| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Department of Dermatology,*
Institut für
Medizinische Strahlenkunde und
Zellforschung,¶
Institute of
Pathology/ Department of Molecular
Pathology,§
Institute of
Immunology,||
University of Würzburg,
Würzburg, Germany; the Department of Molecular
Pharmacology,
Kanazawa University, Kanazawa,
Japan; and the Department of Immunology,
University of Rostock, Rostock, Germany
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B-like binding motifs,
indicating that both sites are critical for IL-8 induction.
Concomitantly, anoxia induced an enhanced binding activity of
AP-1 and NF-B transcription factors only in the highly aggressive
cells. From our in vitro and in vivo data
we suggest that anoxia-induced regulation of IL-8 might be a
characteristic feature of aggressive tumor cells, thus
indicating that IL-8 might play a critical role for tumor progression
in human malignant melanoma.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Interleukin-8 (IL-8), which belongs to the superfamily of CXC chemokines, has a wide range of proinflammatory effects and was initially described as a neutrophil chemoattractant.11,12 IL-8 is produced by a wide range of cells, including lymphocytes, monocytes, endothelial cells, fibroblasts, hepatocytes, and keratinocytes.13 More recently, in vitro data also demonstrated IL-8 production by melanoma cells.14 In addition, there is accumulating evidence that IL-8 plays a key role in melanoma progression and metastasis as patients with melanoma metastases have elevated serum levels of IL-8.15 IL-8 production by melanoma cells directly correlated with their metastatic potential in nude mice as well as in humans.16,17 This has been primarily explained by its properties to act as an autocrine growth factor for melanoma cells14 and to induce haptotactic migration.18 More recently, it has been shown that IL-8 also exhibits potent angiogenic activities both in vitro and in vivo.19-21
As hypoxia is a major stimulus for the expression of angiogenic
factors, it is tempting to speculate whether oxygen deficiency may also
induce IL-8 expression in malignant melanoma and thereby influence
tumor aggressiveness via stimulation of melanoma cell proliferation and
stimulation of angiogenesis. In addition, detailed molecular data on
the production and transcriptional regulation of IL-8 in melanoma under
hypoxia are still missing. Therefore, we applied in situ
hybridization for IL-8 mRNA expression and immunohistochemistry for
IL-8 receptor expression in primary cutaneous melanomas and melanoma
metastases. Furthermore, we studied the regulation of IL-8 production
in highly as well as low aggressive human melanoma cell lines under
anoxic culture conditions. In the present report we demonstrate that
in vivo IL-8 is highly expressed by melanoma cells in close
proximity to necrotic/hypoxic tumor areas, whereas the corresponding
IL-8-specific receptor A is concomitantly expressed both on melanoma
cells and supplying blood vessels. We provide evidence that tumor cell
aggressiveness depends on hypoxia-induced IL-8 production which is
regulated by the transcription factors AP-1 and NF-B.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Formalin-fixed sections (5 µm thickness) of 10 primary cutaneous melanomas of intermediate thickness (1 to 3 mm, Clark level III-IV) and 20 cutaneous metastases from different patients were investigated for in situ mRNA expression. We chose 10 metastases with a histopathologically detected central necrotic, and thereby presumably hypoxic, area and 10 metastases with no apparent necrosis.
Labeling of mRNA Sense and Anti-Sense Probe
The IL-8 cDNA probe (bp 137-1350) was kindly provided by C. Weissmann, University of Zürich, Zürich, Switzerland. The specificity of the IL-8 cDNA probe has been previously been shown.22 Subcloning of the specific cDNA fragment in a plasmid with T3/T7 (Bluescript SK/KS, Stratagene, La Jolla, CA) initiation sites was done according to standard protocols. In vitro transcription of sense and anti-sense probes was performed as described elsewhere.23 Briefly, plasmid DNA was linearized and 35S-labeled sense and anti-sense probes were obtained by in vitro transcription using T3 and T7 polymerases (Boehringer Mannheim, Mannheim, Germany) together with [35S]uridine triphosphate (Amersham, Braunschweig, Germany) as substrate. The original cDNA template was eliminated with DNase (Pharmacia, Uppsala, Sweden). To facilitate the intracellular accessibility of labeled probes, alkaline hydrolysis was performed to get an average length of 50 to 150 bp. The radioactive IL-8 sense and anti-sense probes were adjusted to a specific activity of 2 x 106 cpm/ml in 0.01 mol/L Tris-HCl, pH 7.5, containing 1 mmol/L EDTA.
Hybridization Procedure
Deparaffinized tissue specimens were treated with 10 µg of proteinase K per ml (Boehringer Mannheim) for 30 minutes at 37°C. Afterward, specimens were refixed with 4% paraformaldehyde, acetylated, dehydrated in graded ethanol, and air-dried. Then, slides were overlaid with 20 µl of hybridization solution (50% formamide, 300 mmol/L NaCl, 20 mmol/L Tris-HCl, pH 8.0, 5 mmol/L ethylenediamine tetraacetic acid, 1x Denhardt's solution, 10% dextran sulfate, 100 mmol/L dithiothreitol, and 2 x 105 cpm/µl of heat-denaturated radioactive anti-sense, and for control purposes, sense probe. The slides were coverslipped, sealed, and hybridized at 46°C for 16 hours. Ribonuclease treatment was included as a control and consistently abrogated specific hybridization signals. After removing the coverslips, the nonhybridized RNA probe was removed by incubation with high stringent washing solutions (50% formamide, 2x saline-sodium citrate, and 5 mmol/L ethylenediamine tetraacetic acid at 54–57°C) under constant stirring. To further minimize nonspecific background, noncomplementary unhybridized single-stranded probe was digested with ribonuclease A (20 µl/ml) and ribonuclease T1 (1 unit/ml) (Boehringer Mannheim) for 30 minutes at 37°C. For autoradiography, slides were dipped in NTB-2 Kodak solution (1:2 in 800 mmol/L ammonium acetate) and exposed for 5 weeks at 4°C.
Immunohistochemistry
Formalin-fixed sections (5 µm thickness) of the 10 central necrotic cutaneous metastases were incubated with two monoclonal antibodies raised against CXCR1 and CXCR2 (IL-8 receptors R1 and R2) (PharMingen, Hamburg, Germany; Biozol, München, Germany). Microwaving was used to optimize antigenicity. A biotinylated sheep anti-mouse IgG (Amersham) was used as secondary antibody at a dilution of 1:200. For detection of antibody binding, a streptavidin-peroxidase-complex (streptABC-peroxidase, Dako, Hamburg, Germany) was applied in accordance to the manufacturer's instructions. Serial sections were stained with monoclonal antibodies against CD68 (expressed on macrophages), against neutrophil elastase (specific for neutrophils), and against the CD3 antigen (T-cell-specific) (Dako, Hamburg, Germany). The reaction was visualized using 0.2 mg/ml 3-amino-9-ethylcarbazole (AEC) as substrate. Sections were counterstained with hematoxylin.
Cell Lines and Culture Conditions
The four human melanoma cell lines MV3, BLM (highly metastatic in nude mice24 ), IF6, and 530 (low metastatic) were kindly provided by G. N. P. van Muijen, Department of Pathology, University of Nijmegen, The Netherlands, and maintained in RPMI 1640 medium (Linaris, Bettingen, Germany), supplemented with 10% fetal calf serum (FCS, Linaris), 2 mmol/L L-glutamine, 100 units/ml penicillin/streptomycin and 1% nonessential amino acids. Cells were cultured in a humidified incubator (37°C in 5% CO2, 95% air) and passaged when confluent. Before anoxic stimulation cells were kept under low serum conditions (1% FCS) for at least 16 hours. For anoxic treatment cultures were put in an anaerobic culture chamber (Anaerocult A, Merck, Darmstadt, Germany) for different time periods.
Cytokine Enzyme-Linked Immunosorbent Assay
Cell-free supernatants were harvested at the appropriate times and stored at -70°C before analysis. A commercial sandwich enzyme-linked immunosorbent assay (ELISA) kit for human IL-8 (Quantikine, R&D Systems, Bad Nauheim, Germany) was used and assays were performed according to the manufacturer's specifications.
RNA Extraction from in Vitro Cell Cultures and Northern Blot Analysis
Total cytoplasmic RNA was isolated using the total RNeasy kit (Qiagen, Hilden, Germany). RNA concentration was determined spectrophotometrically at 260 nm. Twenty micrograms of RNA/sample were denatured in 50% formamide in gel running buffer (0.1 mol/L MOPS 3-(N-morpholino)propanesulfonic acid, pH 7.0, 40 mmol/L sodium acetate, 5 mmol/L EDTA, pH 8.0) for 15 minutes at 65°C, fractionated on a 1% agarose gel in formaldehyde buffer and subsequently transferred to a nylon membrane (Hybond N+, Amersham) in 20x SSC. As a probe for IL-8 mRNA, a 402-bp BamHI/SacI IL-8 cDNA fragment was used. For Northern hybridization the purified fragment was labeled to high specific activity with [32P]dATP using a random primer labeling system (Boehringer Mannheim). Membranes were cross-linked by ultraviolet light irradiation and prehybridized in a dextran sulfate buffer (100 g/L dextran sulfate, 0.6 mol/L NaCl, 0.2 mol/L Na2HPO4, 6 mmol/L EDTA, 1.75% lauroylsarcosinate, 50 µg/ml salmon sperm DNA, pH 6.2) for 1 hour at 65°C. Hybridization was carried out in the same prehybridization solution containing 5 x 106 cpm/ml of labeled probe. After hybridization for 16 hours at 65°C and 6 hours at 60°C, membranes were washed twice with 2x SSPE/0.1% sodium dodecyl sulfate (SDS) at room temperature, once with 1x SSPE/0.1% SDS at 60°C, and once again with 0.2x SSPE/0.1% SDS. Membranes were then exposed to Hyperfilm (Amersham) with intensifying screens at -80°C for 3 days. IL-8 mRNA loading differences were corrected by the amount of GAPDH mRNA.
mRNA Stability Assay
The half-life of IL-8 mRNA was determined by treating MV3 and BLM melanoma cells with actinomycin D (Sigma, Deisenhofen, Germany) as described by Lindholm et al25 and Ikeda et al.26 In short, MV3 and BLM cells were grown under standard normoxic conditions and under anoxia for 15 hours, respectively. After that actinomycin D (10 µg/ml) was added to the culture media to inhibit transcription. Cells were harvested at different time points (O, 1, 2, 4, 6, and 8 hours), total RNA was prepared and Northern analysis performed as described above. The relative amounts of IL-8 mRNA and GAPDH mRNA at each time point were quantified using a phosphoimager (Fujix Bas-2000, Fuji). IL-8 mRNA loading differences were corrected by the amount of GAPDH mRNA.
Transfection and Luciferase Assay
Firefly luciferase expression vectors harboring the 5' flanking
region -133 to +44 bp of the IL-8 gene were the same as described
elsewhere.27
They carry the AP-1 (-126 to -120), NF-IL-6
(-94 to -81) and NF-B-like (-80 to -71) binding sites. The
following constructs were used: wild-type -133-luc, mutant AP-1 (AP-1
mut-luc (TatCTCA)), mutant NF-B (NF-B mut-luc (taAcTTTCCTC)).
Melanoma cell lines MV3 and 530 were transfected with 2 µg of
appropriate plasmid DNA using the DMRIE-C
(1,2-dimyristyloxypropyl-3-dimethyl-hydroxyethyl ammonium bromide)
reagent (Gibco, Life Technologies, Eggenstein, Germany) according to
the manufacturer's specifications. Briefly, cells were kept under
serum-free medium for at least 16 hours. 2 µg of plasmid DNA and
DMRIE-C reagent, respectively, were diluted in 500 µl of OptiMEM
(Gibco). Both mixtures were put together and incubated at room
temperature for 30 minutes. Culture medium was removed and the
lipid-DNA complex was overlaid onto cells and incubated overnight.
Subsequently, medium was replaced by RPMI medium (10% FCS) and after
additional 24 hours changed to low serum conditions (1% FCS) for
further 24 hours. Subsequently, cells were exposed to anoxic conditions
for 12 hours. As a positive control melanoma cells were stimulated with
10 ng/ml = 12-o-tetradecanoylphorbol-13-acetate (TPA)
for 12 hours (Sigma, Deisenhofen, Germany). For luciferase assays,
total cell extracts were prepared. Briefly, cells were harvested in 100
µl of lysis buffer (50 mmol/L NaMES, pH 7.8, 50 mmol/L Tris-HCl, pH
7.8, 10 mmol/L dithiothreitol, 2% Triton X-100). The crude cell
lysates were cleared by centrifugation and 50 µl of cleared cell
extracts were added to 50 µl of luciferase assay buffer (125 mmol/L
NaMES, pH 7.8, 25 mmol/L Mg acetate, 2 mg/ml ATP) and activity was
measured after injection of 50 µl of 1 mmol/L D-luciferin (AppliChem,
Darmstadt, Germany) in a Berthold luminometer (Berthold, Bald Wildbach,
Germany). Total protein concentration was measured by the Bradford
technique (Biorad, München, Germany). The luciferase activities
were normalized on the basis of protein content as well as on
ß-galactosidase activity of cotransfected RSV-ß-gal vector. The
ß-galactosidase assay was performed with 20 µl of precleared cell
lysate according to a standard protocol as mentioned
earlier.28
Mean and standard deviations of four
independent experiments, each done in duplicate, are shown in the
figures.
Preparation of Nuclear Extracts and Electrophoretic Mobility Shift Assays (EMSA)
Cells were cultured under low serum conditions (1% FCS) for at
least 16 hours and then exposed to anoxic conditions for 1, 3 or 24
hours, respectively. Nuclear extracts were prepared according to
Dignam's procedure.29
Cells were washed with ice-cold
phosphate-buffered saline and pelleted. Supernatants were removed and
cells resuspended in 500 µl of buffer A (10 mol/L Hepes pH 7.9, 10
mol/L KCl, 0.1 mol/L EDTA, 0.1 mol/L EGTA, 1 mol/L dithiothreitol, 0.5
mol/L phenylmethylsulfonyl fluoride (PMSF)) and allowed to swell for 10
minutes. Cells were pulled 10 to 15 times through a 26G3/8 needle for
cell membrane disruption and nuclei were pelleted in a microcentrifuge.
Nuclei were washed twice in buffer A and resuspended in 50 µl of
buffer C (20 mol/L Hepes, 20% glycerol, 0.4 mol/L NaCl, 0.1 mol/L
EDTA, 0.1 mol/L EGTA, 1 mol/L dithiothreitol, 0.2 mol/L PMSF) and
incubated on ice for 45 minutes with occasional shaking. After
centrifugation, supernatants were harvested, frozen, and stored at
-70°C. The following double-stranded oligonucleotides were used:
AP-1 binding sequence (derived from IL-8 promoter region):
5'GAAGTGTGATGACTCAGGTTTGCCTGA3' and NF-B-like binding sequence
(derived from IL-8 promoter region): 5' GCGATCGTGGAATTTCCTCTGACGCTCGAG
3'. For EMSA, 3 µg of nuclear proteins were incubated at room
temperature for 20 minutes in a 20-µl binding reaction mixture
containing 20 mol/L Hepes, 50 mol/L KCl, 1 mol/L dithiothreitol, 1
mol/L EDTA, 5% glycerol, 2 µg poly(dI-dC) and 50,000 to 100,000 cpm
of 32P-end-labeled probe. The protein DNA complexes were
subjected to gel electrophoresis on a 5% non-denaturing polyacrylamide
gel in 0.5% TBE buffer. The antibodies 
-p65 and -cRel for
supershift analysis of NF-B complexes were purchased from Santa Cruz
Biotechnology (Heidelberg, Germany). The -p50 antibody was kindly
provided by Nancy Ricy, National Cancer Institute, Frederick, MD.
Antibodies for AP-1 supershift analyses (-cJun, -cFos, -cJunD)
were purchased from Santa Cruz Biotechnology. Gels were dried at 80°C
for 1 hour and exposed to Hyperfilm (Amersham) at -70°C.
Nucleotide Sequencing of the Genomic IL-8 Promoter Region
Genomic DNA was isolated from the mentioned cell lines (MV3, BLM, IF6, and 530) using a commercial DNA extraction kit (DNeasy kit, Qiagen) according to the manufacturer's specifications. 100 ng of genomic DNA were used for polymerase chain reaction (PCR) amplification of an IL-8 promoter region, spanning from the -407 position to the +17 position. The following primers were used: 5'ATCTTCACCATCATGATAGCATCTG3', 5'GTTTGTGCCTTATGGAGTGCTCG3'. PCR conditions were: an initial 5-minute denaturation step was followed by 35 cycles of 30 seconds of denaturation, 30 seconds of annealing, 1 minute of primer extension, and a terminal primer extension step of 10 minutes. PCR products were electrophoresed on an 1% agarose gel, cut out, and purified using the QiaexII gel extraction kit (Qiagen). Isolated PCR products were cloned into the pCRII vector (Invitrogen, Leek, The Netherlands). Five clones of the PCR product from each cell line were analyzed by sequencing using an automated capillary sequencer (Perkin Elmer, Weiterstadt, Germany).
Statistical Analysis
IL-8 levels in culture supernatants are given as means ± SD.
The Student's t-test was used for statistical analysis and
P 
0.05 was regarded as statistically significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To determine whether IL-8 is expressed in primary melanomas and
melanoma metastases we first studied IL-8 mRNA production by in
situ hybridization. Sections of primary melanoma lesions
(n = 10), metastases lacking necrotic areas
(n = 10), and metastases with clearly defined
necrotic areas were hybridized with radioactively labeled
35S-anti-sense, and as a control, sense IL-8 probes. A
pronounced IL-8 mRNA expression was detected only in metastases with
signs of necrosis represented as a band-like hybridization pattern
around necrotic areas (Figure 1)
. More
distant to the necrosis only single cells showed a weak IL-8-specific
hybridization signal (Figure 1, B and C)
. IL-8 mRNA expression was only
occasionally detected in single melanoma cells in primary melanomas and
non-necrotic metastases (data not shown). The expression pattern of
IL-8 mRNA in necrotic metastases did not correlate with the presence of
macrophages and neutrophils, as detected by immunohistochemical
staining of serial sections with anti-CD68 monoclonal antibodies and
anti-neutrophil elastase, respectively (Figure 1, E and F
; positively
stained cells in the central necrotic area are marked by arrowheads).
Thus, these cells seem not to contribute to the rim-like IL-8 mRNA
expression. To identify potential target cells for in vivo
synthesized IL-8 in necrotic melanoma metastases, we performed
immunohistochemical analyses for corresponding IL-8 receptors A and B
(CXCR1 and CXCR2). Eight out of 10 metastases displayed strong CXCR1
immunoreactivity of melanoma cells (Figure 2, A and C
; C, high power view of A).
Moreover, endothelial cells of small vessels (Figure 2C
, arrows) in the
vicinity of the metastasis were positively stained for CXCR1. Labeling
for CXCR2 (Figure 2, B and D
; D, high power view of B) showed much
weaker immunoreactivity of melanoma cells (5 of 10 metastases) whereas
endothelial cells were negative (Figure 2D)
. Taken together, our
in situ hybridization data demonstrate that IL-8 mRNA is
particularly expressed in a band-like pattern around necrotic areas in
melanoma metastases and both melanoma cells and endothelial cells may
serve as targets for IL-8.
|
|
To investigate whether anoxia is a potent stimulus for
IL-8 production in melanoma cells we measured IL-8 expression in
supernatants from four melanoma cell lines with different
aggressiveness. As shown in Figure 3
,
baseline production of IL-8 was similar in all four cell lines. On
anoxia there was a sixfold up-regulation of IL-8 production in the
highly aggressive cell lines MV3 and BLM (P
0.05), whereas in the low aggressive cell lines IF6 and 530 IL-8 levels
remained unchanged. After 24 hours of reoxygenation IL-8 levels
decreased in MV3 and BLM supernatants and returned to baseline levels
after an additional 24 hours of incubation (data not shown). The total
amount of non-viable cells was estimated by trypan blue staining and
neither exceeded 20% nor correlated with cytokine levels, suggesting
that IL-8 levels in culture supernatants are not a result of
nonspecific release due to cell death. To analyze whether IL-8
production is paralleled by elevated levels of IL-8 mRNA transcripts,
we performed Northern blot hybridization after 24 hours of normoxia and
anoxia, respectively (Figure 4)
. The two
highly aggressive lines (MV3 and BLM) showed a strong up-regulation of
IL-8 mRNA (12-fold). In contrast, in the low aggressive cell lines (IF6
and 530) we observed only a slight up-regulation (twofold) of mRNA
production under anoxia. To further address the question whether
elevated IL-8 levels under anoxia might be due to enhanced mRNA
stability we performed Northern blots after inhibition of mRNA
transcription by incubation of cells with actinomycin D (Figure 5, A and B)
. These experiments were
performed in the highly aggressive cell lines since only these
displayed a significant mRNA up-regulation. Before addition of
actinomycin D both cell lines expressed low levels IL-8 mRNA under
normoxic condition (Figure 5
, left), but 15 hours of anoxic treatment
led to a strong induction of the chemokine (Figure 5
, right). Addition
of actinomycin D decreases IL-8 mRNA levels in a time-dependent fashion
(see also diagrams in the lower right corners). Anoxia prolonged mRNA
half-life by a factor of 2.3 (MV3) and 2.5 (BLM), respectively,
indicating that mRNA stabilization might contribute to the elevated
mRNA levels.
|
|
|
To evaluate whether anoxia induces enhanced
transcriptional activation of the IL-8 promoter, we used a firefly
luciferase reporter gene linked to wild-type and mutated IL-8 promoters
in luciferase assays (Figure 6A)
. On
anoxic treatment a 7.2-fold up-regulation of transcriptional activity
of the wild-type promoter, harboring AP-1 and NF-B-like binding
sites, was observed in the highly aggressive cell line MV3 (Figure 6B)
.
In contrast, the low aggressive cell line 530 showed only a 2.2-fold
induction of transcriptional activation. Interestingly, point mutations
in the AP-1 or the NF-B-like binding sites in the IL-8 promoter
abolished transcriptional activity, indicating that both factors are
important for IL-8 regulation under anoxia. Consistent with previously
published data, TPA, a potent inducer of AP-1 and NF-B activity, was
used as a positive control and induced a five- to eightfold stimulation
of luciferase activity (data not shown). Taken together, up-regulation
of IL-8 mRNA correlates with the enhanced transcriptional activity of
the promoter in the highly aggressive melanoma cells. To exclude the
fact that different mRNA induction levels, as described above, may be
due to genomic mutations within the IL-8 promoter region, genomic DNA
was isolated from the four cell lines. The nucleotide position from
-407 to nucleotide position +17 was PCR-amplified and sequenced. From
position -407 to +17, which carries the binding motifs for AP-1 and
NF-B, no mutations could be detected in the promoter regions of all
four cell lines (data not shown).
|
B Transcription
Factors in Highly Aggressive Melanoma Cells
Induction of IL-8 gene expression is dependent on the activation
of both transcription factors AP-1 and NF-B.30-33
To
address the question of whether both transcription factors are
stimulated by anoxia in MV3 and 530 cells, we performed EMSA using
specific IL-8 promoter-derived sequences as probes. As shown in Figure 7
, low constitutive AP-1 binding activity
was observed in 530 cells under normoxic conditions, which was not
inducible and even decreased on anoxic treatment. In contrast, AP-1
complexes were strongly induced in the highly aggressive cell line MV3
after 24 hours of anoxia. TPA was used as a positive control and
induced similar AP-1 binding activity in both cell lines (data not
shown). To identify specific AP-1 protein complexes, we performed
supershift experiments from nuclear extracts of MV3 cells (after 24
hours of anoxia) using AP-1-specific antibodies. As shown in Figure 7
,
anoxia-induced protein complexes were partly supershifted with the
anti-cJun antibody and completely supershifted with the anti-cFos
antibody. Anti-JunD antibody added a faint band, suggesting that at
least a small portion of the AP-1 complex might contain JunD. Moreover,
in MV3 we observed a constitutive binding of NF-B transcription
factors, which were slightly induced after 3 hours of anoxia (Figure 8B)
. A further band was induced after 24
hours of anoxia. Both complexes were identified by competition with a
10-fold and 100-fold molar excess, respectively, of cold probe. As
demonstrated by supershift analysis these protein complexes contain
NF-B p50 and p65 subunits, respectively. The lower band was
supershifted by anti-p50 and the upper band was supershifted by
anti-p65 (faint complex, visible only in the highly aggressive MV3
cells). Anti-cRel antibody did not supershift. In the low aggressive
cell line 530 (Figure 8A)
a significant induction of NF-B complexes
was not observed and complexes were faint. In summary, these data
suggest an important role of both transcription factors, AP-1 and
NF-B, for hypoxic gene regulation in aggressive melanoma cells.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B and also transcriptional
activation of the IL-8 promoter only in the highly aggressive melanoma
cells. High levels of IL-8 were detected exclusively in those areas of cutaneous metastases which were close to focal necrosis and presumably under severe hypoxic/anoxic stress and the IL-8 mRNA expressing cells were identified as melanoma cells. Notably, IL-8 mRNA in primary melanoma lesions and non-necrotic metastasis was absent or low, indicating that IL-8 may not play an important role as a promoter of tumor growth and spreading in primary melanoma. High levels of IL-8 in necrotic areas might even contribute to the high serum levels of IL-8 found in patients with widespread melanoma metastasis.15 The fact that the local microenvironment might be of importance for IL-8 production in vivo was recently demonstrated by Gutmann et al,34 who showed that IL-8 production of melanoma metastases after injection into nude mice depended on the organ environment. Interestingly, low vascularized tissue, like skin, induced high IL-8 levels, whereas highly vascularized tissue, especially lung and liver, induced low IL-8 levels. The tumor-promoting features of IL-8 in vivo were demonstrated by recent mouse studies with different melanoma cell lines showing that tumor growth and aggressiveness correlated with IL-8 levels of melanoma cells in vitro.16,17 Together, all mentioned studies underline the physiological relevance of IL-8 as a potent factor in vivo. Interestingly, similar findings regarding IL-8 production in rapidly growing tumors have recently been reported for glioblastoma, a highly aggressive tumor of the central nervous system.35,36
Our in vitro studies provide evidence that up-regulation of
IL-8 mRNA under anoxia is due to both enhanced transcriptional
activation of the IL-8 gene and increased mRNA stability. Similar
results had been obtained for VEGF induction under hypoxia in C6 glioma
cells and PC12 cells.26,37,38
Additionally, we could show
by EMSA and reporter gene analysis that anoxia-induced IL-8 production
in highly aggressive melanoma cells seems to be dependent on the
transcription factors AP-1 and NF-B. Although an interaction of both
transcription factors, AP-1 and NF-B, in IL-8 gene regulation has
been shown after a variety of stimuli, eg, mitogens, proinflammatory
cytokines, and viral infections,30-33,39
little is known
about the role of both factors in hypoxic gene
regulation.40-41
According to our data we propose that
both transcription factors act in a cooperative manner, since both
factors are simultaneously activated and mutations in each of the
corresponding binding sites totally abrogated transcriptional activity
in luciferase assays. Similar data have been recently reported for
glioblastoma, showing that anoxia-induced AP-1 activity was paralleled
by constitutive NF-B activity.36
Interestingly,
hypoxia-inducible factor seems to play no role for anoxic induction of
IL-8, as no binding motif can be detected in the published IL-8
promoter region.42,43
However, we cannot rule out that
hypoxia-inducible factor binds to and indirectly interacts with AP-1,
as has been suggested by recent data.44
It should also be
noted that regulation under hypoxia and anoxia shows differences at
least in some regulated genes, eg, VEGF and p53. VEGF mRNA is already
up-regulated under physiological hypoxia. In contrast, p53 requires
pathological anoxia.45
This might provide an explanation
for the different mRNA kinetics for VEGF and IL-8 under anoxia and the
different distribution pattern for both cytokines observed in
glioblastoma.36
Since rapidly growing tumors display both
hypoxia and anoxia,46
both factors might be of importance
for tumor biology.
Our in vitro data showed that the high aggressiveness of our
melanoma cell lines correlated with elevated IL-8 production and
activation of the transcription factors AP-1 and NF-B under anoxic
stress. The underlying mechanisms which contribute to the different
responsiveness of our cell lines are not yet clear, although it seems
likely that upstream activators might be differently regulated under
anoxic conditions. Recent data suggest that the family of
mitogen-activated protein kinases is involved in hypoxic/anoxic gene
regulation.47-48
Further upstream activators of
mitogen-activated kinases remain to be defined; eg, the existence of a
membrane-bound oxygen sensor is speculative up to now. However, the
different responsiveness of such a sensor might be a further
explanation for our findings.
It has been shown that tissue hypoxia/anoxia indeed renders tumors
highly aggressive.49
In those experiments tumor
aggressiveness had been attributed to subsequent DNA over-replication
and the induction of mutations after hypoxia/reoxygenation. Although
this in fact might be the case, our data provide an alternative
explanation for anoxia-induced tumor aggressiveness. Anoxia-induced
tumor aggressiveness via IL-8 up-regulation might be explained by at
least two different mechanisms, induction of angiogenesis and induction
of tumor growth as an autocrine growth factor for melanoma cells. It is
well established in in vivo models that IL-8 is a potent
angiogenic factor.19-21,50,51
Although the corresponding
receptors CXCR1 and CXCR2 could not be detected on cultured endothelial
cells in vitro,52
in vivo
angiogenesis was blocked by IL-8-specific antibodies,20
suggesting that the lacking of IL-8 receptors in vitro is a
culture artifact. The pivotal role of IL-8 in angiogenesis was
emphasized by Yoshida et al,51
who could demonstrate that
tumor necrosis factor--induced tubulus formation of endothelial
cells in collagen gels is attributable to IL-8. In accordance with
these data, we could clearly detect CXCR1 on endothelial cells of small
vessels in the melanoma metastases. Therefore, we conclude that IL-8
might act as an angiogenic factor in vivo and transduces its
angiogenic effects through CXCR1 which in contrast to CXCR2 only binds
IL-8 as the specific ligand. Moreover, it has been recently shown that
melanoma cells express the CXCR1 and CXCR2 and IL-8 binds to both
receptors and acts as an autocrine growth factor, inducing
proliferation.14,53
The CXCR2 also binds another member of
the CXC chemokine superfamily, the chemokine growth- related oncogene
(synonymous with melanoma growth-stimulating activity)
Gro-, which is also known to act as an autocrine growth factor for
melanoma.53,54
The signaling mechanisms are not yet clear
but recent data implicate that activated CXCR1 and CXCR2 are able
to further activate extracellular signal regulated kinase 1/2
(ERK1/2) and in this way induce proliferation.55-57
We found a strong positive reaction for CXCR1 on melanoma cells in
metastases, and considerably weaker staining for CXCR2. This implicates
that in vivo melanoma cells might serve as autocrine target
cells for IL-8 mainly via CXCR1.
In summary, our data provide evidence that the differential responsiveness to local tissue factors such as anoxia might be an explanation for the different aggressiveness of tumor cells. Tumor cells that are able to overcome the adverse conditions of the microenvironment have a higher potential to survive and induce further metastasis. Further, anoxia-regulated genes such as IL-8 are involved in melanoma progression and metastasis and the described regulatory mechanisms for anoxia-induced IL-8 production might serve as a target for further therapeutic strategies.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Supported by Wilhelm Sander-Stiftung, Contract Grant 95:064 and IZKF (Interdisciplinary Clinical Research Center), Würzburg, Project B 5.
Accepted for publication May 24, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B is a target for glucocorticoid-mediated interleukin-8 gene repression. J Biol Chem 1994, 269:13289-13295 gene expression in T lymphocytes. J Biol Chem 1999, 274:4319-4327B- and cis-regulatory enhancer binding protein-like factor binding elements in activating the interleukin-8 gene by proinflammatory cytokines. J Biol Chem 1990, 265:21128-21133B-binding sites of the interleukin-8 gene. J Virol 1997, 71:5692-5695[Abstract]
and interferon 
synergistically induce interleukin 8 production in a human gastric cancer cell line through acting concurrently on AP-1 and NF-B-like binding sites of the interleukin 8 gene. J Biol Chem 1992, 267:22506-22511B, and CCAAT/enhancer-binding protein-like cis-elements. J Biol Chem 1991, 266:13759-13763B. Eur J Biochem 1995, 234:632-640[Medline]
-dependent angiogenesis. Mol Cell Biol 1997, 17:4015-4023[Abstract]
This article has been cited by other articles:
 |
|
 |
|
  R. Meyuhas, E. Pikarsky, E. Tavor, A. Klar, R. Abramovitch, J. Hochman, T. G. Lago, and A. Honigman A Key Role for Cyclic AMP-Responsive Element Binding Protein in Hypoxia-Mediated Activation of the Angiogenesis Factor CCN1 (CYR61) in Tumor Cells Mol. Cancer Res., September 1, 2008; 6(9): 1397 - 1409. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Liang, A. Sharma, H.-H. Peng, G. Robertson, and C. Dong Targeting Mutant (V600E) B-Raf in Melanoma Interrupts Immunoediting of Leukocyte Functions and Melanoma Extravasation Cancer Res., June 15, 2007; 67(12): 5814 - 5820. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Yano, Y. Fujii, A. Iwai, Y. Kageyama, and K. Kihara Glucocorticoids Suppress Tumor Angiogenesis and In vivo Growth of Prostate Cancer Cells. Clin. Cancer Res., May 15, 2006; 12(10): 3003 - 3009. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. H. Benoy, R. Salgado, P. Van Dam, K. Geboers, E. Van Marck, S. Scharpe, P. B. Vermeulen, and L. Y. Dirix Increased Serum Interleukin-8 in Patients with Early and Metastatic Breast Cancer Correlates with Early Dissemination and Survival Clin. Cancer Res., November 1, 2004; 10(21): 7157 - 7162. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Billecocq, M. Spiegel, P. Vialat, A. Kohl, F. Weber, M. Bouloy, and O. Haller NSs Protein of Rift Valley Fever Virus Blocks Interferon Production by Inhibiting Host Gene Transcription J. Virol., September 15, 2004; 78(18): 9798 - 9806. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Kunz, S. Moeller, D. Koczan, P. Lorenz, R. H. Wenger, M. O. Glocker, H.-J. Thiesen, G. Gross, and S. M. Ibrahim Mechanisms of Hypoxic Gene Regulation of Angiogenesis Factor Cyr61 in Melanoma Cells J. Biol. Chem., November 14, 2003; 278(46): 45651 - 45660. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Karashima, P. Sweeney, A. Kamat, S. Huang, S. J. Kim, M. Bar-Eli, D. J. McConkey, and C. P. N. Dinney Nuclear Factor-{kappa}B Mediates Angiogenesis and Metastasis of Human Bladder Cancer through the Regulation of Interleukin-8 Clin. Cancer Res., July 1, 2003; 9(7): 2786 - 2797. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Mukaida Pathophysiological roles of interleukin-8/CXCL8 in pulmonary diseases Am J Physiol Lung Cell Mol Physiol, April 1, 2003; 284(4): L566 - L577. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Lu, Y. Nakamoto, Y. Nemoto-Sasaki, C. Fujii, H. Wang, M. Hashii, Y. Ohmoto, S. Kaneko, K. Kobayashi, and N. Mukaida Potential Interaction between CCR1 and Its Ligand, CCL3, Induced by Endogenously Produced Interleukin-1 in Human Hepatomas Am. J. Pathol., April 1, 2003; 162(4): 1249 - 1258. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. K. L. Woodward, S. R. Elshaw, A. K. Murray, C. E. Nichols, N. Cross, D. Laws, I. G. Rennie, and K. Sisley Stimulation and Inhibition of Uveal Melanoma Invasion by HGF, GRO, IL-1{alpha} and TGF-{beta} Invest. Ophthalmol. Vis. Sci., October 1, 2002; 43(10): 3144 - 3152. [Abstract] [Full Text] [PDF]
|
|
|
|
|
