| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Animal Model |
From the Department of Pathology,*
Beth Israel Deaconess
Medical Center and Harvard Medical School, Boston, Massachusetts; and
the Department of Pediatric Oncology,
Dana
Farber Cancer Institute, Boston, Massachusetts
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, tumor necrosis factor-, and
interferon-
which could explain the patient's B-symptoms. Treatment
of mice with monoclonal antibody (HeFi-1) which activates CD30 antigen
administered on day 1 after tumor transplantation prevented tumor
growth. Treatment with HeFi-1 after tumors had reached a 0.2
cm3 volume caused tumor growth arrest and prevention of
tumor dissemination. We conclude that transplantation of CD30+ ALCL to
SCID/bg mice may provide a valuable model for the study of the biology
and design of treatment modalities for CD30+ ALCL.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
To address this issue, we developed a xenograft model of treatment resistant ALCL. SCID/bg mice were chosen for this purpose because they have impairment of natural killer cell activity in addition to the lack of B and T cell function. The model was found to closely resemble the primary tumor in histopathology and in clinical behavior with widespread organ involvement. The transcription of NPM-ALK and of various cytokines which could explain the patient's symptoms was demonstrated. Finally, the model was used to test the efficacy of immunotherapy directed against the CD30 antigen expressed by the tumor cells.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The patient is a 22-month-old Caucasian female who presented with 2-month history of fever, cervical adenopathy, and weight loss. The diagnosis was at first difficult to establish because of the admixture of small and large atypical cells. Over the next 2 months the patient developed progressive lymphadenopathy. CAT scans revealed supraclavicular nodes extending into the mediastinum and enlarged paratracheal, axillary, subcarinal, and periaortic lymph nodes. A pleural effusion contained small, CD30+, cytologically malignant cells, with frequent mitoses. Cytogenetics revealed a t(2;5)(p23;q35) translocation. Bone marrow aspirate showed 7% malignant cells. Cerebrospinal fluid was negative for tumor cells. The patient was treated with adriamycin, prednisone, and vincristine. She tolerated the first course of chemotherapy well, and a CAT scan on day 30 showed persistent matted nodes in the supraclavicular region and a persistent mass in the anterior mediastinum. Biopsy of the mediastinum was interpreted as scar tissue. Five days later the patient developed fever and gum swelling. Biopsy of the gum showed recurrent lymphoma. She developed rapidly increasing cervical adenopathy. High-dose etoposide and cyclophosphamide were administered but complicated by Salmonella enteritis. CAT scan showed partial response, and a second round of chemotherapy was administered. Subsequent CAT scan showed tumor reduction, but before the next cycle of chemotherapy she developed fever and rapidly progressive bilateral cervical adenopathy. Two cycles of steroids, high-dose Ara-C, and cisplatin (DHAP) achieved a good clinical response. The patient is currently completing bone marrow transplantation from a matched unrelated donor.
Tumor Cell Preparation
A peripheral blood sample containing circulating tumor cells was obtained with informed consent from the patient at the time of the diagnosis. Peripheral blood mononuclear cells were isolated by gradient centrifugation using Ficoll Paque Plus (Pharmacia Biotech, Uppsala, Sweden), washed twice in PBS and resuspended in RPMI 1640 (BioWhittaker, Walkersville, MD).
Animals
Four to six-week-old SCID/bg mice were obtained from Taconic Farms (Germantown, NY) and housed in autoclaved microisolator cages in an air-filtered laminar flow cabinet within the Animal Research Facility of the Beth Israel Deaconess Medical Center. Food was irradiated, and water and bedding were autoclaved before use. All procedures were performed under aseptic conditions.
Tumor Implantation and Growth
A tumor cell suspension prepared from peripheral blood cells (2 x 107 cells) was injected intraperitoneally (i.p.) to produce a tumor in mouse 1. Subsequent passages of tumor from mouse 1 were performed by serial transplantation of small pieces of tumor subcutaneously into the left flank of SCID/bg mice using a 13-gauge trocar. Initial transplantation groups were composed of 3 or 4 mice. Subsequent experimental therapeutic groups were composed of 16 treated mice and 11 control mice.
Histology and Immunohistology
For histological examination, tumor tissue and organs were fixed in 10% buffered formalin and embedded in paraffin; 4-µm sections were stained with hematoxylin and eosin. Immunohistochemistry for CD30, CD15, EMA, ALK1, CD3, CD4, CD8, CD20, CD57, and EBV-LMP was performed using a three-step immunoperoxidase technique using biotinylated secondary antibodies, streptavidin conjugated with horseradish peroxidase and diaminobenzidine (chromogen).
Flow Cytometry
Single cell suspensions obtained from transplanted tumor cells were analyzed for expression of cell surface antigens using a FACSCalibur flow cytometer (Becton Dickinson, Mountain View, CA). Cells were labeled directly with murine monoclonal antibodies against CD30, CD15, CD3, CD8, CD19, and CD5, conjugated with fluorescein isothiocyanate or phycoerythrin (Caltag, Burlingame, CA).
RNA Extraction and cDNA Synthesis
Total RNA from cells in suspension was isolated using the TRIzol extraction kit (Gibco BRL, Life Technologies, Gaithersburg, MD). For RNA extraction from tissues, the extraction was preceded by a homogenization step. cDNA was generated using Superscript II (Gibco BRL, Life Technologies) and 10 pmol of dT18-primer in 29 µl, according to the manufacturer's instructions. Successful cDNA synthesis was confirmed by amplification of an 839-bp fragment of ß-actin (Clontech, Palo Alto, CA).
Polymerase Chain Reaction for Expression of Cytokine mRNA
Detection of mRNA for human cytokines, cytokine receptors, and
transcription factors was performed using commercially prepared primers
and controls for interleukin (IL)-1, IL-2, IL-2 receptor, IL-4,
IL-5, IL-6, IL-6 receptor, IL-7, IL-8, IL-10, transforming growth
factor (TGF)-ß, interferon (IFN)-, tumor necrosis factor
(TNF)-, c-myc, G-CSF, and G-CSF receptor (Clontech)
according to the manufacturer's instructions. For IL-9 mRNA detection,
previously described primers and polymerase chain reaction (PCR)
conditions were used.8
10 µl of PCR products were
electrophoresed through 2% agarose gels in Tris-borate EDTA buffer, pH
7.4. Gels were stained with ethidium bromide and visualized with
ultraviolet light using a Gel Doc 1000 Analyzer (Bio-Rad, Hercules,
CA).
Molecular Analysis for NPM-ALK Transcripts
cDNAs were amplified by PCR using the primers NPM S1 and ALK A1 as previously described.3 The specific primer sequences were NPM-S1: TCCCTTGGGGGCTTTGAAATAACACC; ALK-A1: CGAGGTGCGGAGCTTGCTCAGC. PCR was preceded by a 5-minute incubation at 94°C. Cycle conditions were as follows: Denaturation at 94°C for 45 seconds, annealing at 60°C for 45 seconds, and elongation at 72°C for 2 minutes for 35 cycles and final extension at 72°C for 5 minutes. The resulting PCR products were fractionated through a standard 2% agarose gel and visualized with ethidium bromide staining by exposure to ultraviolet light using a Gel Doc 1000 Analyzer (Bio-Rad, Hercules, CA).
In Vivo Experiments
Mice were transplanted with same passage tumor cells per
individual experiment to study the anti-tumor effects of the anti-CD30
antibody HeFi-1 (National Cancer Institute, Frederick Cancer Research
and Development Center, Biological Resources Branch, Frederick,
MD).9
Mice were injected i.p. with 10 µg of anti-CD30
antibody (HeFi-1) or mouse IgG1 (Sigma, St. Louis, MO) in 0.2 ml of PBS
as a control, every other day for 10 days, for a total of 5 injections
starting on day 1 or day 6 after tumor implantation. The size of the
subcutaneous tumors was measured with a caliper and tumor volume was
calculated according to the formula V =
d x D x 
/2, where d is
the smaller diameter and D the larger diameter. Mice were
then monitored for tumor development and progression. Treated and
control mice were euthanized and necropsied for evidence of tumors,
including histology and immunohistochemistry. Experimental groups
included 8 mice for each treatment protocol and 11 mice in the control
group. Tumor volumes in both groups were compared by Wilcoxon rank-sum
test for statistical significance.
Anti-Tumor Activity of HeFi-1 in Vitro
The anti-tumor activity of HeFi-1 on human ALCL tumor cell growth in vitro was determined by 3H-thymidine incorporation. Single cell suspensions from short-term tumor tissue cultures were split 24 hours before assays were performed. Cells were resuspended in 10% fetal calf serum (FCS) in RPMI, supplemented with L-glutamine and penicillin/streptomycin at a final concentration of 5 x 104 cells/ml. The cell suspension was plated at 0.2 ml/well in 96-well round bottom plates (Corning Glass Works, Corning, NY). HeFi-1 or IgG1 isotype (Sigma) as a control, was added in soluble form at a concentration of 10 µg/ml. After 72 hours, wells were pulsed with 1 µCi 3H-thymidine/well (New England Nuclear Research Products, Boston, MA). Cells were harvested onto glass fiber filters with a cell harvesting system (PhD Cell Harvester, Cambridge Technology, Inc., Cambridge, MA) and 3H-thymidine incorporation was measured in a Wallac 1409 liquid scintillation counter (Wallac Inc., Gaithersburg, MD). Each experiment was performed in triplicate. Results were statistically analyzed using paired t-test and Statview software package.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Lymphoma cells obtained from the ALCL patient were inoculated i.p. into one 4-week-old female SCID/bg mouse and produced disseminated tumor in 8 weeks. The established tumor was transplanted by subcutaneous injection into four SCID/bg mice which all developed rapidly growing lymphomas manifested by palpable tumor masses within 4 to 6 days. At necropsy, diffuse lymphadenopathy involving mediastinal, retroperitoneal, cervical, axillary, and submandibular nodes, as well as tumor involving the spleen, liver, lung, and pancreas were detected.
Histopathology
The cytological features of the established tumor were similar to
those of the original ALCL tumor with anaplastic, predominantly large
tumor cells with round or bean-shaped nuclei, a high nuclear to
cytoplasmic ratio, and numerous mitoses (Figure 1, a–c
and Figure 4a
). Microscopic
evaluation of a wide range of organs revealed systemic massive
lymphomatous involvement of the lungs (Figure 1d)
, pancreas, kidneys,
and gastrointestinal tract as well as peripheral blood involvement.
Invasion of the central nervous system and bone marrow was not
observed.
|
|
Immunophenotyping on paraffin sections of the transplanted ALCL displayed tumor cell expression of CD30, CD3, and ALK-1, confirming expression of the NPM-ALK fusion protein and identity with the original human ALCL tumor. As in the original tumor, CD4, CD8, EMA, CD15, CD20, CD57, and LMP were not expressed. Analysis of cell surface antigens of the mouse tumor by flow cytometry confirmed expression of CD30 and CD3. CD19, CD4, CD8, and CD5 antigen expression was absent.
Molecular Gene Expression
Reverse transcriptase (RT)-PCR of the original patient tumor and
mouse xenografts showed the predicted 177-bp product for NPM/ALK
(Figure 2)
. Evaluation of mRNA expression
by RT-PCR revealed transcripts for IL-1, IL-2 receptor, IL-6
receptor, G-CSF receptor, IL-8, IL-10, TGF-ß, IFN-, TNF-, and
c-myc. No expression of message was found for IL-2, IL-4,
IL-5, IL-6, IL-7, IL-9, or G-CSF (data not shown).
|
HeFi-1 is a monoclonal antibody raised against a functional
epitope of the human CD30 antigen.9
None of eight mice
treated with 10 µg of HeFi-1 antibody within 24 hours of tumor
transplantation and every other day for 10 days thereafter developed
tumors by 30 days. All of eleven control animals injected with
nonspecific IgG isotype matched control antibody developed tumors that
reached a mean volume of 2.9 cm3
by day 14, and produced
disseminated tumor by 3 to 4 weeks. At necropsy, control mice were
found to have widespread disease, while HeFi-1 treated mice were free
of disease (P < 0.01). In the second
experimental group, we tested the efficacy of HeFi-1 treatment in mice
with established tumors. Mice bearing tumors of at least 0.2
cm3
in volume, which on average corresponded to day 6 after
tumor xenografting, were treated with HeFi-1 and experienced tumor
growth arrest or regression, without tumor dissemination. Tumor volumes
in control and treated animals compared at day 27 were significantly
different (P < 0.025). All treated mice
remained alive at 30 days (Figure 3)
.
Histological sections of tumors in treated mice revealed frequent dying
or dead cells, cellular depletion, fibrosis, and sometimes
calcification, consistent with a therapeutic effect achieved by
HeFi-1 treatment (Figure 4, a–d)
. In
contrast, control mice with established tumors treated with control IgG
antibody developed large tumors, which disseminated widely causing
massive enlargement of lymph nodes, spleen, and other organs, and died
or were moribund within 30 days.
|
Incubation of tumor cells obtained from mouse xenografts with
HeFi-1 significantly inhibited the proliferation of tumor cells (60%)
as measured by 3H-thymidine incorporation (Figure 5)
. An established t(2;5)+, CD30+ ALCL
cell line (Karpas 299) was used for comparison and demonstrated a 47%
inhibition under the same experimental conditions.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
SCID mice have been widely used as xenograft recipients for human
neoplastic tissue including hematological
malignancies.11-14
The SCID mutation is responsible for a
lack of functional T and B lymphocytes, due to a congenital deficiency
in the VDJ recombinase enzyme system involved in immunoglobulin (Ig)
and T cell receptor gene rearrangement that effectively blocks both T
and B cell maturation.15
However, engraftment and
maintenance of human hematopoietic tissue in SCID mice has been
described as difficult16-18
and its efficiency tends to
vary depending on other factors including immunologically mediated
tumor rejection.19-21
Numerous methods for improving
xenografting efficiency including -irradiation, administration of
anti-NK-cell antibodies and immunosuppressive drugs have been
used.20
These methods were largely aimed at dampening the
NK-mediated arm of the immune response but suffer from the disadvantage
that they are cumbersome and often nonspecific. To avoid these
difficulties we used SCID/bg mice. The beige mutation leads to
selective impairment of NK-cell mediated immune
function.21
In combination with the SCID mutation, the
beige mutation appears to provide favorable conditions for growth of
human hematological malignancies in mice, thereby allowing the
establishment and propagation of a reliable source of tumor cells from
limited patient material. This is of particular importance since
despite the ability of the tumor cells to grow indefinitely in
vivo by serial passage through SCID/bg mice, lymphoma cells
recovered from mouse tissues could not be maintained as a cell line
in vitro, even in the presence of recombinant cytokines, a
phenomenon which has been reported by others,12
although
primary cultures could be maintained for up to 3 months by fastidious
culturing procedures.
Expression of cytokine and cytokine receptor genes is believed to play
an important role in the regulation of normal and malignant lymphocyte
proliferation. Numerous cytokines, including IL-1, IL-2, IL-6, IL-7,
and TNF- have been identified as important autocrine growth factors
in a variety of lymphoid neoplasms.22,23
It was of
interest that the present ALCL tumor expressed receptors for IL-2,
IL-6, and G-CSF and transcripts for IL-1, IL-6, TNF-, and
IFN-, which could explain the patient's B symptoms.
Failure of conventional chemotherapy in CD30+ ALCL patients is accompanied by a poor prognosis. New immunological regimens targeting the CD30 molecule could offer alternative therapeutic approaches. The functional relevance of CD30 and CD30 ligand (CD30L) expression in CD30+ ALCLs is unclear at present. Recently, recombinant human CD30L was expressed on the surface of cultured cells and tested for biological activities on a variety of different CD30+ human lymphoma cell lines. It was demonstrated that CD30L+ cells have an antiproliferative effect on certain CD30+ ALCL cell lines.24,25 Therefore, CD30L is capable of transducing signals through the specific cognate molecule CD30, making this a promising molecule to target for immunotherapy of these aggressive lymphomas.
The mechanism of action of HeFi-1 antibody in vivo is most likely a direct effect on tumor growth properties caused by activation of the CD30 signaling pathway.24 The possibility of antibody dependent cellular cytotoxicity (ADCC) is unlikely because SCID/bg mice lack natural killer cells which are the main effectors of ADCC. Our in vitro proliferation assay demonstrates a direct growth inhibitory action of HeFi-1 on tumor cells obtained from murine xenografts. Preliminary studies in our laboratory have shown that the initial in vitro anti-proliferative effect of HeFi-1 is due to cell cycle arrest in late G1 rather than directly causing apoptosis (Levi E, Pfeifer W, Petrogiannis-Haliotis T, Wang Z, Kadin ME, manuscript in preparation). Our model should provide a better understanding of how HeFi-1 therapy affects tumor cell cycle and apoptosis in vivo.
Previous work from this laboratory, using Ber-H2 antibody (which binds to a non-functional epitope on the human CD30 antigen) conjugated with saporin, a plant ribosome-inactivating toxin, demonstrated tumor growth delay and prolonged survival of ALCL xenografted mice.26 The present study demonstrates that just a short course of HeFi-1 monoclonal antibody without a conjugated toxin can prevent growth and dissemination of established tumors and prolong survival of mice bearing a chemotherapy-resistant aggressive CD30+ ALCL. In a prior study by Tian et al it was shown that treatment of SCID mice bearing human ALCL tumor cells with repeated doses of HeFi-1 or M44 antibody significantly prolonged their survival. However, those investigators did not measure tumor burden before treatment and neither regression nor growth delay of established tumors was shown.27 The current regimen has the advantage of avoiding the adverse effects of the toxin and potentially providing more efficient access to tumor cells using a smaller antibody molecule. The short course required to achieve an anti-tumor effect in this study also avoids the potential generation of human anti-mouse antibodies as would be desired in future clinical trials. In conclusion, our in vivo CD30+ ALCL tumor model demonstrates a method to study disseminated disease, beginning with limited human material. Furthermore, this model serves as a tool to elucidate the signaling mechanisms of CD30 activation in human tumor cells that could provide the basis for the selection of appropriate immunotherapeutic modalities in patients with chemotherapy resistant disease.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Supported by the Deutsche Krebshilfe (WP), Lymphoma Research Foundation of America (EL), Cure for Lymphoma Foundation, New York, NY (TP-H), and the American Cancer Society ROG-98-125-01 and the Leukemia Society of America, 6178-98 (MEK).
WP and EL contributed equally to this work.
Accepted for publication June 4, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
/
established in immune-deficient (bg/nu/xid) mice. Leukemia 1993, 7:281-289[Medline]
This article has been cited by other articles:
 |
|
 |
|
  H. M. Amin and R. Lai Pathobiology of ALK+ anaplastic large-cell lymphoma Blood, October 1, 2007; 110(7): 2259 - 2267. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Zhang, Z. Yao, H. Patel, K. Garmestani, Z. Zhang, V. S. Talanov, P. S. Plascjak, C. K. Goldman, J. E. Janik, M. W. Brechbiel, et al. Effective therapy of murine models of human leukemia and lymphoma with radiolabeled anti-CD30 antibody, HeFi-1 PNAS, May 15, 2007; 104(20): 8444 - 8448. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Zhang, Z. Yao, Z. Zhang, K. Garmestani, C. K. Goldman, J. V. Ravetch, J. Janik, M. W. Brechbiel, and T. A. Waldmann Effective therapy for a murine model of human anaplastic large-cell lymphoma with the anti-CD30 monoclonal antibody, HeFi-1, does not require activating Fc receptors Blood, July 15, 2006; 108(2): 705 - 710. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Nagata, T. Ise, M. Onda, K. Nakamura, M. Ho, A. Raubitschek, and I. H. Pastan Cell membrane-specific epitopes on CD30: Potentially superior targets for immunotherapy PNAS, May 31, 2005; 102(22): 7946 - 7951. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. I. Berro, G. A. Perry, and D. K. Agrawal Increased Expression and Activation of CD30 Induce Apoptosis in Human Blood Eosinophils J. Immunol., August 1, 2004; 173(3): 2174 - 2183. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Younes and M. E. Kadin Emerging Applications of the Tumor Necrosis Factor Family of Ligands and Receptors in Cancer Therapy J. Clin. Oncol., September 15, 2003; 21(18): 3526 - 3534. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Willers, R. Dummer, W. Kempf, T. Kundig, G. Burg, and M. E. Kadin Proliferation of CD30+ T-Helper 2 Lymphoma Cells Can Be Inhibited by CD30 Receptor Cross-Linking with Recombinant CD30 Ligand Clin. Cancer Res., July 1, 2003; 9(7): 2744 - 2754. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Nagata, M. Onda, Y. Numata, K. Santora, R. Beers, R. J. Kreitman, and I. Pastan Novel Anti-CD30 Recombinant Immunotoxins Containing Disulfide-stabilized Fv Fragments Clin. Cancer Res., July 1, 2002; 8(7): 2345 - 2355. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Levi, W. M. Pfeifer, M. E. Kadin, S. S. Mir, B. W. M. Richter, and C. S. Duckett CD30-activation-mediated growth inhibition of anaplastic large-cell lymphoma cell lines: apoptosis or cell-cycle arrest? Blood, September 1, 2001; 98(5): 1630 - 1632. [Full Text] [PDF]
|
|
|
|
 |
|
 M. E. Kadin Regulation of CD30 Antigen Expression and Its Potential Significance for Human Disease Am. J. Pathol., May 1, 2000; 156(5): 1479 - 1484. [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
