help button home button Am J Pathol ASIP MEMBERSHIP
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Watari, M.
Right arrow Articles by Strauss, J. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Watari, M.
Right arrow Articles by Strauss, J. F., III
(American Journal of Pathology. 1999;154:1755-1762.)
© 1999 American Society for Investigative Pathology


Regular Articles

Pro-Inflammatory Cytokines Induce Expression of Matrix-Metabolizing Enzymes in Human Cervical Smooth Muscle Cells

Michiko Watari*, Hidemichi Watari*, Michael E. DiSanto{dagger}, Samuel Chacko{dagger}, Guo-Ping Shi§ and Jerome F. Strauss, III*

From the Center for Research on Reproduction and Women's Health*
and the Department of Urology,{dagger}
University of Pennsylvania Medical Center, Philadelphia, Pennsylvania, and the Division of Pulmonary and Critical Care Medicine,§
Brigham and Women's Hospital and Harvard Medical School, Boston, Massachusetts


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The process of cervical ripening has been likened to an inflammatory reaction associated with the catabolism of cervical extracellular matrix by enzymes released from infiltrating leukocytes. We hypothesized that smooth muscle cells in the cervix also participate in this process and that pro-inflammatory cytokines act on cervical smooth muscle cells (CSMC) to provoke the expression of matrix-degrading enzymes. We treated primary cultures of human CSMC with tumor necrosis factor-{alpha} (TNF-{alpha}) and examined expression of the elastinolytic enzyme, cathepsin S, the collagen metabolizing matrix metalloproteinases (MMP)-1, -3, -9, and the tissue inhibitor of metalloproteinase (TIMP)-1 and -2. A time course analysis revealed that 10 ng/ml of TNF-{alpha} induced cathepsin S, MMP-1, -3, and -9 mRNA expression with the maximal response observed after 24–48 hours. TNF-{alpha} induced cathepsin S, MMP-1, -3, and -9 mRNA expression in a dose-dependent manner: the maximal effect was observed at a concentration of 10 ng/ml, with appreciable increases observed at concentrations of 0.1 to 1.0 ng/ml. In contrast, TIMP-1 and -2 mRNAs were not significantly increased by TNF-{alpha} treatment. Interleukin-1ß produced a pattern of gene expression in the CSMC similar to that observed following TNF-{alpha} treatment. Western blot analysis and zymography confirmed the induction of proMMP-1, -3, and -9 in response to TNF-{alpha}, but MMP-2 immunoreactivity and zymographic activity were unaffected. TNF-{alpha} increased secretion of procathepsin S, but did not affect TIMP-1 and reduced TIMP-2 production. We conclude that CSMC are targets of pro-inflammatory cytokines, which induce a repertoire of enzymes capable of degrading the cervical extracellular matrix. The induction of these enzymes may facilitate the normal ripening of the cervix at term and participate in the premature cervical changes associated with preterm labor.



    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The human cervix is composed primarily of connective tissue consisting mainly of fibrillar collagens, elastin, and glycosaminoglycans.1 Smooth muscle cells and fibroblasts are among the major resident cell types.1 In preparation for parturition, the cervix undergoes striking biochemical and structural changes that produce softening and later effacement and dilatation.2 These changes in the cervix, referred to as cervical ripening, are associated with increased vascularity of the tissue, an increase in water content, disorganization of the collagen fibrils, a decline in collagen and elastin contents, and a marked rise in heparan sulfate and hyaluronic acid.3 The profound remodeling of the cervical extracellular matrix occurs coincidentally with a dramatic influx of white blood cells.4,5 Thus, the process of cervical ripening has been likened to an inflammatory response.

The restructuring of the cervical extracellular matrix has been attributed to the release of proteases from invading white blood cells and from cervical fibroblasts.4-7 Pro-inflammatory cytokines are believed to participate in this process.8,9 The cellular targets of these cytokines may include other resident cells in the cervix, because interleukin (IL)-1{alpha} has been reported to increase the production of an elastase-like enzyme from human cervical fibroblasts10 as well as matrix metalloproteinases (MMPs).11 There are, however, no reported studies on matrix-metabolizing enzyme expression by human cervical smooth muscle cells (CSMC).

Several enzymes could potentially be involved in the extracellular matrix remodeling associated with cervical ripening, including the MMPs that degrade fibrillar collagen, MMP-1 and MMP-13, which are produced by mesenchymal as well as some epithelial cells, and leukocyte collagenase, MMP-8.12 Leukocytes also produce a distinct elastase.13 Cathepsins, lysosomal cysteine proteinases, also display elastase activity. Among the cathepsins, cathepsin S is a potential candidate enzyme involved in cervical elastin metabolism because of its potent elastinolytic activity at neutral pH.14 Elastin can also be broken down by MMP-9, an enzyme produced by various cell types including leukocytes. In addition, MMP-2 and MMP-9 hydrolyze collagen fragments produced by the action of the interstitial collagenases.12

In the experiments reported here, we tested the hypothesis that pro-inflammatory cytokines regulate the expression of matrix-degrading enzymes by CSMC. We report that tumor necrosis factor-{alpha} (TNF-{alpha}) and IL-1ß stimulate the expression of matrix-degrading MMPs and cathepsin S, suggesting that release of protease from CSMC plays a role in the normal process of cervical ripening as well as the premature changes in cervical structure associated with preterm labor.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell Culture

Human CSMC isolated from uteri of nonpregnant women removed for benign disease were purchased from Clonetics (San Diego, CA). The CSMC were grown in Smooth Muscle Cell Growth Medium-2 basal medium supplemented with 5% fetal bovine serum (Clonetics). This medium contains human epidermal growth factor (0.5 ng/ml), human fibroblast growth factor (1.0 ng/ml), insulin (5 µg/ml), gentamicin (50 µg/ml), and amphotericin B (50 µg/ml) at 37°C under an atmosphere of 5% CO2 in air. Subcultures of CSMC from passages 3–7 were used in all of the experiments. Before each experiment, CSMC were cultured in medium supplemented with 1% fetal bovine serum or serum-free medium for 24 hours. CSMC were cultured for the indicated times with or without recombinant human TNF-{alpha} or IL-1ß (R & D Systems, Minneapolis, MN).

RNA Isolation and Northern Blot Analysis

Subconfluent cultures of CSMC were grown in medium supplemented with 1% fetal bovine serum for 24 hours before treatment with TNF-{alpha} (0.01–20 ng/ml) or IL-1ß (10 ng/ml) for up to 48 hours. Total RNA was extracted from the cultures with Trizol reagent (Gibco-BRL, Grand Island, NY) using procedures recommended by the manufacturer. Equal amounts of RNA (40 µg/lane) were separated on 1% agarose-formaldehyde denaturing gels, transferred to nylon membranes, and hybridized sequentially with 32P-labeled cathepsin S, MMP-1, MMP-3, MMP-9, and TIMP-1 and TIMP-2 cDNAs at 42°C for 16–18 hours, followed by two sequential washings for 10 minutes in 2X SSPE, 0.1% sodium dodecyl sulfate (SDS) at 37°C, and two washings in 0.1X SSPE, 0.1% SDS at 55°C. Blots were exposed to Kodak X-Omat AR film and then analyzed with a phosphoimager (Molecular Dynamics, Sunnyvale, CA) for quantitation. The relative abundance of mRNAs was normalized to 28S rRNA.

Reverse Transcription-Polymerase Chain Reaction (RT-PCR)

Total RNA extracted from human WISH cells was used for RT-PCR to generate the cathepsin S cDNA probe and total RNA extracted from CSMC was used to generate the MMP-1, -3, -9, and TIMP-1 and -2 cDNAs. RNA was reverse transcribed to produce cDNA using reverse transcriptase (Promega, Madison, WI) and oligo dT as a primer. The cDNAs for cathepsin S, MMP-1, -3, -9, and TIMP-1 and -2 were amplified using 10% of the RT reaction in 100 µl containing 50 pmol forward primer, 50 pmol reverse primer, and 5 U Taq polymerase (Perkin-Elmer, Foster City, CA), with 0.2 mmol/L dNTPs and 1.5 mmol/L MgCl2. The sequences of the synthesized primers and the expected sizes of the PCR products are shown in Table 1 . PCR was performed in a 9600 GeneAmp PCR thermal cycler using the following conditions: for cathepsin S and MMP-9, 94°C (1 minute) for 1 cycle, 94°C (1 minute), 57°C (1 minute), 72°C (1 minute) for 30 cycles, and the final incubation at 72°C for 7 minutes; for MMP-1, 94°C (1 minute) for 1 cycle, 94°C (1 minute) 63°C (1 minute), 72°C (2 minutes) for 30 cycles, and final incubation at 72°C for 7 minutes; for MMP-3, 94°C (1 minute), 57°C (1 minute), 72°C (2 minutes) for 30 cycles, and final incubation at 72°C for 7 minutes; for TIMP-1 and -2, 94°C (1 minute), 57°C (1 minute), 72°C (1 minute) for 30 cycles, and final incubation at 72°C for 7 minutes. The PCR products were ligated into either PCR 3.1 or PCR 2.1 vector (Invitrogen, Carlsbad, CA), and the sequences were confirmed. To obtain the inserts for Northern blotting, the plasmids were digested with BamHI and KpnI (cathepsin S) or EcoRI (MMPs and TIMPs) and the inserts were purified using a gel extraction kit (Qiagen, Stanford, CA) before labeling by the random prime method.


View this table:
[in this window]
[in a new window]
 
Table 1. Nucleotide Sequences of the Primers Used for RT-PCR

 
For RT-PCR analysis of the expression of smooth muscle-specific myosin heavy chain and 17-kd light chain mRNAs, total RNA (3.5 µg) was reverse transcribed using oligo (dT) primers. Aliquots (20 µl) of the PCR product were resolved in 2% agarose gels and visualized after ethidium bromide staining. Band intensities were quantitated by scanning densitometry using a Bio-Rad GS-700 imaging densitometer (Bio-Rad, Hercules, CA). Primers used for RT-PCR analysis of the expression of transcripts for smooth muscle specific proteins were, for smooth muscle myosin heavy chain SM1 and SM2, upstream 5'GCTGGAGGAGGCCGAGGAGGAGTC3', downstream 5'GAGCCATCTGCGTTTTCAATAA3', predicted product sizes (SM1) 206 bp and (SM2) 245 bp; for smooth muscle myosin essential light chains LC17a and LC17b, upstream 5'GACCGTGGCGAAGAACAA3', downstream 5'CAGCCATTCAGCACCATCCG3', predicted product sizes (LC17a) 232 bp and (LC17b) 276 bp. RT-PCR was also performed using upstream primer 5'AACACTTTCCTGCTCCTC3' and downstream primer 5'GCTTTGGCTAGGAATGAT3', which could anneal with the 3' untranslated region of human smooth muscle {alpha}-smooth muscle actin cDNA.

Western Blot Analysis

Cathepsin S, MMP-1, -2, -3, and TIMP-1 and -2 in conditioned medium were analyzed by Western blotting.15 CSMC were cultured in serum-free medium for 24 hours, and then treated with TNF-{alpha} (10 ng/ml) for 48 hours. The conditioned medium, normalized to equal numbers of cells for each treatment group, was collected and concentrated under vacuum at -50°C. The samples were subjected to Western blotting using a rabbit polyclonal antibody raised against human cathepsin S,16 and mouse monoclonal antibodies raised against human MMP-1, -2, -3, and TIMP-1 and -2 (Calbiochem, La Jolla, CA). The Amersham enhanced chemiluminescence system (Amersham Life Sciences, Arlington Heights, IL) was used to detect antibody bound to antigen.

Zymography

CSMC were cultured in serum-free medium for 24 hours before treatment with TNF-{alpha} (10 ng/ml). The conditioned medium was collected after 48 hours of treatment and concentrated under vacuum at -50°C. The aliquots normalized to equal numbers of cells were then subjected to SDS polyacrylamide gel electrophoresis in 7.5% or 10% polyacrylamide gels containing 1 mg/ml gelatin or casein under nonreducing conditions.17 After washing the gels in 2.5% Triton-X 100 (15 minutes x 2) to remove the SDS, the gels were incubated in a buffer containing 50 mmol/L Tris-HCl, pH 7.4, 30 mmol/L CaCl2, 150 mmol/L NaCl at 37°C for 16–18 hours. The gels were then stained with Coomassie Brilliant Blue G250 and destained in a solution consisting of 10% methanol, 10% acetic acid, and 10% glycerol.

Immunocytochemistry

The presence of smooth muscle {alpha}-actin in the CSMC was detected by immunocytochemistry with a monoclonal antibody and immunoperoxidase technique using reagents purchased from Sigma Chemical Co. (St. Louis, MO). Immunostaining was carried out according to the supplier's protocol. Controls included incubations in the absence of the primary antibody.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Characterization of Human CSMC

The CSMC grew as spindle-shaped cells in culture. Virtually all of these cells stained positively for the smooth muscle cell marker, smooth muscle {alpha}-actin. (Figure 1) . We also carried out an RT-PCR analysis for smooth muscle cell-specific transcripts encoding myosin heavy chains and 17-kd light chains (Figure 2) .18 Using primers to specifically amplify transcripts for SM1 and SM2, myosin heavy chain isoforms that are different at the C-terminal region,19,20 we found that the CSMC expressed predominantly SM1. The analysis of myosin light chain transcripts indicated that the cultured CSMC had a light chain pattern consisting of 74% LC17b, which is smooth muscle-specific, and 26% of the LC17a isoform, which is expressed by both smooth muscle and non-muscle cells in humans.21 The primers for actin amplified human smooth muscle {alpha}-actin cDNA. Collectively, these observations that the CSMC express transcripts characteristic of smooth muscle20,22 document that the cells studied were members of the smooth muscle lineage.



View larger version (157K):
[in this window]
[in a new window]
 
Figure 1. Immunocytochemical detection of {alpha}-smooth muscle actin in CSMC. A: Cells stained with a monoclonal antibody recognizing human {alpha}-smooth muscle actin. Red immunoprecipitate identifies {alpha}-smooth actin positive cells. B: Control preparation processed without primary antibody. Scale bar, 10 µm.

 


View larger version (32K):
[in this window]
[in a new window]
 
Figure 2. Analysis of CSMC for expression of smooth muscle-specific myosin heavy chain and 17-kd light chains mRNAs. Smooth muscle-specific PCR primers (SM1/SM2; Lane 1) and (LC17a/LC17b; Lane 2) were used to competitively amplify cDNA derived from CSMC. Human smooth muscle {alpha}-actin was also amplified (Lane 3) as described in Materials and Methods. A 100-bp DNA ladder was used as a molecular size standard (M).

 
TNF-{alpha} Increased the Expression of MMP-1, -3, -9, and Cathepsin S but not TIMP-1 and -2 mRNAs in CSMC

TNF-{alpha} at a dose of 10 ng/ml increased the steady state levels of MMP-1, -3 and -9 and cathepsin S mRNAs over a 48-hour incubation (Figure 3) . Significant increases in the transcripts were seen within 6 hours after addition of the cytokine. In contrast, transcripts encoding TIMP-1 and TIMP-2 were only modestly affected. The effects of TNF-{alpha} on mRNA expression were dose-dependent (Figure 4) . An increase in MMP-3 mRNA was evident at a TNF-{alpha} concentration of 0.1 ng/ml. Increases in MMP-1 and -9 and cathepsin S mRNA levels were evident at a TNF-{alpha} dose of 1.0 ng/ml. Maximal up-regulation of the MMP and cathepsin S mRNAs occurred at doses of 10–20 ng/ml. In contrast, the higher concentrations of TNF-{alpha} did not affect TIMP-1 mRNA and reduced expression of the primary 3.5-kb TIMP-2 transcript.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 3. Effect of TNF-{alpha} on the time course of expression of MMP, TIMP and cathepsin S mRNAs. A Northern blot analysis of total RNA (40 µg/lane) extracted from CSMCs cultured in the absence (Control) or presence of TNF-{alpha} (10 ng/ml) for the indicated time periods is shown. The blot was sequentially probed with the indicated cDNAs.

 


View larger version (44K):
[in this window]
[in a new window]
 
Figure 4. Effect of TNF-{alpha} dose on expression of MMP, TIMP, and cathepsin S mRNAs. A Northern blot analysis of total RNA (40 µg/lane) extracted from CSMC cultured in the absence (0) or presence of different concentrations of TNF-{alpha} for 48 hours is shown. The blot was sequentially probed with the indicated cDNAs.

 
The mean changes in steady state mRNA abundance for the transcripts studied after 48 hours of TNF-{alpha} treatment at a dose of 10 ng/ml from three independent experiments are presented in Table 2 . The mean increases in MMP-1, -3, and -9 and cathepsin S mRNAs were >10-fold.


View this table:
[in this window]
[in a new window]
 
Table 2. Effects of TNF-{alpha} on Steady-State Abundance of MMP, TIMP, and Cathepsin S mRNAs

 
TNF-{alpha} Stimulated Secretion of Matrix-Degrading Enzymes but not TIMPs

Western blot analysis revealed increased levels of proMMP-1 (57 kd) and proMMP-3 (59 kd) in conditioned medium of CSMC treated with TNF-{alpha} (Figure 5) . In contrast, levels of proMMP-2 in the conditioned medium were unaffected by cytokine treatment. The levels of TIMP-1 and -2 in the conditioned medium were unaffected or lower, respectively, following cytokine treatment.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 5. MMP and TIMP production by CSMC cultured in the absence or presence of TNF-{alpha}. Cells were incubated without or with TNF-{alpha} (10 ng/ml) for 48 hours in serum-free medium and aliquots of conditioned media were analyzed by Western blotting using specific monoclonal antibodies as described in Materials and Methods.

 
Casein zymography corroborated the increased release of proMMP-1 and proMMP-3 in response to TNF-{alpha} (Figure 6) . Gelatin zymography showed the up-regulation of proMMP-9 (92- and 170-kd monomer and dimer). The gelatin zymograms also confirmed that MMP-2 was unaffected by the cytokine treatment.



View larger version (39K):
[in this window]
[in a new window]
 
Figure 6. Zymographic analysis of proteinases secreted by CSMC. Conditioned media from CSMC cultured in the absence or presence of TNF-{alpha} (10 ng/ml) as described in the legend for Figure 5 were analyzed by zymography in gels impregnated with either gelatin (A) or casein (B). TNF-{alpha} increased the production of a gelatinase representing the proforms of MMP-9 revealed as lysis bands at 92 and 170 kd (arrowheads). MMP-2 activity (68- and 72-kd lysis bands) was not affected. TNF-{alpha} treatment also increased production of proMMP-3 (59 kd) and proMMP-1 (57 kd) revealed in zymograms of casein-impregnated gels (arrowheads).

 
To investigate the production of cathepsin S, we performed Western blot analysis on cell lysates and the conditioned medium collected after the treatment of CSMC with TNF-{alpha} (10 ng/ml) for 48 hours. Active cathepsin S (28 kd) was detected in cell lysates from control and TNF-{alpha}-treated cells, whereas procathepsin S (~37 kd) protein was detected only in conditioned medium from cultures treated with TNF-{alpha} (Figure 7) .



View larger version (42K):
[in this window]
[in a new window]
 
Figure 7. Production of cathepsin S by CSMC. Cells were cultured in the absence or presence of TNF-{alpha} (10 ng/ml) as described in the legend for Figure 5 . Cell lysates and conditioned media were analyzed by Western blotting for cathepsin S protein. TNF-{alpha} treatment increased the abundance of procathepsin S in conditioned media.

 
IL-1ß Induced Expression of Matrix-Degrading Enzymes in CSMC

To determine whether the responses of CSMC to TNF-{alpha} are representative of responses to other pro-inflammatory cytokines, we treated CSMC cultures with IL-1ß and examined expression of MMP, TIMP, and cathepsin S mRNAs. IL-1ß treatment provoked a pattern of gene expression that paralleled that observed following TNF-{alpha} treatment: MMP-1, -3, and -9 and cathepsin S mRNAs were increased, whereas TIMP-1 and -2 mRNAs were not (Figure 8) . Table 3 presents the change in MMP, TIMP, and cathepsin S mRNAs relative to controls from three independent experiments in which CMSC were treated with IL-1ß for 48 hours at a concentration of 10 ng/ml.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 8. Effects of IL-1ß on expression of MMP, TIMP, and cathepsin S mRNAs. A Northern blot analysis of total RNA (40 µg/lane) extracted from CSMC cultured in the absence (Control) or presence of IL-1ß (10 ng/ml) for the indicated time periods is shown. The blot was sequentially probed with the indicated cDNAs.

 

View this table:
[in this window]
[in a new window]
 
Table 3. Effects of IL-1ß on Steady-State Abundance of MMP, TIMP, and Cathepsin S mRNAs

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The experiments reported here were conducted to determine whether smooth muscle cells in the cervix are capable of participating in the remodeling of the uterine cervix extracellular matrix and if the matrix-degrading potential of these cells is elicited in response to pro-inflammatory cytokines. Previous investigators interested in matrix-degrading enzymes in uterine tissue have focused attention on the process of postpartum uterine involution in laboratory animal models.23-29 To our knowledge, our experiments represent the first characterization of expression of these enzymes in a human uterine smooth muscle cell system. Our findings clearly demonstrate that human CSMC in culture can express a repertoire of proteinases that can hydrolyze the main constituents of the cervical extracellular matrix, including fibrillar collagens (MMP-1) and elastins (MMP-9 and cathepsin S). Moreover, the expression of these genes was markedly up-regulated in response to TNF-{alpha} and IL-1ß, cytokines that may participate in the normal process of cervical ripening or the premature remodeling of the cervix associated with preterm labor.4,5 We also obtained preliminary evidence for CSMC expression of MMP-13, an enzyme that degrades fibrillar collagens and also activates MMP-9 (unpublished observations). The abundance of MMP-13 mRNA was much lower than that of MMP-1, -3, and -9 mRNAs but, like these other MMP transcripts, MMP-13 message levels in the CSMC were increased by cytokine treatment. These findings support the concept that resident cells in the cervix, in addition to leukocytes that infiltrate the cervix during cervical ripening, play roles in extracellular matrix catabolism.

The increase in MMP expression in response to pro-inflammatory cytokine treatment appears to be restricted to MMPs whose promoters contain AP-1 and Ets binding sites. These include the MMP-1, -3, and -9 and cathepsin S genes.16,30,31 In contrast, the MMP-2 gene does not contain these cis elements and MMP-2 expression was not increased by cytokine treatment. Thus, the cytokine-triggered up-regulation of expression of matrix-degrading enzymes may be the result of transcriptional activation mediated by a shared network of transcription factors.

The CSMC responded to TNF-{alpha} with increased production of the proenzyme forms of MMP-1, -3, and -9 and cathepsin S. These proenzymes must be activated to catalyze matrix degradation and it is presumed that activation of one or several of these proteinases (eg, MMP-3 and MMP-13) may result in the activation of the others, as a number of the MMPs have been reported to activate other members of the MMP family.32 Our study does not disclose potential mechanisms of proenzyme activation.

The activities of MMPs are restrained by TIMPs.33,34 It is notable that although cytokine treatment increased expression of certain MMPs, TIMP-1 and TIMP-2 expression was either unaffected or reduced, dramatically shifting the ratio of enzymes to inhibitors. Because we did not assess all four known members of the TIMP family of proteins, or the expression of other enzyme inhibitors, including {alpha}2-macroglobulin and the cathepsin inhibitors, the cystatins, we do not know whether the failure of TIMP-1 and TIMP-2 to respond to cytokine treatment reflects a generalized shift in the balance of proteinases to their respective endogenous inhibitors. It is notable that Rechberger and Woessner35 reported dramatically increased levels of collagenase activity in the cervix during labor with a much less striking increase in TIMP-1 and {alpha}2-macroglobulin levels. These observations are consistent with our findings on CSMC in culture. Moreover, we have demonstrated cathepsin S and MMP-1 and -3 protein in CSMC in human cervical tissue removed at term by immunohistochemistry (M. Watari, E.E. Furth, and J.F. Strauss, III, unpublished observations). The latter findings demonstrate that these enzymes are produced by CSMC in situ. The demonstration of in situ expression of these enzymes is important because smooth muscle cell migration in culture36 or serial cell passage37 could influence MMP expression.

Our findings that pro-inflammatory cytokines increase expression of MMPs in CSMC are similar to, yet different from, reported studies on cervical fibroblasts.11,38 Pro-inflammatory cytokines increase MMP-1 and -3 mRNAs but not MMP-2 expression in both cell types. In contrast, TIMP expression is also increased in cervical fibroblasts but not in CSMC. This disparity may reflect fundamental differences between fibroblasts and smooth muscle cells.

In summary, we have obtained evidence supporting a key role for CSMC in restructuring of the cervical extracellular matrix and documented that pro-inflammatory cytokines can trigger the expression of a number of genes that can act in concert to hydrolyze fibrillar collagen and elastin. We propose that CSMC participate in the normal processes of cervical ripening as well as the premature cervical changes associated with preterm labor.


    Acknowledgements
 
We thank Ms. Judith Wood for help in preparation of this manuscript.


    Footnotes
 
Address reprint requests to Jerome F. Strauss, III, M.D., Ph.D., 1355 BRBII, 421 Curie Boulevard, Philadelphia, PA 19104. E-mail: jfs3{at}mail.med.upenn.edu

Supported by National Institutes of Health grant HD34612 (J.F.S.) and American Heart Association Scientist Development Grant 9730157N (G-P.S.).

Accepted for publication March 11, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Danforth DN: The morphology of the human cervix. Clin Obstet Gynecol 1983, 26:7-13[Medline]
  2. Liggins GC: Cervical ripening as an inflammatory reaction. The Cervix in Pregnancy and Labour. DA Ellwood, ABM Anderson, eds. Edinburgh, Churchill Livingstone, 1981, pp 1–9
  3. Uldbjerg N, Ekman G, Malmstrom A, Olsson K, Ulmsten U: Ripening of the human uterine cervix related to changes in collagen, glycosaminoglycans, and collagenolytic activity. Am J Obstet Gynecol 1983, 147:662-666[Medline]
  4. Junqueira LC, Zugaib M, Montes GS, Toledo OM, Krisztan RM, Shigihara KM: Morphologic and histochemical evidence for the occurrence of collagenolysis and for the role of neutrophilic polymorphonuclear leukocytes during cervical dilation. Am J Obstet Gynecol 1980, 138:273-281[Medline]
  5. Osmers R, Rath W, Adelmann-Grill BC, Fittkow C, Kuloczik M, Szeverenyi M, Tschesche H, Kuhn W: Origin of cervical collagenase during parturition. Am J Obstet Gynecol 1992, 166:1455-1460[Medline]
  6. Rajabi M, Dean DD, Beydoun SN, Woessner JF, Jr: Elevated tissue levels of collagenase during dilation of uterine cervix in human parturition. Am J Obstet Gynecol 1988, 159:971-976[Medline]
  7. Kanayama N, Terao T: The relationship between granulocyte elastase-like activity of cervical mucus and cervical maturation. Acta Obstet Gynecol Scand 1991, 7:29-34
  8. El Maradny E, Kanayama N, Halim A, Maehara K, Sumimoto K, Terao T: The effect of interleukin-1 in rabbit cervical ripening. Eur J Obstet Gynecol Reprod Biol 1995, 60:75-80[Medline]
  9. El Maradny E, Kanayama N, Halim A, Maehara K, Sumimoto K, Terao T: Biochemical changes in the cervical tissue of rabbit induced by interleukin-8, interleukin-1ß, dehydroepiandrosterone sulphate and prostaglandin E2: a comparative study. Human Reprod 1996, 11:1099-1104[Abstract/Free Full Text]
  10. Ito A, Leppert PC, Mori Y: Human recombinant interleukin-1{alpha} increases elastase-like enzyme in human uterine cervical fibroblasts. Gynecol Obstet Invest 1990, 30:239-241[Medline]
  11. Ito A, Sato T, Ojima Y, Chen C-L, Nagase H, Mori Y: Calmodulin differentially modulates the interleukin-1-induced biosynthesis of tissue inhibitor of metalloproteinases and matrix metalloproteinases in human uterine cervical fibroblasts. J Biol Chem 1991, 266:13598-13601[Abstract/Free Full Text]
  12. Woessner JF, Jr: The family of matrix metalloproteinases. Ann NY Acad Sci 1994, 732:11-21[Medline]
  13. Shapiro SD, Senior RM: Macrophage elastase (MMP-12). Matrix Metalloproteinases. WC Park, RP Mecham, eds. San Diego, Academic Press, 1998, pp 185–197
  14. Shi G-P, Munger JS, Meara JP, Rich DH, Chapman HA: Molecular cloning and expression of human alveolar macrophage cathepsin S, an elastinolytic cysteine protease. J Biol Chem 1992, 267:7258-7262[Abstract/Free Full Text]
  15. Towbin H, Staehelin T, Gordon J: Electrophoretic transer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci USA 1979, 76:4350-4354[Abstract/Free Full Text]
  16. Sukhova GK, Shi G-P, Simon DI, Chapman HA, Libby P: Expression of the elastolytic cathepsins S and K in human atheroma and regulation of their production in smooth muscle cells. J Clin Invest 1998, 102:576-583[Medline]
  17. Lei H, Vadillo-Ortega F, Paavola, LG, Strauss III JF 92-kd gelatinase (matrix metalloproteinase-9) is induced in rat amnion immediately prior to parturition. Biol Reprod 1995, 53:339–344
  18. DiSanto ME, Cox RH, Wang Z, Chacko S: Expression of myosin isoforms in smooth muscle cells in the corpus cavernosum penis. Am J Physiol (Cell Physiol) 1997, 272:C1532-C1542[Abstract/Free Full Text]
  19. Nagai R, Kuro-o M, Babij P, Periasamy M: Identification of two types of smooth muscle myosin heavy chain isoforms by cDNA cloning and immunoblot analysis. J Biol Chem 1989, 264:9734-9737[Abstract/Free Full Text]
  20. Matsuoka R, Yoshida MC, Furutani S, Imamura N, Kanda N, Yanagisawa M, Masaki T, Takao A: Human smooth muscle myosin heavy chain gene mapped to chromosomal region 16q12. Am J Med Genet 1993, 46:61-67[Medline]
  21. Morano I, Koehlen S, Haase H, Erbb G, Baltas LG, Rimbach S, Wallwiener D, Bastert G: Alternate splicing and cycling kinetics of myosin change during hypertrophy of human smooth muscle cells. J Cell Biochem 1997, 64:171-181[Medline]
  22. Lenz S, Lohse P, Seidel U, Arnold H-H: The alkali light chains of human smooth and nonmuscle myosins are encoded by a single gene: tissue-specific expression by alternative splicing pathways. J Biol Chem 1989, 264:9009-9015[Abstract/Free Full Text]
  23. Jeffrey JJ: Collagen and collagenase: pregnancy and parturition. Sem Perinatology 1991, 15:118-1126
  24. Wilcox BD, Dumin JA, Jeffrey JJ: Serotonin regulation of interleukin-1 messenger RNA in rat uterine smooth muscle cells: relationship to the production of interstitial collagenase. J Biol Chem 1994, 269:29658-29664[Abstract/Free Full Text]
  25. Wilcox, BD, Rydelek-Fitgerald L, Jeffrey JJ: Regulation of uterine collagenase gene expression: interactions between serotonin and progesterone. Mol Cell Endocrinol 101:67–75
  26. Woessner JF, Jr: Regulation of matrilysin in the rat uterus. Biochem Cell Biol 1994, 74:777-784
  27. Rudolph-Owen LA, Hulboy DL, Wilson CL, Mudgett J, Matrisian LM: Coordinate expression of matrix metalloproteinase family members in the uterus of normal, matrilysin-deficient, and stromelysin-1-deficient mice. Endocrinology 1997, 138:4902-4911[Abstract/Free Full Text]
  28. Wolf K, Sandner P, Kurtz A, Moll W: Messenger ribonucleic acid levels of collagenase (MMP-13) and matrilysin (MMP-7) in virgin, pregnant, and postpartum uterus and cervix of rat. Endocrinology 1996, 137:5429-5434[Abstract]
  29. Balbin M, Fueyo A, Knauper V, Pendas AM, Lopez JM, Jimenez MG, Murphy G, Lopez-Ortin C: Collagenase-2 (MMP-8) expression in murine tissue-remodeling processes: analysis of its potential role in postparum involution of the uterus. J Biol Chem 1998, 273:23959-23968[Abstract/Free Full Text]
  30. Fini ME, Cook JR, Mohan R, Brinckerhoff CE: Regulation of matrix metalloproteinase gene expression. Matrix Metalloproteinases. WC Parks, RP Mecham, eds. San Diego, Academic Press, 1998, pp 299–356
  31. Shi G-P, Webb AC, Foster KE, Knoll JHM, Lemere CA, Munger JS, Chapman HA: Human cathepsin S: Chromosomal localization, gene structure, and tissue distribution. J Biol Chem 1994, 269:11530-11536[Abstract/Free Full Text]
  32. Nagase H: Activation mechanisms of matrix metalloproteinases. Biol Chem 1997, 378:151-160[Medline]
  33. Gomez DE, Alonso DF, Yohiji H, Thorgeirsson UP: Tissue inhibitors of metalloproteinases: structure, regulation and biological functions. Eur J Cell Biol 1997, 74:111-122[Medline]
  34. Murphy G, Willenbrock F, Crabbe T, O'Shea M, Ward R, Atkinson S, O'Connell J, Docherty A: Regulation of matrix metalloproteinase activity. Ann NY Acad Sci 1994, 732:31-41[Medline]
  35. Rechberger T, Woessner JF, Jr: Collagenase, its inhibitors, and decorin in lower uterine segment in pregnant women. Am J Obstet Gynecol 1993, 168:1598-1603[Medline]
  36. Kenagy RD, Hart CE, Stetler-Stevenson WG, Clowes AW: Primate smooth muscle cell migration from aotic explants is mediated by endogenous platelet-derived growth factor and basic fibroblast growth factor acting through matrix metalloproteinases 2 and 9. Circulation 1997, 18:3555-3560
  37. Schnaper HW, Kopp JB, Poncelet AC, Hubchak SC, Stetler-Stevenson WG, Klotman PE, Kleinman HK: Increased expression of extracellular matrix proteins and decreased expression of matrix proteases after serial passage of glomerular mesangial cells. J Cell Sci 1996, 109:2521-2528[Abstract]
  38. Takahashi S, Sato T, Ito A, Ojima Y, Hosono T, Nagase H, Mori Y: 1993 Involvement of protein kinase C in the interleukin 1{alpha}-induced gene expression of matrix metalloproteinases, and tissue inhibitor-1 of metalloproteinases (TIMP-1) in human uterine cervical fibroblasts. Biochim Biophys Acata 1996, 1220:57-65



This article has been cited by other articles:


Home page
Physiol. GenomicsHome page
M. Marotta, C. Ruiz-Roig, Y. Sarria, J. L. Peiro, F. Nunez, J. Ceron, F. Munell, and M. Roig-Quilis
Muscle genome-wide expression profiling during disease evolution in mdx mice
Physiol Genomics, April 10, 2009; 37(2): 119 - 132.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
J. V. Cockle, N. Gopichandran, J. J. Walker, M. I. Levene, and N. M. Orsi
Matrix Metalloproteinases and Their Tissue Inhibitors in Preterm Perinatal Complications
Reproductive Sciences, October 1, 2007; 14(7): 629 - 645.
[Abstract] [PDF]


Home page
ReproductionHome page
S Guay and A Akoum
Stable inhibition of interleukin 1 receptor type II in Ishikawa cells augments secretion of matrix metalloproteinases: possible role in endometriosis pathophysiology
Reproduction, September 1, 2007; 134(3): 525 - 534.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
M. O'Brien, D. O'Shaughnessy, E. Ahamide, J. J. Morrison, and T. J. Smith
Differential expression of the metalloproteinase MMP3 and the {alpha}5 integrin subunit in human myometrium at labour
Mol. Hum. Reprod., September 1, 2007; 13(9): 655 - 661.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
T. Collette, R. Maheux, J. Mailloux, and A. Akoum
Increased expression of matrix metalloproteinase-9 in the eutopic endometrial tissue of women with endometriosis
Hum. Reprod., December 1, 2006; 21(12): 3059 - 3067.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
R. Sharony, G. Pintucci, P. C. Saunders, E. A. Grossi, F. G. Baumann, A. C. Galloway, and P. Mignatti
Matrix metalloproteinase expression in vein grafts: role of inflammatory mediators and extracellular signal-regulated kinases-1 and -2
Am J Physiol Heart Circ Physiol, April 1, 2006; 290(4): H1651 - H1659.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
X. W. Cheng, M. Kuzuya, K. Nakamura, Q. Di, Z. Liu, T. Sasaki, S. Kanda, H. Jin, G.-P. Shi, T. Murohara, et al.
Localization of Cysteine Protease, Cathepsin S, to the Surface of Vascular Smooth Muscle Cells by Association with Integrin {alpha}{nu}{beta}3
Am. J. Pathol., February 1, 2006; 168(2): 685 - 694.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
H. Wang, S. Parry, G. Macones, M. D. Sammel, P. E. Ferrand, H. Kuivaniemi, G. Tromp, I. Halder, M. D. Shriver, R. Romero, et al.
Functionally significant SNP MMP8 promoter haplotypes and preterm premature rupture of membranes (PPROM)
Hum. Mol. Genet., November 1, 2004; 13(21): 2659 - 2669.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
M. S. Soloff, Y.-J. Jeng, M. Ilies, S. L. Soloff, M. G. Izban, T. G. Wood, N. I. Panova, G. V.N. Velagaleti, and G. D. Anderson
Immortalization and characterization of human myometrial cells from term-pregnant patients using a telomerase expression vector
Mol. Hum. Reprod., September 1, 2004; 10(9): 685 - 695.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
M. Takemura, H. Itoh, N. Sagawa, S. Yura, D. Korita, K. Kakui, N. Hirota, and S. Fujii
Cyclic mechanical stretch augments both interleukin-8 and monocyte chemotactic protein-3 production in the cultured human uterine cervical fibroblast cells
Mol. Hum. Reprod., August 1, 2004; 10(8): 573 - 580.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
T. Collette, C. Bellehumeur, R. Kats, R. Maheux, J. Mailloux, M. Villeneuve, and A. Akoum
Evidence for an increased release of proteolytic activity by the eutopic endometrial tissue in women with endometriosis and for involvement of matrix metalloproteinase-9
Hum. Reprod., June 1, 2004; 19(6): 1257 - 1264.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
S. M. Yellon, A. M. Mackler, and M. A. Kirby
The Role of Leukocyte Traffic and Activation in Parturition
Reproductive Sciences, September 1, 2003; 10(6): 323 - 338.
[Abstract] [PDF]


Home page
Endocr. Rev.Home page
T. E. Curry Jr. and K. G. Osteen
The Matrix Metalloproteinase System: Changes, Regulation, and Impact throughout the Ovarian and Uterine Reproductive Cycle
Endocr. Rev., August 1, 2003; 24(4): 428 - 465.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Iwahashi, Y. Muragaki, A. Ooshima, and N. Umesaki
Decreased Type I Collagen Expression in Human Uterine Cervix during Pregnancy
J. Clin. Endocrinol. Metab., May 1, 2003; 88(5): 2231 - 2235.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
M. Watari, H. Watari, T. Fujimoto, H. Yamada, J. Nishihira, J. f. Strauss III, and S. Fujimoto
Lipopolysaccharide Induces Interleukin-8 Production By Human Cervical Smooth Muscle Cells
Reproductive Sciences, February 1, 2003; 10(2): 110 - 117.
[Abstract] [PDF]


Home page
Mol Hum ReprodHome page
M. Yoshida, N. Sagawa, H. Itoh, S. Yura, M. Takemura, Y. Wada, T. Sato, A. Ito, and S. Fujii
Prostaglandin F2{alpha}, cytokines and cyclic mechanical stretch augment matrix metalloproteinase-1 secretion from cultured human uterine cervical fibroblast cells
Mol. Hum. Reprod., July 1, 2002; 8(7): 681 - 687.
[Abstract] [Full Text] [PDF]


Home page
CROBMHome page
D.P. Dickinson
CYSTEINE PEPTIDASES OF MAMMALS: THEIR BIOLOGICAL ROLES AND POTENTIAL EFFECTS IN THE ORAL CAVITY AND OTHER TISSUES IN HEALTH AND DISEASE
Critical Reviews in Oral Biology & Medicine, May 1, 2002; 13(3): 238 - 275.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
G. A. Limb, J. T. Daniels, R. Pleass, D. G. Charteris, P. J. Luthert, and P. T. Khaw
Differential Expression of Matrix Metalloproteinases 2 and 9 by Glial Muller Cells : Response to Soluble and Extracellular Matrix-Bound Tumor Necrosis Factor-{alpha}
Am. J. Pathol., May 1, 2002; 160(5): 1847 - 1855.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
K.W. Marvin, J.A. Keelan, R.L. Eykholt, T.A. Sato, and M.D. Mitchell
Use of cDNA arrays to generate differential expression profiles for inflammatory genes in human gestational membranes delivered at term and preterm
Mol. Hum. Reprod., April 1, 2002; 8(4): 399 - 408.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
R. N. Weinreb and J. D. Lindsey
Metalloproteinase Gene Transcription in Human Ciliary Muscle Cells with Latanoprost
Invest. Ophthalmol. Vis. Sci., March 1, 2002; 43(3): 716 - 722.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
M.H.F. Sullivan, S.A. Alvi, N.L. Brown, M.G. Elder, and P.R. Bennett
The effects of a cytokine suppressive anti-inflammatory drug on the output of prostaglandin E2 and interleukin-1{beta} from human fetal membranes
Mol. Hum. Reprod., March 1, 2002; 8(3): 281 - 285.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Fujimoto, S. Parry, M. Urbanek, M. Sammel, G. Macones, H. Kuivaniemi, R. Romero, and J. F. Strauss III
A Single Nucleotide Polymorphism in the Matrix Metalloproteinase-1 (MMP-1) Promoter Influences Amnion Cell MMP-1 Expression and Risk for Preterm Premature Rupture of the Fetal Membranes
J. Biol. Chem., February 15, 2002; 277(8): 6296 - 6302.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
U. Ulug, S. Goldman, I. Ben-Shlomo, and E. Shalev
Matrix metalloproteinase (MMP)-2 and MMP-9 and their inhibitor, TIMP-1, in human term decidua and fetal membranes: the effect of prostaglandin F2{alpha} and indomethacin
Mol. Hum. Reprod., December 1, 2001; 7(12): 1187 - 1193.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
M. Yoshida, N. Sagawa, H. Itoh, S. Yura, D. Korita, K. Kakui, N. Hirota, T. Sato, A. Ito, and S. Fujii
Nitric oxide increases matrix metalloproteinase-1 production in human uterine cervical fibroblast cells
Mol. Hum. Reprod., October 1, 2001; 7(10): 979 - 985.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
A. Solomon, D.-Q. Li, S.-B. Lee, and S. C. G. Tseng
Regulation of Collagenase, Stromelysin, and Urokinase-Type Plasminogen Activator in Primary Pterygium Body Fibroblasts by Inflammatory Cytokines
Invest. Ophthalmol. Vis. Sci., July 1, 2000; 41(8): 2154 - 2163.
[Abstract] [Full Text]


Home page
Clin. Cancer Res.Home page
M. Määttä, Y. Soini, A. Liakka, and H. Autio-Harmainen
Differential Expression of Matrix Metalloproteinase (MMP)-2, MMP-9, and Membrane Type 1-MMP in Hepatocellular and Pancreatic Adenocarcinoma: Implications for Tumor Progression and Clinical Prognosis
Clin. Cancer Res., July 1, 2000; 6(7): 2726 - 2734.
[Abstract] [Full Text]


Home page
Reproductive SciencesHome page
M. Watari, H. Watari, I. Nachamkin, and J. F. Strauss III
Lipopolysaccharide Induces Expression of Genes Encoding Pro-Inflammatory Cytokines and the Elastin-Degrading Enzyme, Cathepsin S, in Human Cervical Smooth-Muscle Cells
Reproductive Sciences, May 1, 2000; 7(3): 190 - 198.
[Abstract] [PDF]


Home page
Mol Hum ReprodHome page
M. B. Sennstrom, G. Ekman, G. Westergren-Thorsson, A. Malmstrom, B. Bystrom, U. Endresen, N. Mlambo, M. Norman, B. Stabi, and A. Brauner
Human cervical ripening, an inflammatory process mediated by cytokines
Mol. Hum. Reprod., April 1, 2000; 6(4): 375 - 381.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Watari, M.
Right arrow Articles by Strauss, J. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Watari, M.
Right arrow Articles by Strauss, J. F., III


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS