no HIP/PAP signal was observed in embryonic intestine at a time when the initial cytodifferentiation of the intestinal endoderm into an epithelial monolayer has not yet occurred, whereas a signal was detected at E16.5 when morphological waves of cytodifferentiation generate nascent villi.31,32 The data are therefore consistent with the role for HIP/PAP in this process.
We have previously shown by Northern blot analysis that HIP/PAP gene was not expressed in human adult liver, although it was abundantly expressed in many primary liver tumors. In situ hybridization analysis of three tumors showed that 10 to 50% of tumorous hepatocytes are intensely labeled, whereas no signal was detected in nontumorous areas adjacent to tumors. HIP/PAP expression in tumors might have been the consequence of hepatocytes dedifferentiation and expression of a liver fetal marker. However, this now seems unlikely: no expression was detected by Northern blot in several human fetal liver samples age 9.6 to 21.5 weeks. Similarly, in mouse, we showed by in situ hybridization analysis that HIP/PAP transcripts are not expressed in fetal liver from E10.5 to E16.5. RT-PCR allowed us to confirm the absence of HIP/PAP transcript at an early stage, E8.5, at the beginning of hepatic determination33 and at E10.5. Finally, at E16.5 fetal liver was isolated and no HIP/PAP expression was detected by RT-PCR. These results indicate that expression of HIP/PAP in hepatocellular carcinomas is not related to reexpression in tumorous hepatocytes of a gene normally expressed in fetus but instead is related to the liver carcinogenis.
One of the most striking results of our present study is the specific and intense expression of HIP/PAP in the embryonic nervous system. HIP/PAP is found in some cells of trigeminal ganglia, in DRG sensory neurons, and in the ventral horns of mouse spinal cord, a region occupied by motor neurons. In spinal cord, the signal is present in an area that also scores positive for galectin 1, a marker of motor neurons within this tissue. However, it is restricted to a small number of cells and seems distributed all along the ventral tube. Motor neurons located at different positions in the embryonic spinal cord project their axons to innervate distinct targets in the periphery, establishing a topography of motor connections.34 Molecular specificities of these neurons was demonstrated by Tsushida et al35 who showed that the expression pattern of four genes of the LIM homeobox gene family defines subclasses of motor neurons that segregate into different spinal cord columns and thus select distinct axonal pathways. It would be interesting to compare expression of HIP/PAP with that of the LIM genes. In any case our results indicate that HIP/PAP is a marker of a subset of the motor neurons. This observation provides an additional tool for understanding the mechanisms of neuronal differentiation.
In addition, HIP/PAP itself might play a role in neuron growth/guidance or survival. The importance of carbohydrates in neuronal migration during late embryonic life and their interaction with adhesion molecules such as neural cell adhesion molecules (N-CAM) is well established.36 At least one lectin has already been demonstrated to play a role in axonal guidance because the Galectin-1 null mutation affects the outgrowth and/or guidance of a subset of olfactory neurons.37 Lectins might mediate by cross-linking of carbohydrate ligands present on neurons and promote axonal adhesion of these neurons to laminin sugar chains.38 Moreover laminin, which promotes neurite outgrowth in vitro is present in the pathways through which central and peripherical axons project to their cellular targets. The localization of HIP/PAP in motor neurons and DRG and the ability of this lectin to bind laminin5 suggest that HIP/PAP might be a new lectin implicated in axonal guidance and/or growth. In this regard, it is also interesting that HIP/PAP (which is also called Reg-2) was recently isolated in a search for genes expressed in regenerating rat motor neurons and likely acts as a Schwann cell mitogen in vitro.39
In summary, our data suggest that HIP/PAP might be involved during development in the differentiation processes of neuronal, pancreatic, and intestinal cells. Furthermore, its high expression in liver cancer and not in fetal liver also suggest that HIP/PAP might participate in the expansion of liver cells during liver carcinogenesis.
| Acknowledgements |
|---|
| Footnotes |
|---|
Supported in part by Institut National de la Santé et de la Recherche Médicale, Association pour la Recherche Contre le Cancer, and Ligue Nationale Contre le Cancer.
Accepted for publication January 23, 1999.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M.-T. SIMON, A. PAULOIN, G. NORMAND, H.-T. LIEU, H. MOULY, G. PIVERT, F. CARNOT, J. G. TRALHAO, C. BRECHOT, and L. CHRISTA HIP/PAP stimulates liver regeneration after partial hepatectomy and combines mitogenic and anti-apoptotic functions through the PKA signaling pathway FASEB J, August 1, 2003; 17(11): 1441 - 1450. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |