| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |




From the Cancer Biology Program,*
Hematology-Oncology
Division, the Department of Medicine and the Department of
Pathology,
Beth Israel Deaconess Medical
Center, Boston, Massachusetts; and the Department of Clinical
Pathology,
University of Vienna,
Vienna, Austria
| Abstract |
|---|
|
|
|---|
platelet-derived growth factor receptor and Jak 1,
respectively, was confirmed by immunohistochemistry. In
contrast, the type 1 insulin-like growth factor
receptor, thought to play a role in PCa development,
was lost in metastatic PCa. These results implicate several specific
growth factors and signaling pathways in metastatic
androgen-independent PCa and indicate that loss of the type 1
insulin-like growth factor receptor contributes to PCa
progression.
| Introduction |
|---|
|
|
|---|
Studies from many groups have
demonstrated critical roles for a series of peptide growth factors and
corresponding epithelium-expressed receptor tyrosine kinases (RTKs) in
normal prostate and/or in PCa. These growth factors include
transforming growth factor
,9
insulin-like growth
factor 1 (IGF-1),10
keratinocyte growth
factor,11,12
basic fibroblast growth
factor,13
hepatocyte growth factor (HGF),7,8
platelet-derived growth factor,14, 15
and nerve growth
factors.16
A role for HGF in advanced metastatic PCa has
been suggested by immunohistochemistry showing the consistent
expression of the HGF receptor (c-met) in bone marrow
metastases.7,8
However, the role of these or other novel
growth factors and their corresponding receptors in metastatic
androgen-independent PCa remains uncertain.
The strategy taken in this study to identify growth factor-receptor interactions that support PCa growth in bone marrow was to identify RTKs expressed by these tumors freshly isolated from human bone marrow. RTKs contain a conserved tyrosine kinase domain that can be amplified from small numbers of tumor cells by reverse transcriptase-polymerase chain reaction (RT-PCR) with degenerate oligonucleotide primers.17 In this study, RTKs and nonreceptor tyrosine kinases (NRTKs) expressed by a series of freshly isolated human PCa bone marrow metastases and by the LNCaP PCa cell line were amplified and cloned by this method. A large number were then sequenced to determine the spectrum of expressed RTKs and NRTKs in human PCa metastatic to bone marrow. The presence or absence of particular tyrosine kinases was then confirmed by immunohistochemistry.
| Materials and Methods |
|---|
|
|
|---|
A series of patients with advanced androgen-independent PCa underwent bone marrow biopsies from the posterior iliac crest, as described previously.18,19 A portion of each biopsy was frozen in OCT and frozen sections were analyzed histologically. Biopsies in which normal marrow elements were largely or completely replaced by PCa, with minimal fibrosis, were sought and 7 such biopsies from a total of 6 patients were identified. Adjacent 6-µm frozen sections (n-4 or 5) were then used for RNA extraction. LNCaP, a human androgen receptor expressing PCa cell line,20 was maintained in Dulbecco's modified Edgle's medium with 10% fetal calf serum.
Tyrosine Kinase Domain Amplification
RNA was extracted with RNAzol B (Tel-Test, Friendswood, TX) and cDNA was synthesized using an oligo-dT primer, as described previously.18 The oligo-dT was then removed by spin dialysis with a Microcon-100 filter (Amicon, Beverly, MA). cDNA was amplified in 50-µl reactions containing 500 ng of each degenerate primer (see below), Taq polymerase, bovine serum albumin at 0.1 mg/ml, and standard buffer containing 1.5 mmol/L MgCl2 as supplied by the manufacturer (Promega, Madison, WI). The cycles were 94° for 20 seconds, 48° for 45 seconds and 72° for 30 seconds for 35 cycles. Secondary PCR amplifications were performed using the same conditions.
Protein kinases have a conserved catalytic domain that can be divided
into 11 subdomains.17,21
This study used a series of
degenerate sense primers in subdomain VI and anti-sense primers in
subdomains VIII and IX (Table 1)
. Primer
sequences were chosen to preferentially amplify tyrosine kinases rather
than serine/threonine kinases. The TK1 primer in domain VI was further
chosen to bias against src family intracellular tyrosine kinases and in
favor of RTKs and non-src family intracellular tyrosine kinases.
However, the other domain VI primers would be predicted to amplify both
src and other tyrosine kinases equally.
|
A second series of amplifications used a different pair of subdomain VI and IX primers. The primary amplifications were carried out with primers TK2 and TK8 in subdomains VI and IX, respectively. Secondary amplifications for 12 to 15 cycles were then carried out using 25% of the primary reactions and replacing primer TK2 with the nearly identical primer TK3. This latter step served to incorporate a nondegenerate BamH1 site at the 5' end. The PCR products were then digested with BamH1 and EcoR1 and ligated into pBluescript.
Tyrosine Kinase Analysis
In the initial analyses, bacterial colonies containing tyrosine
kinases were identified by PCR amplification with flanking primers in
the vector and subsequent agarose gel electrophoresis to identify
clones containing the correctly sized insert. In later screens, these
PCR-amplified inserts were also dot blotted with oligonucleotide probes
specific for tyrosine kinases frequently isolated in the initial
screens. The sequences of these probes were as follows: Jak 1,
ACCAAAGCAATTGAAACCGAT; FER, ATCTTCTGGCTTAAAGCA;
platelet-derived
growth factor receptor (
PDGF-R), GATTCGAACTATGTGTCG; Lyn,
GTCTCCGAGTCACTAATGTGC. Clones that hybridized strongly (consistent with
identity) were counted toward the total for each receptor. A fraction
of these strongly hybridizing clones was chosen at random and
sequenced, which in all cases confirmed their identity. The total
number of confirmed tyrosine kinase isolates (based upon hybridization
and/or sequencing) from metastatic PCa analyzed in this series of
experiments was 448.
To analyze a larger sampling of these libraries for particular tyrosine kinases, PCR products generated from the libraries by the domain VI and IX primers (primers TK2 and TK8, respectively) were dot blotted and hybridized with specific oligonucleotide probes. In addition to the probes above, probes for the type 1 insulin-like growth factor receptor (type 1 IGF-R) (GTAGCCGAAGATTTCACAGTC), FGF receptor 2 (FGF-R2) (GATATCAACAATATAGACTAT), and a probe for both the FGF-R1 and FGF-R3 (GACATTCACCACATCGACTAC) were used.
Immunohistochemistry
B5-fixed, decalcified bone marrow biopsies and formalin-fixed
prostate and transurethral resection specimens were embedded in
paraffin and sectioned for
PDGF-R, Jak 1, and prostate-specific
antigen (PSA) immunohistochemistry. Sections were pretreated by
microwaving in citrate buffer (10 mmol/L, pH 6.0) twice for 5 minutes
each at 600W. The sections were incubated with polyclonal rabbit
antibodies to PSA (Dako, Copenhagen, Denmark; dilution 1:2000),
PDGF-R (antibody C-20 generated against amino acids 10651084,
Santa Cruz Biotechnology, Santa Cruz, CA; dilution 1:40), or Jak 1
(antibody Q-19, against amino acids 11221141, Santa Cruz
Biotechnology; dilution 1:60). The primary antibody incubations for 1
hour were followed by incubation with a biotinylated goat anti-rabbit
Ig secondary and then alkaline phosphatase-conjugated streptavidin
(Biogenex, San Ramon, CA). The reaction product was visualized by new
fuchsin (Dako) as a chromogen. Staining intensities were graded
semiquantitatively as 0, no staining; +, weak staining; ++, moderate
staining; and +++, strong staining. Staining for PSA was strong in all
tumor samples and was not graded.
Nonspecific reactivity was assessed by omission of the primary
antibody. The specificity of staining for the
PDRG-R and Jak 1 was
also confirmed in bone marrow sections as well as in control tissues by
preabsorption of the antisera with blocking peptides supplied by
the manufacturer. Equimolar concentrations of antibody and blocking
peptide were incubated for 1 hour at room temperature.
Expression of the type 1 IGF-R was examined in frozen and paraffin sections. Prostate and bone marrow biopsies frozen in OCT were sectioned at 6 µm and postfixed in methanol. The primary was a mouse anti-human type 1 IGF-R mAb (mAb 391, R&D Systems, Minneapolis, MN), used at 0.5 µg/ml. The secondary was a biotinylated goat anti-mouse Ig followed by streptavidin-HRP, as above. The samples were counterstained with hematoxylin. Alternatively, prostate core biopsies were taken from fresh prostatectomy specimens with a 14 gauge biopsy needle and processed identically to bone marrow biopsies. Fixation was in 95% ethanol:37% formaldehyde at 4:1, followed by overnight decalcification in EDTA. After deparaffinization, sections were microwaved in 1 mmol/L EDTA, pH 8.0, twice for 6 minutes each at 600W, followed by cooling for 20 minutes. Blocking of endogenous biotin was done using an avidin-biotin blocking kit (Vector Labs, Burlingame, CA) for 15 minutes. The primary mouse anti-human type 1 IGF-R mAb (Lab Vision Corp., Fremont, CA) was added for 45 minutes. Biotinylated horse anti-mouse IgG (1:200) in a solution containing glucose (50 mg/ml) and glucose oxidase (7 U, Sigma, St. Louis, MO) was used as a secondary for 30 minutes followed by Vectastain Elite reagent (Vector). Visualization was done with Vector peroxidase kit (peroxidase substrate kit, Vector VIP, SK-4600) for 10 minutes and counterstaining by acid hemalaun.
| Results |
|---|
|
|
|---|
To determine whether the degenerate PCR primers would be useful for amplification of diverse tyrosine kinases from prostate cancer, the LNCaP cell line was examined initially. LNCaP was derived from a human PCa metastatic to lymph node.20 Its growth is stimulated by androgen and it produces PSA. Although it expresses a mutant androgen receptor, the mutation is identical to one found in some patients with androgen-independent prostate cancer.19,22 LNCaP does not form bone marrow metastases when transplanted into immunodeficient mice,23 but has nonetheless been the most commonly used human model for PCa.
Tyrosine kinase expression by LNCaP cells was examined by RT-PCR using
the primers in subdomains VI and IX (primers TK1 and TK7,
respectively). This was followed by a secondary amplification with
subdomain VI and VIII primers (TK1 and a pool of TK4, -5, and -6). A
total of 38 clones containing inserts of the correct size to be kinase
domains were identified. Sequencing revealed that there were 7
different kinases represented (Table 2)
.
Among the kinases isolated, the type 1 IGF-R and Bmx have been
reported previously in these cells.24-27
Although it is
clearly the case that LNCaP expresses additional tyrosine kinases,
these initial results indicated that diverse tyrosine kinases could be
amplified under these conditions.
|
A series of 7 androgen-independent PCa bone marrow metastases from 6 patients were next examined by RT-PCR for tyrosine kinase expression. These particular samples were selected based upon their high proportion of tumor cells and absence of normal bone marrow elements. The cDNA libraries were amplified in an initial series of experiments with the primers described above for LNCaP. To maximize the number of different kinases, a second series of amplifications was carried out with a distinct set of primers in subdomains VI and IX (see Material and Methods).
The results from both sets of primers were combined, yielding a total
of 448 clones containing kinase domains from the 7 biopsies. The vast
majority could be identified as previously described receptor or
nonreceptor tyrosine kinases (Table 3)
.
Although the kinases are listed in Table 3
based upon the frequency
with which they were isolated, this does not necessarily reflect
abundance of the respective transcripts and more likely reflects the
efficiency with which they were amplified by the degenerate primers.
Two novel kinases were also identified, each in single biopsies.
Although these are indicated as RTKs in Table 3
, it has not yet been
determined whether they are receptor or nonreceptor kinases.
|
PDGF-R and Jak 1 Expression in
Bone Marrow Metastases
The PCa biopsies examined contained predominantly tumor cells, but
nontumor cells were also certainly present and could have been the
source for one or more of the kinases identified in Table 3
. Therefore,
immunohistochemistry was used to further assess tumor expression of
particular kinases. The
PDGF-R and Jak 1 proteins were examined, as
these receptor and nonreceptor tyrosine kinases, respectively, were
identified in the majority of the PCa samples.
An analysis of these proteins in normal bone marrow was carried out
initially to determine whether there were normal cells in the biopsies
that might be the origin of these transcripts. In normal bone marrow,
moderate to strong staining for
PDGF-R was found consistently in
megakaryocytes and osteoblasts and occasionally in plasma cells,
endothelial cells, and fibroblasts (Figure 1A)
. However, the vast majority of
myeloid and bone marrow stromal elements did not stain. Strong staining
for Jak 1 in these sections of normal bone marrow was detected only in
macrophages (Figure 1B)
. Weak Jak 1 staining was seen on scattered
mononuclear cells, which appeared to be myeloid precursors, whereas all
other cells were negative.
|
PDGF-R (Figure 1D)
PDGF-R
staining was seen in the stromal elements surrounding the tumor cells
(Figure 1D)
|
PDGF-R, with uniform staining in most
carcinoma cell complexes. No staining was observed in the stroma.
Staining for
PDGF-R and Jak 1 was completely abolished by
preincubation with the appropriate peptides (Figure 1F
PDGF-R and Jak 1 were
expressed by PCa bone marrow metastases.
Immunohistochemical Analysis of
PDGF-R and Jak 1
Expression in Primary PCa and Nonneoplastic Prostate
Archival primary PCa samples from needle biopsies or radical
prostatectomies were available from four of the patients examined here.
Tumor cell staining for
PDGF-R was observed in each of these four
samples (Figure 2A
and Table 4
). In
three, uniform tumor staining similar to that seen in the corresponding
metastatic tumors was observed. In the fourth case (patient 2),
moderate to strong staining was observed in the more differentiated
areas, whereas many poorly differentiated areas were negative.
Jak 1 protein expression was examined in three additional primary
prostate cancers. In each case there was uniform moderate to strong
staining for Jak 1 (Figure 2B)
.
|
PDGF-R and Jak 1 in transurethral resection specimens
from five patients showing variable degrees of hyperplasia were also
examined. Staining intensity relative to the tumor samples was
assessed. Luminal epithelial cells showed absent or very weak staining
for
PDGF-R in the vast majority of glands (Figure 2C)
Weak immunoreactivity of prostate luminal epithelial was found for Jak
1. In some cases basal cells stained more strongly than the overlying
luminal epithelial cells (Figure 2D)
. Occasional smooth muscle cell
bundles showed moderate staining but most stained weakly or were
negative. Strong Jak 1 staining was observed only in macrophages.
Comparative Analysis of Tyrosine Kinases Expressed in Normal Prostate versus Metastatic Androgen-Independent PCa
It was noteworthy that several RTKs believed to be important in
normal and neoplastic prostate growth, including the type 1 IGF-R and
the receptors for KGF (also termed FGF7) and bFGF, were not identified
in this analysis of metastatic androgen-independent PCa. With respect
to the type 1 IGF-R, this did not appear to be an unintended primer
bias, as this receptor was readily amplified from the LNCaP cell line
(Table 1)
. To determine whether this might simply reflect inadequate
sampling, expression of transcripts for the type 1 IGF-R and FGF-R1,
-R2, and -R3 was specifically examined by RT-PCR and dot blot
hybridization.
The tyrosine kinase libraries from the seven metastatic prostate
cancers and from three sections of nonneoplastic prostate generated
identically were amplified by PCR. Equivalent amounts of PCR product,
based upon ethidium bromide staining, were then dot blotted and
hybridized with a series of kinase-specific probes. There were no
marked difference in Jak 1 transcript levels between the metastatic
tumors and the normal prostate samples (Figure 3)
. Expression of FER, which has not been
examined previously in prostate, was also similar in all samples.
Consistent with previous reports, this analysis detected FGF receptors
and the type 1 IGF-R in normal prostate.10-13
In contrast,
in six of the seven metastatic PCa samples there was weak or absent
hybridization with the pool of FGF-R1, -R2, and -R3 probes. It should
be noted that both the PCR primers and probes used for this FGF-R
analysis were in the kinase domain and would recognize the
alternatively spliced form of the FGF-R2 found in the Dunning rat PCa
model and recently in human PCa.28,29
Finally, the type 1
IGF-R was detected in only one of the metastatic PCa samples.
Therefore, these results were consistent with the failure to identify
FGF-Rs or the type 1 IGF-R among the 448 tyrosine kinases analyzed.
|
Immunohistochemistry was used to confirm loss of type 1 IGF-R
expression in metastatic androgen-independent PCa. The first
experiments used frozen sections, because none of the initially tested
type 1 IGF-R antibodies worked in formalin-fixed and paraffin-embedded
tissues. Frozen sections from nonneoplastic prostate showed expression
confined to the epithelium, with moderate staining of most glands
(Figure 4A
, at higher power in Figure 4B
). Primary PCa also expressed the type 1 IGF-R at levels that were
comparable to normal epithelium, based upon staining intensity on
identically processed sections (Figure 4C
, at higher power in Figure 4D
). However, there was heterogeneity with most tumors containing a
minority of cells that were negative for type 1 IGF-R staining. In
contrast, no type 1 IGF-R expression was detectable in frozen sections
from a series (n = 7) of androgen-independent
bone marrow metastases (Figure 4, E and F)
.
|
|
| Discussion |
|---|
|
|
|---|
Expression of
PDGF-R protein by metastatic PCa was confirmed by
immunohistochemistry in a series of bone marrow metastases. Further
immunohistochemical analyses showed moderate to strong
PDGF-R
expression in primary prostate cancers, but weak or absent expression
in nonneoplastic prostate epithelium and stroma. Previous studies
similarly showed
PDGF-R expression in primary PCa and in prostatic
intraepithelial neoplasia (PIN), a potential precursor lesion to PCa,
but not in normal prostate or benign prostatic
hypertrophy.14,15
Interestingly, the former study of
primary PCa suggested a correlation between
PDGF-R expression and
more differentiated tumors. Although a similar observation was made in
one of the primary tumors examined here (Table 4
, patient 2), the
consistent finding of
PDGF-R in metastatic tumors demonstrated that
PDGF-R expression was not a marker of more benign disease.
A series of NRTKs were also identified and Jak 1 protein expression was assessed further as it was isolated from each of the biopsies. Immunohistochemical studies indicated that Jak 1 protein was weakly expressed in normal prostate luminal epithelial cells and suggested increased expression in primary and metastatic tumor cells. Jak 1 functions to transmit activation signals from multiple cytokine receptors.30,31 These observations indicate that Jak 1-linked cell surface receptors, possibly the IL-6 receptor or other receptors yet to be identified, function in normal prostate epithelial cells and may contribute to neoplastic growth.
An analysis of tyrosine kinase expression by the LNCaP cell line was also carried out, although it was less extensive then that of the patient tumor samples and certainly identified only a fraction of the kinases expressed by LNCaP. Nonetheless, a number of kinases were found in both the patient samples and in LNCaP. These included eph1, FER, and Bmx. Eph1 and Bmx were also identified previously in a tyrosine kinase screen of the CWR22 prostate cancer cell line,32 suggesting a consistent role for these kinases in PCa. Bmx was recently reported to be an effector of IL-6 and phosphatidylinositol 3 kinase (PI3-kinase) in LNCaP cells.27 Preliminary immunohistochemical studies have confirmed eph1 expression by prostate epithelial cells (T. Li and S. Balk, unpublished findings), but further studies are clearly necessary to confirm the cellular origin of other kinases identified in this screen. This is particularly the case for KDR, Tie-1, and Tie-2, which are generally expressed on endothelial cells.
One significant difference between LNCaP and the metastatic PCa biopsies was cloning of the type 1 IGF-R from LNCaP, and the failure to amplify this transcript from the PCa bone marrow biopsies. Loss of the type 1 IGF-R in metastatic androgen-independent PCa was further confirmed by immunohistochemistry. This loss was surprising as signal transduction by the type 1 IGF-R, through PI3-kinase and Akt, provides critical survival signals for many cells,33 and recent studies have linked increased IGF-1 levels to PCa.34-36 The importance of this pathway in prostate cancer is further supported by the frequent loss in PCa of PTEN, a downstream negative regulator of PI3-kinase.37-42 Antisense RNA to the type 1 IGF-R has also been shown to directly suppress the growth and metastatic potential of prostate cancer cells.43-44
Nonetheless, a previous in situ hybridization and immunohistochemical study that quantitated type 1 IGF-R expression found a moderate decrease in primary PCa relative to normal epithelium.45 Decreased type 1 IGF-R expression was also reported in more tumorigenic SV40 T antigen-transformed human prostate epithelial cells,46 and restoring expression in these cells to normal levels by retroviral infection led to decreased tumorigenicity and enhanced apoptosis.47,48 In the mouse SV40 T antigen-induced PCa model, decreased type 1 IGF-R expression was recently reported in metastatic and androgen-independent tumors.49 Although it is not yet clear to what extent these latter observations in SV40 T antigen-transformed tumors reflect SV40 T antigen versus PCa biology, they support the conclusion that loss of type 1 IGF-R receptor contributes to human metastatic androgen-independent PCa.
The molecular basis for selective pressure against type 1 IGF-R expression in metastatic androgen-independent PCa has not been determined. It is also unclear to what extent type 1 IGF-R loss is associated with androgen independence versus metastatic growth. We propose that loss of type 1 IGF-R may be linked to PTEN loss during PCa progression. This hypothesis implies that overstimulation of the type 1 IGF-R signal transduction pathway in cells that have lost PTEN, a negative regulator of this pathway, may be deleterious. It should be noted that this requirement for type 1 IGF-R loss cannot be absolute, as the LNCaP cell line has lost PTEN and still expresses the type 1 IGF-R. In any case, these results indicate that IGF-1, although possibly playing a role in prostate cancer development, does not contribute to the growth of advanced metastatic androgen-independent PCa. The results similarly suggest that fibroblast growth factors, which may contribute to PCa development, do not stimulate the growth of advanced metastatic androgen-independent PCa.
The identification of tyrosine kinases that regulate PCa growth in bone marrow is significant as bone marrow metastases account for the vast majority of PCa morbidity and mortality. Moreover, specific tyrosine kinase antagonists are being developed that could be useful therapeutically. This study identified a series of tyrosine kinases that may regulate the growth of advanced androgen-independent PCa. Unfortunately, model systems that directly test the importance of these kinases in PCa metastatic to bone marrow are not readily available, and the development of such systems clearly represents a major future challenge. Nonetheless, based upon the evidence presented here, we have initiated clinical trials of a PDGF-R antagonist in metastatic androgen-independent PCa that may help to address the role of this particular receptor. Finally, if signaling through particular RTKs can inhibit tumor growth or stimulate apoptosis, then activation of these pathways may represent another novel therapeutic approach in PCa.
| Footnotes |
|---|
Supported by National Institutes of Health grants CA-65647 to S. P. B. and CA-70297 to Z. S., by an American Cancer Society grant to G. J. B. (EDT-112), and by the Hershey Family Prostate Cancer Research Fund. D. M. was supported by an NIH Hematology Career Training Program grant (HL07516).
Equally important contributions to this work were made by the first two authors.
Current address of Z. Sun: Department of Surgery and Genetics, Stanford University School of Medicine, Stanford, CA.
Accepted for publication July 25, 1999.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. D. McCabe, D. D. Spyropoulos, D. Martin, and C. S. Moreno Genome-Wide Analysis of the Homeobox C6 Transcriptional Network in Prostate Cancer Cancer Res., March 15, 2008; 68(6): 1988 - 1996. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Wang, R. M. Luque, R. D. Kineman, V. H. Ray, K. T. Christov, D. D. Lantvit, T. Shirai, S. Hedayat, T. G. Unterman, M. C. Bosland, et al. Disruption of Growth Hormone Signaling Retards Prostate Carcinogenesis in the Probasin/TAg Rat Endocrinology, March 1, 2008; 149(3): 1366 - 1376. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Jiang, R. A. Borgesi, N. C. McKnight, R. Kaur, C. L. Carpenter, and S. P. Balk Activation of Nonreceptor Tyrosine Kinase Bmx/Etk Mediated by Phosphoinositide 3-Kinase, Epidermal Growth Factor Receptor, and ErbB3 in Prostate Cancer Cells J. Biol. Chem., November 9, 2007; 282(45): 32689 - 32698. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Mathew, P. F. Thall, C. D. Bucana, W. K. Oh, M. J. Morris, D. M. Jones, M. M. Johnson, S. Wen, L. C. Pagliaro, N. M. Tannir, et al. Platelet-Derived Growth Factor Receptor Inhibition and Chemotherapy for Castration-Resistant Prostate Cancer with Bone Metastases Clin. Cancer Res., October 1, 2007; 13(19): 5816 - 5824. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. de Bono, G. Attard, A. Adjei, M. N. Pollak, P. C. Fong, P. Haluska, L. Roberts, C. Melvin, M. Repollet, D. Chianese, et al. Potential Applications for Circulating Tumor Cells Expressing the Insulin-Like Growth Factor-I Receptor Clin. Cancer Res., June 15, 2007; 13(12): 3611 - 3616. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. G. Dolloff, M. R. Russell, N. Loizos, and A. Fatatis Human Bone Marrow Activates the Akt Pathway in Metastatic Prostate Cells through Transactivation of the {alpha}-Platelet-Derived Growth Factor Receptor Cancer Res., January 15, 2007; 67(2): 555 - 562. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-H. Kim, C. Xu, Y.-S. Keum, B. Reddy, A. Conney, and A.-N. T. Kong Inhibition of EGFR signaling in human prostate cancer PC-3 cells by combination treatment with {beta}-phenylethyl isothiocyanate and curcumin Carcinogenesis, March 1, 2006; 27(3): 475 - 482. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. L. Goel, M. Breen, J. Zhang, I. Das, S. Aznavoorian-Cheshire, N. M. Greenberg, A. Elgavish, and L. R. Languino {beta}1A Integrin Expression Is Required for Type 1 Insulin-Like Growth Factor Receptor Mitogenic and Transforming Activities and Localization to Focal Contacts Cancer Res., August 1, 2005; 65(15): 6692 - 6700. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Wu, A. Odman, L. M. Higgins, K. Haugk, R. Vessella, D. L. Ludwig, and S. R. Plymate In vivo Effects of the Human Type I Insulin-Like Growth Factor Receptor Antibody A12 on Androgen-Dependent and Androgen-Independent Xenograft Human Prostate Tumors Clin. Cancer Res., April 15, 2005; 11(8): 3065 - 3074. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Hofer and M. A. Rubin Platelet-Derived Growth Factor Receptor Inhibitor Imatinib Mesylate and Docetaxel: A Modular Phase I Trial in Androgen-Independent Prostate Cancer J. Clin. Oncol., February 20, 2005; 23(6): 1332 - 1333. [Full Text] [PDF] |
||||
![]() |
P. Mathew, I.J. Fidler, and C. Bucana In Reply: J. Clin. Oncol., February 20, 2005; 23(6): 1333 - 1334. [Full Text] [PDF] |
||||
![]() |
S. Matsuzaki, M. Canis, C. Vaurs-Barriere, J.L. Pouly, O. Boespflug-Tanguy, F. Penault-Llorca, P. Dechelotte, B. Dastugue, K. Okamura, and G. Mage DNA microarray analysis of gene expression profiles in deep endometriosis using laser capture microdissection Mol. Hum. Reprod., October 1, 2004; 10(10): 719 - 728. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Mathew, P. F. Thall, D. Jones, C. Perez, C. Bucana, P. Troncoso, S.-J. Kim, I. J. Fidler, and C. Logothetis Platelet-Derived Growth Factor Receptor Inhibitor Imatinib Mesylate and Docetaxel: A Modular Phase I Trial in Androgen-Independent Prostate Cancer J. Clin. Oncol., August 15, 2004; 22(16): 3323 - 3329. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Rubinstein, G. Idelman, S. R. Plymate, G. Narla, S. L. Friedman, and H. Werner Transcriptional Activation of the Insulin-Like Growth Factor I Receptor Gene by the Kruppel-Like Factor 6 (KLF6) Tumor Suppressor Protein: Potential Interactions between KLF6 and p53 Endocrinology, August 1, 2004; 145(8): 3769 - 3777. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. L. Paris, A. Andaya, J. Fridlyand, A. N. Jain, V. Weinberg, D. Kowbel, J. H. Brebner, J. Simko, J.E. V. Watson, S. Volik, et al. Whole genome scanning identifies genotypes associated with recurrence and metastasis in prostate tumors Hum. Mol. Genet., July 1, 2004; 13(13): 1303 - 1313. [Abstract] [Full Text] [PDF] |
||||
![]() |
H.-S. Lin, G. J. Berry, W. E. Fee Jr, D. J. Terris, and Z. Sun Identification of Tyrosine Kinases Overexpressed in Head and Neck Cancer Arch Otolaryngol Head Neck Surg, March 1, 2004; 130(3): 311 - 316. [Abstract] [Full Text] [PDF] |
||||
![]() |