| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Animal Model |
2-Macroglobulin- and Murinoglobulin-1- Deficient Mice
From the Experimental Genetics Group, Center for Human Genetics, Flemish Institute for Biotechnology, Leuven, Belgium
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2-macroglobulin (MAM) and
murinoglobulin-1 (MUG1) were generated and proved phenotypically normal
under standard conditions. Acute pancreatitis was induced with a diet
deficient in choline and methionine, supplemented with
ethionine. The mortality was less than 25% in wild-type mice,
as opposed to at least 56% in knockout mice, and was highest
(70%) in MAM-/- mice, with earliest onset at 2 days. Plasma
amylase and lipase levels were increased, but pancreatic tissue
appeared histologically variable in individual mice. The clinical
symptoms were most severe in MAM-/- mice and,
surprisingly, were not aggravated in the double knockout
mice, suggesting that the lack of proteinase inhibition
capacity was not the major problem. Therefore, we analyzed the
expression of 21 different cytokines and polypeptide factors in the
pancreas of all experimental groups of mice. Interleukin-1-receptor
antagonist mRNA was consistently induced by the diet in the pancreas of
MAM-/- mice, and transforming growth factor-ß,
tumor necrosis factor-, tumor necrosis factor-ß,
ß-lymphotoxin, and interferon-
mRNA levels were also
increased. The data demonstrate the important role of
2-macroglobulin (A2M) in acute pancreatitis as both a
proteinase inhibitor and a cytokine carrier. Mice deficient in MAM
and/or MUG thus offer new experimental models for defining in
vivo the role of the macroglobulins in pancreatitis and in
other normal and pathological processes.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2-macroglobulin (MAM) and murinoglobulin (MUG) are
molecularly characterized members of the 2-macroglobulin
(A2M) family.1-5
MAMs are all broad-spectrum
inhibitors of proteinases, including pancreatic trypsin and
chymotrypsin, that act by trapping or covalent tagging after
proteolytic cleavage of the bait region.1,6
The expression
of the cryptic receptor binding domain allows A2M-proteinase complexes
to bind to the A2M receptor,7
molecularly identified as
the multifunctional lipoprotein
receptor-related protein.8
Elimination is efficient and
keeps circulating levels of A2M-proteinase complexes in plasma low,
even in severe cases of acute pancreatitis.9-13
The original function of A2M as a proteinase scavenger was complemented
by a role as a binding protein for various growth factors, polypeptide
hormones, and cytokines. The number of different cytokines that bind to
A2M is steadily increasing and includes transforming growth factor-ß
(TGF-ß), interleukin-1 (IL-1), IL-2, IL-6, IL-8, platelet-derived
growth factor (PDGF), tumor necrosis factor- (TNF-), basic
fibroblast growth factor (bFGF), interferon-, activin, inhibin,
epidermal growth factor, vascular epidermal growth factor, nerve growth
factor-ß, brain-derived neurotrophic factor, neurotrophin-3,
neurotrophin-4, and ciliary neurotrophic factor, among
others.14-17
Major differences in binding mode and
affinity to particular conformers of A2M, ie, native or activated A2M,
were noted, and binding to activated A2M necessarily implicates only
the rapid elimination of the bound cytokine or factor as noted above
for A2M-proteinase complexes. Because most interactions were
demonstrated in vitro, their physiological meaning in
vivo is largely unexplored.
The binding of A2M to both proteinases and cytokines suggests an
important role for A2M in many diseases and processes. In this report
we concentrated on the role of A2M in a particular condition, ie, acute
pancreatitis. In humans, acute pancreatitis typically varies in
intensity from mild self-limiting or edematous pancreatitis to severe,
acutely hemorrhagic necrotizing disease, with multiple organ failure
and fatal outcome. High plasma levels of pancreatic enzymes, ie,
amylase, lipase, and trypsin(ogen), were
described.9,18-20
Although diagnostically valuable,
levels of circulating pancreatic enzymes have limited value in
assessing the etiology or severity of acute
pancreatitis.21-23
Attention has been given to the levels
and the role of the circulating proteinase inhibitors, ie,
2-macroglobulin (A2M), 1-proteinase inhibitor, and
1-antichymotrypsin, among others.10,11,24
Plasma A2M
levels allow differentiation between mild and complicated
attacks.12
In addition to proteinase inhibitors, inflammatory cytokines act as
pathogenic mediators of acute pancreatitis. Death in most patients is
caused not by pancreatic inflammation per se, but rather by
multiorgan failure, to which pro-inflammatory cytokines could
contribute. Studies with patients and in animal models demonstrated
production or overproduction of different cytokines, ie, interleukin-1
(IL-1), IL-6, IL-8, and tumor necrosis factor-
(TNF-).25-29
Transforming growth factor-ß (TGF-ß)
has been implicated in the disease process and in regeneration from
acute pancreatitis.30-32
Cytokine production not only
correlated to disease severity, but involvement of the pancreas
preceded that of other organs, indicating that they participate
in or even determine on the progression from initial, local pancreatic
inflammation to the multiorgan process.33
The implication of these two completely different classes of proteins, ie, proteinases and cytokines, in the pathology of acute pancreatitis, in which both bind to A2M, suggested a moderating role for A2M in acute pancreatitis. The role of A2M in acute pancreatitis was tested in mice with a targeted inactivation of the A2M gene.34 Mice, as opposed to humans, also express murinoglobulins (MUG), single-chain variants typical for rodents, and one, MUG1, is transcriptionally important.2,5,35 We report here the inactivation of this gene and the generation of doubly deficient MAM-/-MUG1-/- mice. Because the MAM and MUG1 genes proved to be closely spaced, recombination by breeding was circumvented by generating embryonal stem (ES) cell lines with both MAM and MUG1 genes targeted. The singly and doubly deficient mice were viable, fertile, and phenotypically normal. Acute pancreatitis was induced with a diet deficient in choline and methionine and supplemented with ethionine (the CDE diet).36 Surprisingly, the high susceptibility and mortality of MAM-deficient mice were not made worse by the extra deficiency in MUG1, thereby excluding that lack of proteinase inhibitor capacity was the major problem. RNA protection assays identified expression of different cytokines and polypeptide factors in the pancreas; in particular, IL-1 receptor antagonist (IL-1Ra) correlated most closely with clinical findings. These mice, deficient in either MAM or MUG1 or in both inhibitors, provide interesting models for defining the role of proteinases and cytokines not only in the etiology of acute pancreatitis, but also in other diseases and conditions.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The MUG1 construct was based on a 7.5-kb
NheI-BamHI genomic clone comprising exons 18 to
25 of the MUG1 gene.5
A 0.9-kb
ScaI-KpnI fragment with exon 18 and part of exon
19 was replaced by a 1.8-kb cassette containing the phosphoglycerate
kinase gene promoter driving the hygromycinB phosphotransferase
cDNA37
(Figure 1)
. Before
electroporation into ES cells, the construct was linearized with
SalI. For the double knockout, the MUG1 gene was targeted in
ES cell lines that contained a recombined MAM gene34
using
a construct producing neomycin resistance4
(Figure 1)
. ES
cells (line E14, 129/ola)38
grown on mitomycin STO feeders
with single or double antibiotic resistance were positively selected in
medium containing either hygromycinB (100 µg/ml) or neomycin (400
µg/ml) or both. Colonies were picked, expanded, frozen, and genotyped
by Southern blotting with probes located outside, at either end of the
MUG1 fragment (Figure 1)
: a 0.4-kb HindIII/NheI
genomic DNA fragment at the 5' end (L probe); a 0.6-kb
BamHI/ClaI genomic DNA fragment located outside
the 3' end (R probe); a 1.8-kb BglII fragment of the
PGK-hygromycin gene; a 1.1-kb BglII fragment of the
PGK-neomycin gene.4,34,37
Homozygous deficient mice were
obtained and genotyped by Southern blotting or polymerase chain
reaction (PCR) as described.34
PCR mixtures contained 0.1
µmol/L of each primer, 200 µmol/L of each dNTP, 50 mmol/L KCl, 10
mmol/L Tris-HCl, 1.5 mmol/L MgCl2, and 1.25 units
of Taq DNA polymerase, in a total volume of 50 µl.
Wild-type MUG1 allele was amplified with a forward primer located in
exon 17 (position 1986–2004) and a reverse primer in exon 18 (position
2098–2119).5
Targeted alleles were amplified with a
reverse primer located in exon 19 (position 2439–2457) in combination
with forward primers either in the hygromycin gene (5'
GATGTGGAATGTGTGCGA 3') or in the neomycin gene (5'
GTCAAGAAGGCGATAGAAGGCGAT 3'). Diagnostic amplicons were, respectively,
1.9 kb for wild-type and 0.2 and 1 kb for recombined MUG1 alleles.
|
Total liver RNA was extracted with Trizol reagent (Gibco BRL, Glasgow, UK) and analyzed by Northern blotting.34 Probes were generated by PCR amplification, corresponding to position 1188–1758 of the MAM cDNA3 and to position 1777–2262 of the MUG1 cDNA.2 RNA protection assays were performed on total pancreas RNA with commercially available reagents (Riboquant Multiprobe RNase Protection Assay, Pharmingen, San Diego, CA). Autoradiographs taken for different exposure times on Hyperfilm MP were scanned and quantitated densitometrically (Amersham-Pharmacia, Uppsala, Sweden).
Diet-Induced Acute Pancreatitis
Choline- and methionine-deficient powder (CDE diet, Tecklad Harlan CPB, AD Zeist, The Netherlands) was supplemented with D,L-ethionine (final concentration 0.5% w/w). Mice had free access to water and either regular chow or to CDE powder for 2 to 5 days. Mice were killed with chloroform and pancreata were isolated. Pancreatic tissue was fixed in 4% paraformaldehyde for 3 hours and embedded in paraffin, and thin sections were stained with hematoxylin and eosin. Serum amylase and lipase levels and blood glucose levels were determined using clinical kits or analyzers. Immunohistochemistry for IL-1Ra was performed on dewaxed sections (5 µm). Biotinylated antibody to mouse IL-1Ra (R&D Systems, Abingdon, UK) was reacted overnight at room temperature, followed by inactivation of endogenous peroxidase and incubation with streptavidin-biotin complex. Reaction was visualized with diaminobenzidine and H2O2. All numerical data are expressed as means ± SE and analyzed by two-tailed Student's t-test.
Analysis of Binding of IL-1Ra to Mouse and Human A2M and Murinoglobulin
Recombinant IL-1Ra (R&D Systems) was incubated with purified MAM or human A2M or added to mouse plasma or serum, separated by nondenaturing rate electrophoresis and denaturating sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and analyzed by Western blotting. The presence of endogenous mouse IL-1Ra was also analyzed on samples of mouse plasma and serum taken from wild-type C57Bl/6 mice and from MAM-/-, MUG1-/-, and MAM-/-MUG1-/- mice.
Samples of purified human and mouse A2M (4 µg) and plasma and serum samples (1 or 2 µl) were diluted and incubated in phosphate buffered saline containing a mixture of proteinase inhibitors, and in specified experiments, with extra addition of recombinant IL-1Ra, and with or without extra addition of 5 mmol/L calcium ions. Samples were incubated for 30 minutes at room temperature and products were subjected to nondenaturating rate electrophoresis in homogenous (6%) or gradient (4–20%) Tris-glycine PAGE. After electrophoretic transfer to nitrocellulose membranes (Hybond-C, Amersham, Uppsala, Sweden) and inactivation with fat-free milk, sequential incubation was done with a biotinylated antibody to IL-1Ra (R&D Systems) and with streptavidin-peroxidase for detection of immune complexes with the enhanced chemiluminescence system (Amersham).
In other experiments, similar samples were transferred and blots were analyzed by ligand blotting by incubating the membranes with recombinant IL-1Ra (0.01–0.1 µg/ml) for 1 hour. After washing, detection of IL1-Ra binding to immobilized proteins was performed with the antibody to IL-1Ra Ab as described above.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In a 7.5-kb genomic clone comprising exons 18 to 25 of the MUG1
gene from the 129 mouse strain (129/J library, 5) we replaced a 0.9-kb
ScaI-KpnI fragment containing exon 18 and 108 bp
of exon 19 with a 1.8-kb XhoI-ClaI cassette
encoding the hygromycin B phosphotransferase gene.37
Before electroporation into ES cells, the construct was linearized with
SalI (Figure 1A)
. Selection in hygromycin containing medium
yielded 428 colonies that were genotyped by Southern blotting
(SstI digestion and hybridization with the L probe).
The 19 ES clones with correct hybridization pattern (Figure 1A, C)
were
expanded and genotyped with the three probes (L, R, and hyg; see Figure 1, A and C
). Eventually, five ES cell lines with the expected
restriction and hybridization patterns (overall frequency of
recombination, 1.2%) were injected into C57Bl blastocysts and resulted
in coat-color chimeric offspring. Only one line transmitted the
targeted MUG1 gene through the germline. From a total of 195 offspring,
44 were homozygous (22.6%), 104 heterozygous (53.3%), and 47
wild-type (24.1%) mice, establishing a normal mendelian inheritance
pattern of the targeted MUG1 gene. Homozygous MUG1-deficient breeding
pairs produced litters of normal size with normal frequency. At this
writing, the oldest MUG1-/- mice approach 18 months of age and still
appear healthy in our open animal house.
Proof of MUG1 mRNA deficiency was obtained on liver RNA from
wild-type, heterozygous, and homozygous MUG-deficient mice. The 5-kb
MUG1 mRNA was absent in the liver of MUG1-/- mice (Figure 1E)
even
after overexposure for 7 days (results not shown). Subsequent
hybridization of the same membrane with the MAM cDNA probe revealed the
typical 5-kb mRNA in all mice (Figure 1E)
.
Plasma proteins were analyzed by rocket immunoelectrophoresis (results
not shown) and by SDS-PAGE (Figure 1F)
. Plasma of MUG1-/- mice was
devoid of MUG1 protein, whereas plasma levels of MAM were normal
(Figure 1F
, lane 3). Inactivation of the MUG1 gene was complete and not
replaced by expression of other murinoglobulin isoforms, confirming
that only the MUG1 gene is transcriptionally active.2,5,35
Generation of MAM/MUG1 Double Knockout Mice
To generate double MAM/MUG1 knockout ES cells, a MUG1 construct
with a neomycin resistance gene (Figure 1B)
was electroporated into an
ES cell line with one MAM allel targeted with a hygromycin resistance
gene.34
Double selection in medium containing both
neomycin and hygromycin, yielded 572 resistant ES cell colonies,
analyzed by Southern blotting (SstI restriction and
hybridization with L probe; Figure 1
). The 17 ES cell lines with a
targeted MUG1 gene were expanded and re-analyzed with the three probes
(Figure 1B, D)
, resulting in eight ES cell lines with a correctly
targeted MUG1 gene and with one copy of the targeted MAM
gene.4
This equaled a 1.4% frequency of recombination.
Of three cell lines yielding germline chimeras, two produced pups with both recombinant alleles. Crossing and genotyping of offspring over several generations demonstrated that the MUG1 and the MAM gene were in linkage disequilibrium. This was confirmed by crossings of single knockout mice, from which double MAM/MUG1 deficient mice were rarely obtained, following chromosomal recombination events (5.3% recombination frequency). Matings of double heterozygous MAM+/-MUG1+/- mice eventually resulted in mice homozygous for both inactivated gene (results not shown).
Proof of deficiency of MAM and MUG in the homozygous double transgenic
mice was obtained by Northern blotting of liver mRNA and by plasma
protein electrophoresis as above. Liver of double heterozygous
MAM+/-MUG1+/- mice contained about half the mRNA levels relative to
wild-type mice (Figure 1E)
, and the 5-kb MAM and MUG mRNA transcripts
were completely absent in the liver of the double knockout mice (Figure 1E)
. Electrophoresis of plasma proteins demonstrated the presence or
absence of the 165- and 35-kd subunits of MAM3
and/or of
the 180-kd subunit of MUG15
(Figure 1F)
.
The MAM-/-MUG1-/- mice produced litters of normal size with a normal frequency, establishing a mouse strain that is devoid of all A2M family members. This is experimental proof that these proteinase inhibitors are not vitally needed, opposite to what we inferred from the lack of humans deficient in A2M (Ref. 1, and references therein). Individual doubly deficient MAM-/-MUG1-/- mice have been under observation for over 15 months and appear normal and healthy in open animal housing conditions.
Single and double knockout mice were back-crossed into the C57Bl mouse strain for at least 6 generations. To exclude the possibility that the whole breeding colony would be derived from only a few mice, six couples per generation were used. Mice with a C57Bl background of at least 98.5% were obtained, which alleviated problems with differences in genetic background between experimental and control mice (C57Bl) in subsequent experiments.
Experimental Induction of Edematous Pancreatitis
Edematous pancreatitis was first experimentally attempted by induction with cerulein, following a regime of 7 injections every hour.39,40 Amylase and lipase levels in plasma were significantly increased in all genetically modified mice relative to wild-type C57Bl mice (results not shown) but during and following the experiment, all mice appeared healthy and behaved normally. Macroscopically, the pancreas appeared somewhat swollen and enlarged, but histologically, no major signs of necrosis were noted. Only the appearance of vacuoles in the cytoplasm of acinar cells was different, relative to animals receiving vehicle only. Subsequent studies were therefore performed with another model of induction of acute experimental pancreatitis, ie, by using a diet deficient in choline and methionine and supplemented with ethionine.36
Experimental Induction of Acute Hemorrhagic Pancreatitis
Mortality
In preliminary experiments, the mortality of MAM-/- mice resulting from the CDE diet was compared in mice with a mixed 129 x C57Bl background34 and after backcrossing into the C57Bl background. Mortality was 60% in MAM-/-MUG1-/- mice in the C57Bl strain after 5 days of CDE diet, whereas in the mixed 129 x C57Bl background, mortality was only 23%. This demonstrated the importance of the genetic background, although this back-crossing was time-consuming and expensive. To exclude the influence of the C57Bl genetic background in the following experiments, mice were also backcrossed to the FVB mouse strain for 6 generations. Because preliminary experiments revealed no difference between the C57Bl and FVB mouse strain, the data reported here were all obtained from mice back-crossed into C57Bl.
The CDE diet was tested in a total of 6 independent experiments spread
over a period of 10 months. Each test lasted from 2 to 5 days and
resulted in an overall mortality rate of 27% in wild-type C57Bl mice
and at least 56% in all of the deficient mice (Figure 2)
. Surprisingly, mortality commenced
most early in the MAM-/- mice, in all experiments. Typically, after 5
days on the CDE diet, nearly 70% of the MAM-/- mice had succumbed
(Figure 2)
. MUG1-/- mice were more sensitive to the diet than
nontransgenic mice but less than MAM-/- mice, whereas the combined
deficiency of both inhibitors in MAM-/-MUG1-/- mice did not
aggravate mortality, and even alleviated the effect as far as time of
onset was concerned (Figure 2)
.
|
Because amylase and lipase levels are the highest between 60 and
72 hours,41
mice were given the CDE diet for 66 hours to
measure enzyme and cytokine levels. Enzymatic activity of amylase and
lipase increased in plasma of all mice, confirming as expected the
development and course of acute pancreatitis. After 66 hours of diet,
concentrations of amylase and lipase peaked in the MAM knockout mice,
to 4 and 10 times higher levels, respectively, relative to
nontransgenic C57Bl mice (P < 0.01; Figure 3
). Levels of both enzymes were higher in
MAM-/- mice than in MUG1-/- mice (P < 0.05) and, in
complete accord with the mortality data, the amylase level was also
significantly higher than in doubly deficient MAM-/-MUG1-/- mice
(P < 0.05; Figure 3
). These effects were reversible
since feeding regular chow following a 3-day CDE diet, resulted in
complete normalization of amylase and lipase activities in plasma of
all mice, including MAM-/- mice, after 4 days (results not shown).
|
. High activity of both enzymes was
conspicuously evident after 48 hours with values much higher than in a
group of MAM-/- mice, all analyzed nonselectively after 48 hours on
the same CDE diet (Figure 4)
. Importantly, these very high levels of
amylase and lipase activity coincided with the onset of mortality in
the MAM-/- mice (Figure 2)
.
|
Histology of the Pancreas
After 3 days of the CDE diet, pancreatic morphology was largely
unaffected and normal, with minimal differences between the 4 groups.
Occasionally, minor areas of the pancreas were necrotic and showed
signs of infiltration by immune cells (Figure 5, A and B
, and Table 1
). The exception was a pronounced
vacuolization of acinar cells in the MAM-/- mice (Figure 5C)
,
not evident in mice of the other experimental groups.
|
|
showed massive necrosis
of the pancreatic acini with inflammatory infiltration and hemorrhage,
although in some mice there was still no evidence of histological
alteration of the pancreas (Figure 5, D and E
, and Table 1
). The degree
of necrosis was not markedly different in the MAM-/- mice relative to
wild-type C57Bl mice on the same diet for the same duration, a finding
that indicated that necrosis and mortality did not correlate.
Obviously, this outcome was distorted in the sense that only the
surviving mice, which were fewer in number in the MAM-/-
group, were examined. Nevertheless, in all experiments taken together,
no correlation was discerned between the amylase and lipase activities
in the plasma and the degree of necrosis of the pancreas (results not
shown).
One of the remarkable morphological features in severely affected
pancreata after 5 days of CDE diet in MAM-/- mice (5 of 7) and
MAM-/-MUG1-/- mice (5 of 10) was the appearance of acini with an
enlarged lumen (Figure 5, E and F)
. This might result from atrophy of
the acinar cells or might indicate acino-ductular metaplasia, a
phenotypic trait much rarer in nontransgenic C57Bl mice (2 of 29 mice)
or in MUG1-/- mice (1 of 6). The CDE diet also affected the liver,
resulting in hepatic cell necrosis, formation of large vacuoles, and
inflammatory infiltration, observed in all mice (Figure 5, G and H)
.
These lesions became apparent after 2 days of CDE diet and remained
unchanged thereafter. In addition, 4 days of regular chow after 3 days
of CDE diet restored liver morphology to a nearly normal microscopic
appearance (results not shown). The histology of the lungs from mice
that received the diet between 48 and 96 hours was completely normal
(results not shown).
Expression of Cytokines in the Pancreas
RNA protection assays covering 21 different cytokines and
polypeptide hormones revealed that mRNA coding for IL-1Ra, TNF-ß,
Lt-ß, TNF-, IFN-, and TGF-ß1 were detectable in the
pancreas of some or all of the mice in the four experimental groups
analyzed after 3 days of CDE diet. No factor was, however, expressed in
all mice of all groups; eg, TGF-ß1 was expressed in 5 of 8
MAM-/-MUG1-/- mice, whereas TNF-ß mRNA was seen in only 1 of
these mice (Figure 6A)
. The least
responsive mice were the MUG1-/- mice, in which up-regulation of none
of the 21 markers was evident except in 1 mouse, whereas Lt-ß,
TNF-, IFN-, and TGF-ß1 mRNA was present in most of the
pancreata of MAM-/- and MAM-/-MUG1-/- mice. Had we considered
only these data, we would have concluded that MAM regulates cytokine
expression in acute pancreatitis. Wild-type mice, however, with the
lowest mortality rate, reacted more than the MUG1-/- mice,
demonstrating that the correlation between cytokine expression and the
presence of MAM is not very clear, at least not at the mRNA level.
Therefore, cytokine expression needs to be analyzed in more detail on
the protein level to determine whether MAM binds and regulates cytokine
levels not only in vitro, but also in vivo.
|
.
Immunohistochemically, IL-1Ra protein was visualized only in the cells
of acini with an enlarged lumen and was absent in normal acini (Figure 5F)
. The local production of IL-1Ra within the acini is consistent with
the fact that other cytokines are also expressed in the pancreatic
parenchyma.32,33 Because no data are available in the literature about the binding of MAM to IL-1Ra, Western blotting and ligand blotting were performed. Western blotting did not reveal the binding of endogenous IL-1Ra to MAM or MUG or other high-molecular-weight proteins in plasma or serum (results not shown). To overcome the presumed problem of detection limits, we attempted to demonstrate binding of additionally added recombinant IL-1Ra to MAM by Western blotting. This also proved negative, however, even when nondenaturing rate electrophoresis in 6% gels was used as separation medium before transfer (results not shown). Ligand blotting with recombinant IL-1Ra also did not indicate appreciable binding of IL-1Ra to either purified mouse A2M or human A2M (results not shown).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In acute pancreatitis, many enzymes are released in the blood and
proteinases must be rapidly inhibited, a process A2M was thought to
control.10-12,24
The severity of acute pancreatitis is
determined by the degree of local inflammation in the pancreas, which
is variable, whereas death is caused in most patients by multiorgan
system failure. Both phenomena must be related, and pro-inflammatory
cytokines, ie, IL-1, IL-6, IL-8, and TNF-, were shown to be produced
during acute pancreatitis.25-29
A2M is not only a
wide-spectrum proteinase inhibitor but also a major carrier of
cytokines, and the MAM and MUG1 knockout mice were therefore ideal
experimental models. Earlier experiments with MAM-/- mice had
provided indications that MAM plays a crucial role in pancreatitis, but
the mixed genetic background was recognized as a potential
problem.34
The MAM-/-, MUG1-/-, and MAM-/-MUG1-/-
mice were therefore backcrossed to the C57Bl strain for 6 generations
and all experiments were performed with mice against this homogeneous
genetic background.
In this study, we demonstrated that A2M limits the severity of acute pancreatitis, probably not only as a proteinase inhibitor, but also as a potent carrier of biologically active polypeptides. The evidence for the first part of this conclusion is immediate: deficiency in MAM or MUG increased the mortality resulting from the CDE diet from 27% to, respectively, 67% and 56% after 5 days. The lack of synergy in mice lacking both proteinase inhibitors and the difference in mortality between MAM-/- and MUG1-/- mice argued strongly against a deficit in proteinase inhibition capacity as the only or even the major cause, because their spectra of proteinase inhibition are comparable.42-44
MAM-/- mice started to die as early as the second and third days of the regime, defining a critical window in which mortality was 7 times higher than in wild-type mice. Deficiency of MUG and of MAM and MUG combined, although eventually increasing mortality significantly and to nearly the same level, showed remarkable differences in kinetics. This warranted the conclusion that A2M contributed strongly to, or even determined, the outcome of this critical period at 2 to 3 days of CDE diet. The nonrandom type of experiment corroborated this conclusion. A large group of MAM-/- mice and analysis of only the sick mice at each time point (see Results) demonstrated that high amylase and lipase levels at 48 hours of diet coincided with onset of lethality in random experiments.
The difference in mortality between MAM-/- and MUG-/- mice can be explained by the differential cytokine or polypeptide carrier characteristics of MAM and MUG. As reviewed in the introduction, the diversity and number of polypeptide hormones, growth factors, and cytokines identified as binding to A2M are steadily increasing. We demonstrated differential binding to MAM, but not to MUG, of TGF-ß1 and TGF-ß2.45 Comparative or differential binding characteristics of other factors to MAM and MUG are lacking. Analysis of binding of these cytokines and other biologically active factors to MAM and MUG is a future direction of research to which these mice can contribute considerably. They provide a physiological model to test the importance of the binding of A2M to cytokines in vivo, which until now had been demonstrated only in vitro.
Because the severity of pancreatitis is determined not only by the
initial damage in the pancreas but also by the further local or
multiorgan systemic immune reaction, cytokines were analyzed by RNA
protection assays. The presence of Lt-ß, TNF-, IFN-, and
TGF-ß1 mRNA in the pancreata of most MAM-/- and MAM-/-MUG1-/-
mice and in only one pancreas of MUG1-/- mice suggested a role for
MAM in the regulation of cytokine expression. The data obtained from
the wild-type mice, however, did not support this conclusion. Detailed
analysis of cytokine expression on the protein level will be necessary
to answer the question whether MAM is indeed a cytokine scavenger.
The consistent expression of IL-1Ra mRNA in all MAM-/- mice and its
absence in the other knockout and wild-type mice was surprising and
puzzling. IL-1Ra has been shown to be protective in this experimental
model of pancreatitis.26,46-47
A variety of exogenous
stimuli results in the local production of IL-1 and IL-1Ra, with
appearance of IL-1 before IL-1Ra within a short time interval. In
addition, IL-1 is itself a weak inducer of IL-1Ra production by
monocytes. Thus, it was hypothesized that IL-1Ra occurs as part of a
physiological regulatory response to limit the proinflammatory effect
of IL-1, influenced by the production of other
cytokines.48
Assuming that expression of IL-1Ra is a local
protective reaction in the pancreas of mice severely affected by
pancreatitis, then one implication could be that in MAM-/- mice,
which were demonstrated to be the most affected by the diet, pancreatic
expression of IL-1Ra would be higher compared to less affected mice. If
IL-1Ra plays a protective role, absence of IL-1Ra should increase the
severity of pancreatitis, which can be analyzed in double
MAM/IL-1Ra knockout mice.49
Alternatively, MAM
could transport noxious factors, like TNF-, IL-1, and IL-6, and
protective factors, like IL-1Ra, out of and away from the intoxicated
pancreas. In the absence of MAM these factors may accumulate and
amplify ongoing pancreatic disease. Immune infiltration, local and
distant production of other factors, and, indeed, other effects might
positively or negatively affect progression of the process and explain
the observed variability in patients and models alike. This hypothesis
is based on the fact that A2M binds many cytokines and growth factors
although, to our knowledge, binding of IL-1Ra to A2M has not been
experimentally demonstrated and the attempt described here was
negative. In contrast, binding of TGF-ß, TNF-, IL-1, IL-6, and
IL-8 to A2M was demonstrated.14-17
They are all factors
proven to act on and even determine the progression of acute
pancreatitis, suggesting that the high mortality of the MAM-/- mice
can be explained by the absence of an effective cytokine scavenger.
Histological variability of the pancreas of mice on the CDE diet ranged from normal to massive necrosis of the acini, inflammatory infiltration, and hemorrhage. We did not observe a close correlation between amylase and lipase concentrations and the degree of pancreatic necrosis. Similarly, in the human condition, the value and meaning of amylase and lipase profiles are still debated.21-23 A remarkable morphological feature in severely affected pancreata of MAM-/- and MAM-/-MUG1-/- mice deserves attention. The occurrence of ductular structures is observed, similar in appearance to those in transgenic mice overexpressing TGF-ß50 or a dominant-negative TGF-ß receptor.51 We noted increased levels of TGF-ß in plasma of mice on the CDE diet, but these were not markedly different in MAM-/- mice (results not shown).
In conclusion, we demonstrated that the A2M family of proteinase inhibitors is not essential for life and established the direct contribution of A2M to the pathology and mortality of acute pancreatitis as postulated.34 The definite involvement of A2M in acute pancreatitis is clear, although cytokines and growth factors need to be further analyzed at the protein level. Based on the data presented here and data from literature, we postulate that the high mortality of the MAM-/- mice can be explained by both the proteinase- and cytokine-binding activity of A2M. In this report we concentrated on pancreatitis, but there are many other areas, eg, sepsis, immunology, and lung pathology, in which these single and double knockout mice are now being used and can yield important information. The recent and most interesting finding that the A2M gene is associated with sporadic Alzheimer's disease52 suggests another area in which these mice might become experimentally useful.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Supported by the Fonds voor Wetenschappelijk Onderzoek-Vlaanderen (FWO), by NFWO-Lotto, by the Interuniversity Network for Fundamental Research (IUAP) of the Belgian Government, and by the Special Biotechnology Program of the Flemish Government (IWT/VLAB/COT-008). L. U. and L. O. were post-doctoral research fellows of the Special Research Fund of the K. U. Leuven.
L. Umans and L. Serneels contributed equally to this work.
Accepted for publication May 18, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
2M receptors in fibroblasts. Cell 1980, 20:37-43[Medline]
2-macroglobulin. Immunol Today 1990, 11:163-166[Medline]
, IL-1ß, IL-1/ß, and IL-1 receptor antagonist shows that IL-1ß is crucial in turpentine-induced fever development and glucocorticoid secretion. J Exp Med 1998, 187:1463-1475. Gastroenterology 1992, 103:1883-1892[Medline]
This article has been cited by other articles:
 |
|
 |
|
  A. S. Kowalik, C. L. Johnson, S. A. Chadi, J. Y. Weston, E. N. Fazio, and C. L. Pin Mice lacking the transcription factor Mist1 exhibit an altered stress response and increased sensitivity to caerulein-induced pancreatitis Am J Physiol Gastrointest Liver Physiol, April 1, 2007; 292(4): G1123 - G1132. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-h. Wong, D. D. Mruk, M. K. Y. Siu, and C. Y. Cheng Blood-Testis Barrier Dynamics Are Regulated by {alpha}2-Macroglobulin via the c-Jun N-Terminal Protein Kinase Pathway Endocrinology, April 1, 2005; 146(4): 1893 - 1908. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. He, D. J. McCartney, Q. Wei, S. Esadeg, J. Zhang, R. A. Foster, M. A. Hayes, C. Tayade, F. Van Leuven, and B. A. Croy Characterization of a Murine Alpha 2 Macroglobulin Gene Expressed in Reproductive and Cardiovascular Tissue Biol Reprod, February 1, 2005; 72(2): 266 - 275. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. C. Waghabi, C. M. L. M. Coutinho, M. N. C. Soeiro, M. C. S. Pereira, J.-J. Feige, M. Keramidas, A. Cosson, P. Minoprio, F. Van Leuven, and T. C. Araujo-Jorge Increased Trypanosoma cruzi Invasion and Heart Fibrosis Associated with High Transforming Growth Factor {beta} Levels in Mice Deficient in {alpha}2-Macroglobulin Infect. Immun., September 1, 2002; 70(9): 5115 - 5123. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. V. Gourine, V. N. Gourine, Y. Tesfaigzi, N. Caluwaerts, F. Van Leuven, and M. J. Kluger Role of alpha 2-macroglobulin in fever and cytokine responses induced by lipopolysaccharide in mice Am J Physiol Regulatory Integrative Comp Physiol, July 1, 2002; 283(1): R218 - R226. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Kato, T. Kishi, T. Kamachi, M. Akisada, T. Oka, R. Midorikawa, K. Takio, N. Dohmae, P. I. Bird, J. Sun, et al. Serine Proteinase Inhibitor 3 and Murinoglobulin I Are Potent Inhibitors of Neuropsin in Adult Mouse Brain J. Biol. Chem., April 27, 2001; 276(18): 14562 - 14571. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
