| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Institut National de la Santé et de la Recherche
Médicale U-370 and Liver Unit,*
Centre Hospitalier
Universitaire Necker, Paris, France; the Service d’Anatomie et de
Cytologie Pathologiques,
Hôpital Antoine
Béclère Clamart, France; the Service
d’Anatomo-pathologie,
Hôpital Laennec,
Paris, France; the Service
d’Hépatologie,§
Hôpital
Necker-Enfants Malades, Paris, France; the Service de Chirurgie
Générale et Digestive,¶
Hôpital
Antoine Béclère, Clamart, France; and the Laboratory for
Histo- and Cytochemistry,||
University of Leuven,
Leuven, Belgium
 |
Abstract |
|---|
 Top Abstract IntroductionPatients and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
HIP/PAP belongs to group VII of the C-type lectin family according to Drickamer’s classification,2 because it contains only one carbohydrate recognition domain (CRD) linked to a signal peptide. In this group, three PAPs (PAP I or peptide 23, PAPs II and III) have been described for the rat,3 whereas three reg/lithostatines have been identified in the mouse (I, II, and III).4,5 One PAP gene (tentatively named HIP/PAP) and one reg/lithostatine have been described in humans.1,6,7
Our earlier investigations had shown that HIP/PAP was expressed in normal subjects in the intestine (Paneth and neuroendocrine cells), and the pancreas (acinar pancreatic cells and islets of Langerhans), whereas in the liver, its expression was triggered in the event of primary liver cancer.8 Moreover, HIP/PAP is a secretory protein that is rapidly overexpressed during the acute phase of pancreatitis.9 In addition, rat peptide 23, or PAP I, is secreted by rat pituitary and uterine cells under the influence of growth hormone-releasing hormone and estradiol, respectively.10,11 Motor neurons are the only adult mammalian neurons of the central nervous system that regenerate after injury. The gene corresponding to human HIP/PAP gene in the rat, called Reg-2 or rat PAP I, has recently been found to be expressed in regenerating motor neurons, and the protein exhibits mitogen-like activity in vitro on Schwann cells.12 Thus, the same protein has been identified using several independent approaches and exhibits marked, tissue-specific expression.
In the exocrine pancreas, HIP/PAP expression pattern is consistent with that of an acute phase reactant; however, this does not account for its expression in the islets of Langerhans of the endocrine pancreas. In human liver, limited data are available concerning the implications of HIP/PAP expression. Our previous investigations in the liver, demonstrating that HIP/PAP was expressed in HCC, suggested its potential importance in human liver carcinogenesis. Furthermore, increased serum secretion has been demonstrated in patients with HCC.13 However, we still do not know whether the liver cells involved in the biliary or hepatocyte differentiation express the HIP/PAP protein. During the early stages of chemical hepatocarcinogenesis in the rat, a cell population (the so-called oval cells) appears and is thought to derive from a stem cell compartment.14,15 Oval cells have been the subject of thorough investigation and exhibit a capacity toward both biliary and hepatocyte cell lineages.16-19 Oval cell proliferation has also been observed during hepatocarcinogenesis in woodchuck virus carriers20 and in human livers from patients with different pathological conditions, including chronic infection by hepatitis B virus (HBV),21 and ductular reaction induced by regeneration and cholestasis.22 Ductular reaction has been characterized by the proliferation of reactive ductules, which are made up of intermediate hepatocyte-like and bile duct-like cells.23,24 Thus, the analysis of human liver sections exhibiting such cell proliferation should be relevant in this context. We therefore investigated HIP/PAP expression in patients with a range of liver diseases associated with ductular reaction, as well as in those with HCC and cholangiocarcinomas. We determined the serum levels of HIP/PAP and correlated the rate of secretion to liver expression profiles.
|
Patients and Methods |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
Tissues
Liver samples from 35 patients with HCC were obtained at surgery,
immediately frozen in liquid nitrogen, and stored at -80°C for RNA
extraction. Liver sections and sera were also available for testing
using immunohistochemistry and enzyme-linked immunosorbent assay
(ELISA) techniques. Clinical data are shown in Table 1
.
|
Each liver sample was divided into two parts. The larger part was either fixed in B5 fixative and used for routine light microscopic diagnosis or treated with 4% formalin and paraffin-embedded for immunohistochemistry. The other part was snap-frozen in liquid nitrogen-cooled isopentane, stored at -70°C, and used for immunohistochemistry tests.
Sera
Sera from 28/35 patients with HCC, 51 patients with cirrhosis without overt HCC, and 26 healthy donors used as normal controls were stored at -20°C for the HIP/PAP assay. This protocol was approved by the local Institutional Review Board at Necker Enfants-Malades Hospital (Paris).
Methods
RNA Extraction, Northern Blots, and Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
Total RNA was extracted using Trizol Reagent (Life Technologies, Gaithersburg, MD). RNAs (20 µg) were separated on a denaturing formaldehyde gel and then transferred onto Hybond-C-extra nitrocellulose membranes (Amersham, Buckinghamshire, UK). Hybridizations were performed using random-primed human HIP/PAP. Hybridization and washing conditions were as previously described.1
Total RNA (1 µg) was processed for RT-PCR (MMLV-RT and Taq DNA Polymerase, Life Technologies) using the sense 19bis (5'ATGCTGCCTCCCATGGCCCTG3') and the antisense 101 (5'GCCCATGATGAGTTGCACACCAAACA3') primers in positions 1–21 and 553–578 of the HIP/PAP cDNA. Human HIP/PAP cDNA (one-third of the reverse reaction) was heated to 94°C for 5 minutes and amplified for 40 cycles of 94°C for 1 minute, 58°C for 1 minute, and 72°C for 1 minute, and the final cycle was identical except for the 10-minute extension.
Western Blot Analysis
Human ileum and sera were analyzed using Western blot with pre-HIP antibodies diluted to 1:5000, as previously described.8
Immunohistochemistry
Two immunohistochemical methods were used for immunohistochemistry, whether the tissue was frozen or not.
Formalin-fixed sections 3 µm thick were deparaffinized, hydrated, and boiled for 20 minutes in 10 mmol/L citrate buffer, pH 6.2, in a microwave oven. Endogenous peroxidase activity was quenched by incubation with 0.3% hydrogen peroxide. Trypsin predigestion for 5 minutes at 37°C, phosphate-buffered saline washing, and blocking for 10 minutes with normal goat serum (dilution 1:20) were performed before incubation for 30 minutes at room temperature with polyclonal pre-HIP or CRD antibodies (dilution 1:400).8 After washing three times in phosphate-buffered saline, biotinylated-linked secondary antibody (DAKO, Trappes, France) was added for 30 minutes. The sections were then washed and incubated for 30 minutes with a complex of streptavidin/biotinylated peroxidase. Signals were visualized using 3-amino-9-ethylcarbazole (Sigma, St Louis, MO) and counterstained with Mayer’s hematoxylin. Finally, the slides were mounted in an aqueous solution with glycergel (DAKO).
Semiserial 5-µm cryostat sections were dried overnight at room temperature, fixed in acetone for 10 minutes, and stained using a three-step peroxidase-anti-peroxidase method (Dakopatts, Copenhagen, Denmark). Two different HIP/PAP rabbit total IgGs (CRD and pre-HIP, dilution 1:100)8 were incubated overnight at 4°C. Cytokeratin 7 (Dakopatts, dilution 1:50), and OV6 (Drs. H. Dunsford and S. Sell, University of Texas, Austin, TX, dilution 1:200) antibodies were incubated for 30 minutes at room temperature. The reagents were diluted in phosphate-buffered saline, pH 7.2, containing 10% normal human serum, and incubated for 30 minutes at room temperature. After each incubation, the sections were washed three times with phosphate-buffered saline, pH 7.2, for 15 minutes. The reaction product was developed using 3-amino-9-ethylcarbazole and H2O2. As a control, semiserial sections were incubated with anti-HIP/PAP antisera, preabsorbed with an HIP/PAP recombinant protein used for immunization in the production of anti-HIP/PAP antisera. Additional controls involved omitting the primary antibody, or using irrelevant isotypic primary antibodies.
ELISA
Serum HIP/PAP levels were assayed using a sandwich ELISA test in accordance with manufacturer’s instructions (Dynabio, La Gaude, France) and as previously described.13
Statistical Analysis
Distribution of data were described using the box and whiskers
representation (Statview 5' software). The Mann-Whitney U
test was used to compare HIP/PAP concentrations in controls, patients
with HCC, and patients with cirrhosis. Spearman’s rank correlation was
used to correlate 
-fetoprotein and HIP/PAP concentrations in
patients with HCC. Comparisons of observed frequencies for HIP/PAP
expression and classic HCC prognostic factors were calculated with the
2
test. P values <0.05 were
considered statistically significant.
|
Results |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
Among 35 HCC patients analyzed using Northern blot, 34 and 29 were
also studied using RT-PCR and immunohistochemistry, respectively (Table 1)
. Northern blots showed an accumulation of HIP/PAP mRNAs in 9/35 HCC.
However, RT-PCR detected HIP/PAP gene transcription in 27/34 (79%)
tumor tissues (Figure 1)
. In contrast,
HIP/PAP mRNA was not detectable in two samples of nontumoral liver,
although the corresponding tumoral tissue expressed the gene (data not
shown). Finally, HIP/PAP protein was detected in 10/29 (34%) HCC
tissues using immunohistochemistry (Table 2A)
.
|
|
We found no relationship between HIP/PAP gene expression and classic
HCC prognostic factors (Table 3)
, and
there was no correlation between -fetoprotein and HIP/PAP serum
concentrations (Table 1)
. Liver samples and sera from patients with
cholangiocarcinomas were not available for these investigations.
|
HIP/PAP protein was expressed in 10/29 (34%) HCC tissues, which
were divided into four groups based on the signal intensity (Table 2B)
.
Group I exhibited strong labeling (more than 20% of staining cells;
n = 2), group II a moderate labeling (5–20% of
staining cells; n = 4) and group III a slight labeling
(1–5% of staining cells; n = 4), whereas no signal
was detected in group IV (n = 19). Positive
cells were localized at the periphery of the carcinomatous nodules in
6/10 positive tumors. HIP/PAP immunostaining appeared as
intracytoplasmic brown granules occupying most of the cytoplasm; in
6/10 and 2/10 HCC tissues, HIP/PAP was expressed in perinuclear bodies
and at the plasmic membrane, respectively (Figure 2, A
-C). Twenty cholangiocarcinomas,
characterized by tubular structures and tumoral strands within a
fibrous stroma, were also studied. HIP/PAP protein was expressed in
8/20 cholangiocarcinomas (40%). Signal intensity was virtually
equivalent in these 8 positive tumors. Staining was cytoplasmic and
diffuse in the majority of the tumor cells, but with varying intensity
(Figure 2D)
.
|
. Figure 3B
shows HIP/PAP positive
reactive ductules and hepatocyte-like intermediate cells (arrow) in a
case of cirrhosis. In addition, nerves in portal tracts and portal
tract equivalents (for focal nodular hyperplasia) were also
immunoreactive, as shown in one case of chronic active hepatitis C
(Figure 3C)
.
|
.
Whether HIP/PAP was really expressed in ductular cells, we performed
immunohistochemistry test on semiserially cut cryostat sections of a
portal tract in an extrahepatic subobstruction (Figure 4)
. We observed that HIP/PAP, cytokeratin
7 (bile duct type cytokeratin) and OV6 (marker of oval cells) were
expressed in ductular cells localized in the portal tracts.
|
Sera HIP/PAP levels were compared in three groups of subjects
(ng/ml): normal controls (healthy donors, n = 26), HBV,
HCV, or alcoholic patients with liver cirrhosis
(n = 51), and patients with HCC
(n = 28). Serum samples from patients with
cholangiocarcinoma were not available. HIP/PAP levels did not result in
a normal distribution of data, so we used a nonparametric test to
establish the comparisons. HIP/PAP levels were significantly higher in
HCC patients (median 50.25 ng/ml; range 19–2803 ng/ml) compared to
healthy donors (21 ng/ml; 7–55 ng/ml; P < 0.0001),
and to patients with cirrhosis (28 ng/ml; 11.5–424 ng/ml;
P = 0.0076) (Figure 5A)
.
Based on normal controls, we estimated the normal serum value at 27
ng/ml, which agreed with the results obtained by Dusetti et
al.13
HIP/PAP protein levels were indeed elevated in the
sera of 21/28 (75%) patients with HCC and 25/51 (49%) cirrhotic
patients (Table 2A)
. Seventeen of 20 RT-PCR-positive patients showed
elevated HIP/PAP values in the ELISA test; furthermore, 3 of 7 patients
whose liver tissues showed a marked accumulation of HIP/PAP RNA,
detectable by Northern blot, had serum values which reached more than
60, 10, and 3 times the threshold of normal values, respectively.
Overall, these data showed that the rate of HIP/PAP secretion was
directly related to its hepatic expression.
|
.
It is worth noting that there was, however, a highly significant
difference between alcoholic patients and controls
(P = 0.0006). Whether the frequent increase of
HIP/PAP levels in alcohol-related cirrhotic patients might reflect an
impact of alcohol on ductular reaction remains still elusive. |
Discussion |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
The nature of the cellular response to liver injury depends largely on the location and degree of liver loss. After a two-thirds partial hepatectomy in the rat, or limited hepatotoxic injury in humans, the restoration of liver mass is accomplished through the proliferation of mature hepatocytes. However, the cellular response to severe liver injury, such as that induced by chemicals24 and, possibly, by chronic viral infections,20,21 may involve reserve liver stem cells (the so-called oval cells), which have so far resisted definite characterization.25,26 In humans, the proliferative response to many types of liver injury is indeed characterized by an increase in bile duct-like structures and is termed a ductular reaction. Recent evidence has suggested that reactive ductules in humans may contain immature cells with a capacity for bipotential differentiation.27 During chemically induced carcinogenesis in the rat14-16 and mouse,28 oval cells have been studied extensively and their dual capacities for biliary and hepatocyte differentiation have been demonstrated. In these models of liver carcinogenesis, oval cells are very likely to give rise to both HCC and cholangiocarcinoma. Furan-induced biliary hyperplasia and cholangiofibrosis are associated with the metaplastic appearance of cells with the morphology of hepatocytes (ductular hepatocytes) during the early stages of rat cholangiocarcinogenesis.29 Our present results show that HIP/PAP-positive cells express biliary cell markers. It remains to be elucidated, however, whether such HIP/PAP-positive cells could differentiate in both biliary and hepatocytic lineages.
In humans, such reactive bile ductules exhibit neuroendocrine features (chromogranin A and neural cell adhesion molecule immunoreactivity).30 It has been suggested that these molecules, produced in dense-cored secretory granules, may play a role in the growth and/or differentiation of liver cells through autocrine and/or paracrine pathways. Interestingly, we now present evidence that HIP/PAP is expressed in reactive bile ductules and in certain nerve bundles located in the portal tracts, and so may participate in this process. Three characteristics of HIP/PAP protein support this hypothesis. First, HIP/PAP protein is stored in zymogen secretion granules of exocrine pancreas acinar cells and in the endocrine pancreas.8 Second, HIP/PAP is expressed in intestinal neuroendocrine and Paneth cells showing neuroendocrine marker and immunoreactivity for synaptophysin8 (F. Carnot, personal data). Indeed, HIP/PAP is also expressed in regenerating motor neurons and could act as a mitogenic factor for Schwann cells.12 We have also recently shown that HIP/PAP is expressed in nervous system of the postimplantation mouse embryo at day 14.5, before its expression in intestine and pancreas at day 16.531 Third, HIP/PAP interacts with both hepatocytes and extracellular matrix proteins and has been proposed as an adhesive molecule.8 Taken together, these results suggest that HIP/PAP may constitute a further marker of liver cells which express a complex pattern of neuroendocrine and neural cell adhesion molecules, and may be activated in response to certain liver regeneration stimuli as well as during liver carcinogenesis.
This study also confirms the existence of abundant intrahepatic HIP/PAP gene expression in patients with HCC. Northern blot-based analysis showed an accumulation of HIP/PAP RNA in 9/35 subjects with HCC (25%), a figure which agrees with previous results (7/29).1 The positive frequency of HIP/PAP expression was, however, significantly increased when other more sensitive experimental approaches were used; indeed, using RT-PCR, HIP/PAP RNA was detected in 28/35 (79%) liver tumors. Furthermore, HIP/PAP protein was expressed in 11/32 (34%) tumors and secreted into the serum of 21/28 (75%) patients with HCC. Thus, a convergence could be seen in the results obtained with the three experimental approaches, further validating the translation of the mRNA amplified by RT-PCR.
The activation of several genes has been reported extensively in liver
cancers, such as those encoding for -fetoprotein, glutamine
synthetase,32
and insulin-like growth factor II. In
contrast with those markers, HIP/PAP expression was not detectable
during fetal liver development.31,33
In this context, it
is important to emphasize that, in agreement with previous
study,34
there was no correlation between -fetoprotein
and HIP/PAP serum levels, which suggests that both inductions occur by
independent mechanisms.
Cholangiocarcinoma tissues were only available for immunohistochemical analysis, but HIP/PAP protein was also frequently expressed in the tumors (8/20, 40%). Our observations thus demonstrate that HIP/PAP gene activation is a frequent genetic feature of tumor liver cells engaged in either the hepatocyte or cholangiolar pathways. The role of HIP/PAP in liver carcinogenesis is as yet unknown, and only a subset of HCC and cholangiocarcinoma tumors express HIP/PAP. However, HIP/PAP serum levels are also increased in a subset of cirrhotic patients without malignancies (25/51, 49%), and HIP/PAP is expressed in ductular cells characterized by cytokeratin 7 and OV6 immunostainings. Taken together, these results suggest that HIP/PAP is expressed not only in hepatocellular carcinoma, but also in cholangiocarcinoma as well as in ductular cells. As these ductular cells have been proposed to represent potential progenitor cells with a bipotential capacity to differentiate into bile duct cells and hepatocytes, they might constitute potential precursors for a subset of liver cancers with either hepatocyte or cholangiolar phenotypes. This observation, seen alongside the expression of HIP/PAP in tumor cells with either hepatocyte or cholangiolar phenotypes, leads us to suggest that HIP/PAP may be implicated in hepatocyte or cholangiolar differentiation and proliferation.
|
Footnotes |
|---|
Supported by Institut National de la Santé et de la Recherche Médicale, Association pour la Recherche contre le Cancer, Ligue Nationale contre le Cancer, Fondation de France.
Accepted for publication July 15, 1999.
|
References |
|---|
|
TopAbstractIntroductionPatients and MethodsResultsDiscussionReferences |
|---|
-fetoprotein. Oncology 1998, 55:421-425[Medline]
This article has been cited by other articles:
 |
|
 |
|
  L. A. Tebar, S. M. Geranton, C. Parsons-Perez, A. S. Fisher, R. Bayne, A. J. H. Smith, M. Turmaine, S. Perez-Luz, A. Sheasby, C. De Felipe, et al. Deletion of the mouse RegIII{beta} (Reg2) gene disrupts ciliary neurotrophic factor signaling and delays myelination of mouse cranial motor neurons PNAS, August 12, 2008; 105(32): 11400 - 11405. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Gironella, E. Folch-Puy, A. LeGoffic, S. Garcia, L. Christa, A. Smith, L. Tebar, S. P Hunt, R. Bayne, A. J H Smith, et al. Experimental acute pancreatitis in PAP/HIP knock-out mice Gut, August 1, 2007; 56(8): 1091 - 1097. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Folch-Puy, S. Granell, J. C. Dagorn, J. L. Iovanna, and D. Closa Pancreatitis-Associated Protein I Suppresses NF-{kappa}B Activation through a JAK/STAT-Mediated Mechanism in Epithelial Cells J. Immunol., March 15, 2006; 176(6): 3774 - 3779. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R.-H. Yuan, Y.-M. Jeng, H.-L. Chen, F.-J. Hsieh, C.-Y. Yang, P.-H. Lee, and H.-C. Hsu Opposite Roles of Human Pancreatitis-Associated Protein and REG1A Expression in Hepatocellular Carcinoma: Association of Pancreatitis-Associated Protein Expression with Low-Stage Hepatocellular Carcinoma, {beta}-Catenin Mutation, and Favorable Prognosis Clin. Cancer Res., April 1, 2005; 11(7): 2568 - 2575. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M.-T. SIMON, A. PAULOIN, G. NORMAND, H.-T. LIEU, H. MOULY, G. PIVERT, F. CARNOT, J. G. TRALHAO, C. BRECHOT, and L. CHRISTA HIP/PAP stimulates liver regeneration after partial hepatectomy and combines mitogenic and anti-apoptotic functions through the PKA signaling pathway FASEB J, August 1, 2003; 17(11): 1441 - 1450. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
