| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |




From the Department of Dermatopathology,*
Albany Medical
Center, Albany, New York; the Division of Pediatric
Oncology,
Dana Farber Cancer Institute and
Children's Hospital, Boston, Massachusetts; and the Department of
Dermatopathology,
Massachusetts General
Hospital, Boston, Massachusetts
| Abstract |
|---|
|
|
|---|
-MSH and
c-Kit ligand. Because of its central role in melanocyte survival
and to assess its potential use as a histopathological marker for
melanoma, Mitf expression was examined in histologically
confirmed human melanoma specimens. Western blot analysis of melanoma
cell lines revealed consistent expression of two Mitf protein isoforms
differing by MAP kinase-mediated phosphorylation. In a series of 76
consecutive human melanoma surgical specimens, 100% stained
positively for Mitf with a nuclear pattern of reactivity. In a
side-by-side comparison, Mitf staining was positive in
melanomas that failed to stain for either HMB-45 or S-100, the
most common currently used melanoma markers. Of 60 non-melanoma
tumors, none displayed nuclear Mitf staining and two displayed
cytoplasmic staining. Although Mitf does not distinguish benign from
malignant melanocytic lesions, for invasive neoplasms it
appears to be a highly sensitive and specific histopathological
melanocyte marker for melanoma.
| Introduction |
|---|
|
|
|---|
-MSH) up-regulates pigment enzyme gene
expression through a signaling cascade that stimulates expression of
Mitf followed by secondary (Mitf-mediated) activation of pigment enzyme
expression.8,9 Although Mitf is important in regulating the pigmentation response for melanocytes, the complete absence of melanocytes in Mitf-deficient mice suggests that Mitf is essential for melanocyte development, postnatal survival, or both. One instructive mouse mutant, mivit, displays nearly normal melanocyte development but accelerated age-dependent melanocyte death over the first months of life.10 This melanocyte death is attributable to a mutation within the helix-loop-helix motif of mi5,11 and suggests a vital role for Mitf protein in postnatal survival of melanocytes.
Recent studies have also demonstrated that Mitf is a phosphorylation target in the Steel/c-Kit signaling pathway,12 a connection that highlights the phenotypic overlap of mi/mi, kit, and steel mutant mice. Stimulation of the mitogenic cytokine receptor c-Kit results in MAP kinase-mediated phosphorylation of Mitf, producing transcriptional superactivation through selective recruitment of CBP/p300,13 a family of factors that function as transcriptional coactivators for Mitf.14,15
The annual incidence of human melanoma worldwide is increasing at the rate of approximately 5% per year.16 It is estimated that 1 in 75 persons born in the United States by the year 2000 will develop malignant melanoma in their lifetime.17 Due to its propensity to metastasize rapidly and widely, coupled to the common feature of late recurrence, relapses from melanoma represent an important and often life-threatening clinical condition.18
Melanoma resides among the tumor types more commonly associated with metastases lacking an obvious primary tumor site.18-22 A significant limitation associated with the histopathology of metastatic melanoma is its frequent nonspecific histological appearance, shared with other poorly differentiated neoplasms, combined with common loss of melanocytic markers within these tumors. Pigmentation enzymes and other melanocytic markers such as c-Kit are frequently absent or difficult to detect in primary or metastatic melanomas.23-26 Current histopathological diagnosis of metastatic melanoma relies most often on two antibody-antigen combinations: S100 and HMB-45.27-31 S100, although quite sensitive, also stains a significant number of nonmelanoma malignancies,23,29 thereby providing limited specificity. HMB-45, which is quite selective for melanoma, may fail to identify a fraction (ranging from 5 to 50%) of these tumors23,29 and has been suggested to stain variably in a technique-dependent fashion.23,27,30,32-35 A combination of S100 and HMB45 staining improves their diagnostic utility for melanoma detection.
Using a monoclonal antibody generated against human Mitf, we identified strong nuclear staining within normal skin melanocytes, nevi, dysplastic nevi, and 100% of 76 consecutively acquisitioned melanomas, including amelanotic and metastatic tumors. In side-by-side comparisons, Mitf definitively stained melanomas that were negative for S100 or HMB-45. Among nonmelanoma tumors, Mitf stained the cytoplasm in two of 60 cases, but no cases exhibited nuclear staining. Thus, Mitf may be a sensitive and specific melanocytic marker, offering a useful means of identifying the melanocytic nature of a neoplasm.
| Materials and Methods |
|---|
|
|
|---|
NIH3T3 murine fibroblast cell line, B16 murine melanoma cell line, and the human neuroblastoma cell lines IMR-32 and SK-N-SH were grown in DMEM with 10% fetal bovine serum (FBS). The human melanoma cell lines (gift of Dr. R. Halaban, Yale University) 501-mel,24 MeWo, and YUZAZ636 were grown in Ham's F10 media supplemented with 10% FBS.
Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
Total cellular RNA was isolated using RNAzol (Tel-Test, Friendswood, TX). Primers to the mouse microphthalmia gene flanking exons 58 were synthesized: 5' exon 5 CCCGTCTCTGGAAACTTGATCG and 3' exon 8 CTGTACTCTGAGCAGCAGGTG. cDNA was made using MMTV reverse transcriptase (GIBCO BRL, Gaithersburg, MD). Ten micrograms of total RNA were used for each cDNA reaction along with 30 pmol of 3' exon 8 primer and incubated according to manufacturer's instructions. The cDNA reaction mixture was diluted in PCR buffer (10 mmol/L Tris, pH 8.3, 55 mmol/L KCl, 625 fmoles of 5'primer, 250 fmoles of 3' primer), Taq polymerase (Fisher Scientific Co., Pittsburgh, PA), and dNTPs (Pharmacia Biotech, Piscataway, NJ) with incubations at 94°C for 2 minutes, 57°C for 1 minute, and 72°C for 2 minutes for 30 cycles and visualized on polyacrylamide gels.37
Western Blotting
Whole cell lysates were made by on-plate lysis of washed cells by adding 2.3% sodium dodecyl sulfate (SDS), 10% glycerol, 6.25 mmol/L Tris, pH 6.8, and 2-ß-mercaptoethanol, and boiled for 5 minutes. The protein lysates were resolved on 8% SDS-polyacrylamide gels. Proteins were transferred to nitrocellulose with methanol-glycine electrotransfer buffer (Bio-Rad Labs, Hercules, CA). The membrane was blocked in 5% milk for 1 hour at room temperature. After washing in TBST (10 mmol/L Tris, pH 7.6, 150 mmol/L NaCl, and 0.5% Tween 20), 1:40 dilution of the Mitf antibody (hybridoma culture supernatant) was added for 1 hour at room temperature and developed using goat anti-mouse horseradish peroxidase-conjugated antibody (Cappel, West Chester, PA) and enhanced chemiluminescence (Amersham, Arlington Heights, IL).
Immunofluorescence and Immunohistochemistry
Mitf monoclonal antibodies12,37 were shown not to cross-react with other b-HLH-Zip factors by immunoprecipitation and DNA mobility shift assay37 (data not shown). The antibody C5 recognizes both mouse and human Mitf and was used for Western blotting, whereas antibody D5 recognizes human Mitf only and was used for immunostaining. For staining, cells were grown on glass chamber slides (Fisher Scientific, Pittsburgh, PA) and were fixed with 3% formaldehyde in phosphate buffered saline (PBS) for 30 minutes. D5 antibody (diluted 1:40) was added for 1 hour. The Vectastain Elite kit (Vector Laboratories, Burlingame, CA) was used for immunohistochemical staining per manufacturer's instructions. The diaminobenzidine reagent (Vector Laboratories) was applied for 2 to 4 minutes. For immunofluorescence, the Cy-3-conjugated goat anti-mouse (Jackson Immunological) was used. Nuclei were stained with 10 ng/ml DAPI (Sigma). All incubations were followed by three washes with 0.1% Triton X-100 in PBS.
Histopathology
Eighty cases with the diagnosis of melanoma were sequentially selected from the pathology files of the Albany Medical Center Department of Pathology. Of these, four were excluded because of unavailability of adequate lesional tissue. The histopathological material was reviewed by two of the authors (RK and MM) to confirm the diagnoses. Immunohistochemical studies were performed on all cases using formalin-fixed, paraffin-embedded tissue. Sections were cut at 4 µm, heated at 60°C, deparaffinized in xylene, and hydrated in a graded series of alcohols. Primary antibodies included polyclonal rabbit antibody S-100 (Ventana, prediluted), mouse monoclonal antibody HMB-45 (Ventana, prediluted), and monoclonal antibody D5 (Mitf antibody, undiluted). Antigen retrieval was performed using microwaving in citrate buffer for the Mitf antibody. Staining was performed with the Ventana ES automated immunohistochemistry system using the Ventana DAB Detection Kit (Ventana Medical Systems) Tissues known to express the antigen of interest were used as positive controls, whereas removal of the primary antibodies in the test tissues were used as negative controls. Only Mitf antibody nuclear staining was regarded as positive, whereas cytoplasmic staining alone was considered a negative result (and was observed in only two breast carcinomas, see Results). S-100 and HMB-45 antibody staining were considered positive if cytoplasmic staining was present. The Fisher Exact test was used for statistical analyses comparing Mitf versus HMB-45 and Mitf versus S100. Sixty nonmelanocytic tumors (detailed below) were selected to test the specificity of Mitf and HMB-45. These selected tumor types have been shown to express S-100.28
| Results |
|---|
|
|
|---|
|
|
Mitf expression was tested in a series of consecutively accessioned histologically confirmed human melanoma pathological specimens. Of the 76 cases, 19 were melanomas in situ, 50 were conventional melanomas, and 7 were metastatic melanomas. Eight cases were histologically amelanotic (2 melanoma in situ and 6 primary melanoma). Nine cases had a predominantly spindled cell morphology, eight cases had a spindled/epithelioid morphology, and the remainder had a predominantly epithelioid cell morphology.
Mitf expression was positive and nuclear in all 19 melanomas in
situ (Table 1
and Figure 2
). Among
the invasive melanomas, Mitf was also positive in all cases, again
displaying a nuclear pattern (Table 1)
. For the consecutive series,
Mitf staining was compared in side-by-side fashion with HMB-45 and
S-100. The nuclear staining pattern of Mitf contrasted the cytoplasmic
or more diffuse staining patterns of S-100 and HMB-45 (Figure 3)
. All three stains were positive in the
majority of cases (Table 1)
. However, HMB-45 failed to stain 7 cases.
In these 76 consecutive melanomas, Mitf's enhanced sensitivity over
HMB-45 was statistically significant (P = 0.01).
Although S-100 is known to be less specific for
melanoma,31
all but 5 melanomas in this consecutive series
were positive for S-100. Independent of specificity (see below),
Mitf displayed a statistical trend toward greater sensitivity for
melanoma than S-100 (P = 0.06). Only 1 melanoma
was negative for both S100 and HMB-45, and this, too, was positive for
Mitf. Focal positivity was seen within 2 cases for Mitf and 2 cases for
HMB-45. Figure 3
shows representative staining for Mitf, HMB-45, and
S-100 in conventional, amelanotic, metastatic, and in-transit
melanomas. The nuclear staining pattern of Mitf is compared at low and
high powers. This amelanotic tumor was also negative for HMB-45 but was
positive for Mitf and S-100 (Figure 3)
. Mitf also stained positively in
a melanoma-in-transit (Figure 3)
. This invasive tumor resides in the
dermal/subdermal region without contiguous extension from overlying
epidermis.
|
|
|
|
| Discussion |
|---|
|
|
|---|
Mitf staining in melanomas produces a nuclear pattern which has some theoretical advantages over cytoplasmic immunostains. It may be difficult to distinguish background staining from positivity for cytoplasmic antibodies, especially with weak signal. Furthermore, cellular architecture is not obscured with nuclear staining, which aids in the preservation of the tissue structure being examined. For pigmented lesions it may be difficult to distinguish cytoplasmic stains from pigmentation, although such lesions are less likely to require special stains.
Mitf was expressed in 8/8 histologically amelanotic melanomas. Based on its recognition of the M box promoter element,5 Mitf is thought to regulate transcription of the pigmentation enzymes tyrosinase, TRP1 and TRP2.5-7 Its persistent expression in the amelanotic melanomas examined here suggests that factors downstream of Mitf may down-regulate pigmentation. One such mechanism is the proteolytic degradation of tyrosinase, recently described for human melanoma cells.25 These findings suggest that down-regulation of pigmentation may occur through mechanisms downstream of Mitf rather than through loss of Mitf itself. Of note, however, nondetection of Mitf expression at the RNA level has been observed in a murine amelanotic melanoma cell line.15
Mitf was consistently detected in all metastatic melanomas in this series. Although the broader clinical utility of Mitf for metastatic melanoma remains to be validated with larger trials, these data using histologically confirmed melanoma specimens suggest that Mitf may be a sensitive marker for this clinical entity, which can represent a diagnostic challenge. From 4 to 14% of melanomas have no known primary site, arise from an internal site, or are diagnosed at the metastatic stage.18-22 Moreover, because a significant fraction of metastatic melanomas are amelanotic, such lesions may be difficult to classify on simple morphological grounds, certainly to the nonspecialist, and could represent a variety of undifferentiated or poorly differentiated tumors such as epithelial tumors, sarcomas, lymphoid neoplasms, or germ cell tumors.39 Combined detection of S-100 and keratin may help rule in or rule out the possibility a melanoma. S-100 is sensitive for melanoma but also commonly stains other tumors in this differential including breast adenocarcinomas, lung carcinomas, teratomas, neurogenic tumors, and others,23,29,40-43 whereas keratin expression is atypical in melanomas.44 Larger survey studies are still needed to determine the true specificity of Mitf staining in diverse malignancies as well as in metastatic melanoma.
It is noteworthy that 2 of the breast cancer specimens in this series produced cytoplasmic Mitf staining. Mitf is normally expressed in osteoclasts and mast cells, and it is known that many breast cancers express genes involved in bone resorption such as parathyroid hormone-related protein, cathepsin K, interleukin-6, interleukin-1, transforming growth factor, and collagenases.45,46 It will be of interest to examine mast cell and osteoclastic lesions for Mitf expression. If the staining of the breast lesions reflects true Mitf protein expression, it is possible that this Mitf protein might up-regulate osteoclast-like genes such as cathepsin K, a resorption factor recently detected in breast tumor cell lines.47 As such, Mitf expression could play a role in bone metastasis of breast cancer and perhaps even predict osteotrophic tumors.
HMB-45 antibody recognizes the melanosome matrix protein pmel 17 or gp100.30,48 Like Mitf, HMB-45 antibody recognizes a melanocyte antigen and is not thought to discriminate between melanocytes and melanoma cells. Mitf is thought to represent a central transcriptional regulator of enzymes involved in melanin biosynthesis. Because all HMB-45-positive tumors in this series also expressed Mitf, it is possible that Mitf regulates the transcription of pmel 17, a possibility consistent with prior studies of these factors.15
These results demonstrate that microphthalmia is a sensitive and specific melanocyte marker for melanoma diagnosis. Mitf also appears to be a master regulator of both melanocyte development and postnatal viability, as well as pigmentation. The preservation of Mitf expression in melanomas is consistent with the possibility that it could play a role in melanoma cell survival. If so, an understanding of its biochemical roles may result in its use as a therapeutic target.
| Acknowledgements |
|---|
| Footnotes |
|---|
Supported by a grant from the National Institutes of Health to D. E. F. K. N. W. was supported by National Institutes of Health K08 National Institute on Aging 0085201. G. M. is a predoctoral fellow of the Howard Hughes Medical Institute and a Sandoz fellow. D. E. F. is a Pew Foundation Fellow and James S. McDonnell Scholar.
R. K. and K. N. W. contributed equally to this manuscript.
Accepted for publication April 27, 1999.
| References |
|---|
|
|
|---|
MSH signaling regulates expression of microphthalmia, a gene deficient in Waardenburg Syndrome. J Biol Chem 1998, 273:33042-33047This article has been cited by other articles:
![]() |
A. Sekulic, P. Haluska Jr, A. J. Miller, J. G. De Lamo, S. Ejadi, J. S. Pulido, D. R. Salomao, E. C. Thorland, R. G. Vile, D. L. Swanson, et al. Malignant Melanoma in the 21st Century: The Emerging Molecular Landscape Mayo Clin. Proc., July 1, 2008; 83(7): 825 - 846. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. N. Dynek, S. M. Chan, J. Liu, J. Zha, W. J. Fairbrother, and D. Vucic Microphthalmia-Associated Transcription Factor Is a Critical Transcriptional Regulator of Melanoma Inhibitor of Apoptosis in Melanomas Cancer Res., May 1, 2008; 68(9): 3124 - 3132. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Becker, M. C. Mihm, S. M. Hewitt, V. K. Sondak, J. W. Fountain, and M. Thurin Markers and Tissue Resources for Melanoma: Meeting Report. Cancer Res., November 15, 2006; 66(22): 10652 - 10657. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. F. Vlahos, C. W. Lipari, B. Bankowski, T.-H. Lai, J. A. King, I.-M. Shih, K. Fragakis, and Y. Zhao Effect of Luteal-Phase Support on Endometrial L-Selectin Ligand Expression after Recombinant Follicle-Stimulating Hormone and Ganirelix Acetate for in Vitro Fertilization J. Clin. Endocrinol. Metab., October 1, 2006; 91(10): 4043 - 4049. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Miller and M. C. Mihm Jr. Melanoma. N. Engl. J. Med., July 6, 2006; 355(1): 51 - 65. [Full Text] [PDF] |
||||
![]() |
G. G. McGill, R. Haq, E. K. Nishimura, and D. E. Fisher c-Met Expression Is Regulated by Mitf in the Melanocyte Lineage J. Biol. Chem., April 14, 2006; 281(15): 10365 - 10373. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Goding and F. L. Meyskens Jr. Microphthalmic-Associated Transcription Factor Integrates Melanocyte Biology and Melanoma Progression Clin. Cancer Res., February 15, 2006; 12(4): 1069 - 1073. [Full Text] [PDF] |
||||
![]() |
K. Koyanagi, S. J. O'Day, R. Gonzalez, K. Lewis, W. A. Robinson, T. T. Amatruda, C. Kuo, H.-J. Wang, R. Milford, D. L. Morton, et al. Microphthalmia Transcription Factor as a Molecular Marker for Circulating Tumor Cell Detection in Blood of Melanoma Patients Clin. Cancer Res., February 15, 2006; 12(4): 1137 - 1143. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. K. Sra, M. Babb-Tarbox, S. Aboutalebi, P. Rady, G. L. Shipley, D. D. Dao, and S. K. Tyring Molecular Diagnosis of Cutaneous Diseases Arch Dermatol, February 1, 2005; 141(2): 225 - 241. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Sharov, M. Fessing, R. Atoyan, T. Y. Sharova, C. Haskell-Luevano, L. Weiner, K. Funa, J. L. Brissette, B. A. Gilchrest, and V. A. Botchkarev Bone morphogenetic protein (BMP) signaling controls hair pigmentation by means of cross-talk with the melanocortin receptor-1 pathway PNAS, January 4, 2005; 102(1): 93 - 98. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Miller, J. Du, S. Rowan, C. L. Hershey, H. R. Widlund, and D. E. Fisher Transcriptional Regulation of the Melanoma Prognostic Marker Melastatin (TRPM1) by MITF in Melanocytes and Melanoma Cancer Res., January 15, 2004; 64(2): 509 - 516. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Doglioni, S. Piccinin, S. Demontis, M. G. Cangi, L. Pecciarini, C. Chiarelli, M. Armellin, T. Vukosavljevic, M. Boiocchi, and R. Maestro Alterations of {beta}-Catenin Pathway in Non-Melanoma Skin Tumors: Loss of {alpha}-ABC Nuclear Reactivity Correlates with the Presence of {beta}-Catenin Gene Mutation Am. J. Pathol., December 1, 2003; 163(6): 2277 - 2287. [Abstract] [Full Text] |
||||
![]() |
J. Du, A. J. Miller, H. R. Widlund, M. A. Horstmann, S. Ramaswamy, and D. E. Fisher MLANA/MART1 and SILV/PMEL17/GP100 Are Transcriptionally Regulated by MITF in Melanocytes and Melanoma Am. J. Pathol., July 1, 2003; 163(1): 333 - 343. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Durda, I. S. Dunn, L. B. Rose, D. Butera, E. M. Benson, F. Pandolfi, and J. T. Kurnick Induction of "Antigen Silencing" in Melanomas by Oncostatin M: Down-Modulation of Melanocyte Antigen Expression Mol. Cancer Res., April 1, 2003; 1(6): 411 - 419. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. R. Widlund, M. A. Horstmann, E. R. Price, J. Cui, S. L. Lessnick, M. Wu, X. He, and D. E. Fisher {beta}-Catenin-induced melanoma growth requires the downstream target Microphthalmia-associated transcription factor J. Cell Biol., September 16, 2002; 158(6): 1079 - 1087. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Altschmied, J. Delfgaauw, B. Wilde, J. Duschl, L. Bouneau, J.-N. Volff, and M. Schartl Subfunctionalization of Duplicate mitf Genes Associated With Differential Degeneration of Alternative Exons in Fish Genetics, May 1, 2002; 161(1): 259 - 267. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Selzer, V. Wacheck, T. Lucas, E. Heere-Ress, M. Wu, K. N. Weilbaecher, W. Schlegel, P. Valent, F. Wrba, H. Pehamberger, et al. The Melanocyte-specific Isoform of the Microphthalmia Transcription Factor Affects the Phenotype of Human Melanoma Cancer Res., April 1, 2002; 62(7): 2098 - 2103. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Du and D. E. Fisher Identification of Aim-1 as the underwhite Mouse Mutant and Its Transcriptional Regulation by MITF J. Biol. Chem., January 4, 2002; 277(1): 402 - 406. [Abstract] [Full Text] |
||||
![]() |
E. P. v. Strandmann, S. Senkel, G. Ryffel, and U. R. Hengge Dimerization Co-Factor of Hepatocyte Nuclear Factor 1/Pterin-4{{alpha}}-Carbinolamine Dehydratase Is Necessary for Pigmentation in Xenopus and Overexpressed in Primary Human Melanoma Lesions Am. J. Pathol., June 1, 2001; 158(6): 2021 - 2029. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Motyckova, K. N. Weilbaecher, M. Horstmann, D. J. Rieman, D. Z. Fisher, and D. E. Fisher Linking osteopetrosis and pycnodysostosis: Regulation of cathepsin K expression by the microphthalmia transcription factor family PNAS, April 25, 2001; (2001) 91479298. [Abstract] [Full Text] |
||||
![]() |
J. A. Ramos-Vara, M. E. Beissenherz, M. A. Miller, G. C. Johnson, L. W. Pace, A. Fard, and S. J. Kottler Retrospective Study of 338 Canine Oral Melanomas with Clinical, Histologic, and Immunohistochemical Review of 129 Cases Vet. Pathol., November 1, 2000; 37(6): 597 - 608. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. I. Salti, T. Manougian, M. Farolan, A. Shilkaitis, D. Majumdar, and T. K. Das Gupta Micropthalmia Transcription Factor: A New Prognostic Marker in Intermediate-thickness Cutaneous Malignant Melanoma Cancer Res., September 1, 2000; 60(18): 5012 - 5016. [Abstract] [Full Text] |
||||
![]() |
C. R. Goding Mitf from neural crest to melanoma: signal transduction and transcription in the melanocyte lineage Genes & Dev., July 15, 2000; 14(14): 1712 - 1728. [Full Text] |
||||
![]() |
M. Wu, T. J. Hemesath, C. M. Takemoto, M. A. Horstmann, A. G. Wells, E. R. Price, D. Z. Fisher, and D. E. Fisher c-Kit triggers dual phosphorylations, which couple activation and degradation of the essential melanocyte factor Mi Genes & Dev., February 1, 2000; 14(3): 301 - 312. [Abstract] [Full Text] |
||||
![]() |
G. Motyckova, K. N. Weilbaecher, M. Horstmann, D. J. Rieman, D. Z. Fisher, and D. E. Fisher Linking osteopetrosis and pycnodysostosis: Regulation of cathepsin K expression by the microphthalmia transcription factor family PNAS, May 8, 2001; 98(10): 5798 - 5803. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |