| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |





From the Servicio de Reumatología,*
Centro de
Investigación, Hospital 12 de Octubre, Madrid, Spain; Unité
dImmunologie Virale,
Institut Pasteur,
Paris, France; Service de Dermatologie,
Hopital H. Mondor, Creteil, France; and INRA,§
Villenave dOrmon, France
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
and ß, are generated from the
SDF-1 gene by alternative splicing. ß and
forms differ by the
presence of four additional amino acids at the carboxy terminal end of
the former.3,4 SDF-1/CXCR4 interactions are unique and nonpromiscuous. In mice, SDF-1 or CXCR4 gene knock-outs generate a similar phenotype, characterized by deficient B lympho- and myelopoiesis, and abnormal neuronal and cardiovascular development.5-8 Embryo lethality associated with either CXCR4 or SDF-1 gene knock-outs emphasizes the critical and unique role played by their products during development. Prenatal death precludes the use of these animal models to investigate the postnatal physiological functions of these proteins. However, the constitutive expression of SDF-1 on one hand and, on the other hand, the fact that SDF-1/CXCR4 represents a nonredundant cell-signaling system, suggest that this chemokine plays a critical role in lymphocytic circulation and immune surveillance in the postnatal life. In vitro, SDF-1 shows potent chemoattractant properties for cells expressing the CXCR4 receptor, such as monocytes, lymphocytes, and CD34+ hematopoietic stem cells.9-11 Moreover, SDF-1/CXCR4 interactions are involved in homing and circulation of leukocytes during B-cell lymphopoiesis and myelopoiesis.5-7 The role of SDF-1 and CXCR4 in the homing of CD4 T lymphocytes or CD34+ stem cells to the bone marrow of mice has been demonstrated.12
Besides its physiological functions, SDF-1 has the unique capacity, not shared with any other known chemokine, to inhibit the entry of CXCR4-dependent (X4) viruses in T lymphocytes by binding and internalizing CXCR4.13-16 Although both X4 and CCR5-dependent (R5) viruses are detected in AIDS patients, only R5 HIV isolates are transmitted and propagate during asymptomatic phases of HIV infection, in contrast to X4 isolates, which become predominant in AIDS patients.17 A role for SDF-1 in delaying the evolution and mortality related to HIV, presumably associated with interference in the propagation of X4 HIV viruses during acute and chronic/asymptomatic phases of infection, has been proposed.18 SDF-1 transcripts have been detected in many tissues.3 However, human blood leukocytes do not express SDF-1,3 and the cell types involved in SDF-1 production and interference with transmission and propagation of X4 HIV isolates remain to be identified.
In an effort to identify SDF-1-producing cells, we have investigated the expression of SDF-1 products in human skin. Human skin offers an accessible and abundant source of tissue to investigate the phenotypic characteristics of cells involved in immunological and inflammatory responses. Importantly, skin contains Langerhans cells, which are critical in antigen presentation and specific priming of naive T lymphocytes. Immature Langerhans cells show a selective incapacity to support infection by X4 HIV isolates or to fuse with cells expressing X4 HIV envelopes that correlates with a relatively low abundance of CXCR4 on their cell surface.19,20 Thus the study of SDF-1 and CXCR4 expression in skin could shed light on the role played by this ligand/receptor in immunological homeostasis and dissemination of HIV.
Using a novel and specific anti-SDF-1 monoclonal antibody (mAb), we have analyzed SDF-1 expression in normal and inflamed skin. Because many chemokines can be internalized and presented on their surface by different cell types, particularly by endothelial cells (ECs),21 we have also studied the expression pattern of SDF-1 at the mRNA level by in situ hybridization (ISH) to evaluate whether cell types containing SDF-1 protein are also responsible for SDF-1 gene expression.
Herein we demonstrate that SDF-1 and its receptor CXCR4 are expressed by ECs, pericytes of adult small capillary blood vessels, and some epithelial cells. Importantly, we show that normal Langerhans cells express SDF-1 and that CXCR4 mononuclear cells colocalize with SDF-1-expressing cells in different skin inflammatory diseases. Overall our findings are compatible with a potential role for SDF-1 in the haptotactical attraction of circulating T lymphocytes by ECs and their interaction with antigen-presenting Langerhans cells.
| Materials and Methods |
|---|
|
|
|---|
The anti-SDF-1 K15C mAb (IgG2a) recognizes an epitope encompassed
in the amino-terminal end of SDF-1; it was developed by immunizing
BALB/c mice with a synthetic polypeptide carrying SDF-1 residues 115,
where cysteines in the motif C9P10C11 were replaced by serines. The
SDF-1ß cDNA was isolated from primary human fibroblasts by reverse
transcription of total RNA and subsequent polymerase chain reaction
(PCR) amplification. The cDNA of SDF-1
was obtained by PCR
amplification, using the SDF-1ß cDNA as a template.3,4
Nucleotide sequences of both cDNAs were verified by dideoxy sequencing.
For expression in mammalian cells, SDF-1
and ß cDNAs were
subcloned in a pcDNA3 plasmid (Invitrogen, Carsbad, CA) that allows
transcription from a human cytomegalovirus promoter.
Immunodetection of SDF-1 in Cells and Human Skin
Normal skin was obtained from five healthy individuals undergoing minor surgical interventions. Skin biopsies from five patients with cutaneous lupus, five with dermatomyositis, and five with systemic sclerosis (scleroderma) were also studied. All samples were routinely fixed with formalin and embedded in paraffin. Antigen retrieval was performed by microwave heating (3 x 5 minutes at 750 W in 1 mmol/L EDTA, pH 8) before immunostaining. Endogenous peroxidase was quenched in 3% H202 in methanol for 20 minutes. Staining was performed following a standard indirect avidin-biotin horseradish peroxidase method (ABC standard; Vector Laboratories, Burlingame, CA). Color was developed with diaminobenzidine (Vector Laboratories). The following antibodies were used: anti-SDF-1 clone K15C at 20 µg/ml, anti-CXCR4 clones 12G5 and 6H822 at 15 µg/ml and 2 µg/ml, respectively, and undiluted anti-CD1a MAb 010 (Immunotech S.A., Marseille, France). Controls with normal serum instead of primary antibody were always included. For K15C mAb controls preincubating the antibody with SDF-1 protein were also included. Sections were counterstained with hematoxylin.
To evaluate the specificity of K15C mAb, the immortalized goat
fibroblast TIGEF cell line23
was cotransfected by the
phosphate calcium method with 2 µg of EGFP-N1 (Clontech, Palo Alto,
CA) and 20 µg of either pcDNA3 SDF-1
or ß expression vectors.
The pcDNA3 insertless vector was used as the control.
TIGEF cells were spread on glass coverslips, and immunofluorescence was performed 40 hours after transfection. To prevent secretion and to enhance intracellular accumulation of SDF-1 isoforms, cells were treated for the last 4 hours in culture with Brefeldine A (10 µg/ml). Cells were washed and fixed in 3.7% paraformaldehyde in phosphate-buffered saline (PBS), permeabilized as previously described,15 incubated with the K15C mAb (15 µg/ml) for 1 hour at room temperature, and finally incubated with Cy3-goat anti-mouse IgG (Amersham Life Science, Little Chalfont, UK). Confocal microscopy was performed on a Leica TCS4D instrument. Series of 0.30.7-µm intervals were recorded and photographed.
The presence of functional SDF-1 in the culture media of transfected cells was confirmed by its ability to down-regulate surface CXCR4 in a Jurkat lymphoblastoid T cell line. CXCR4 endocytosis was evaluated by fluorescent activated cell sorting (FACS) analysis as previously described.15
Expression of SDF-1 by transfected cells was also confirmed by Western blot. Cells transfected as indicated above were treated or not for the last 4 hours in culture with Brefeldine A. Cells were collected 48 hours after transfection, and cytoplasmic proteins (60 µg) were separated by 15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis, blotted onto nitrocellulose filters, and probed with the K15C mAb. The ability of K15C to recognize either recombinant or synthetic SDF-1 isoforms was compared. A horseradish peroxidase-labeled rabbit anti-mouse antibody and the ECL system (Amersham Life Science) were used to reveal SDF-1 isoforms by the specific antibody.
In Situ Hybridization
Skin sections were dewaxed and rehydrated in PBS containing 0.1% active diethylpyro carbonate (DEPC). Sections were microwaved for 3 x 5 minutes at 750 W in 1 mmol/L EDTA (pH 8) and postfixed in cold 4% paraformaldehyde in PBS for 10 minutes. After treatment with 0.1% Triton X-100, sections were prehybridized in 5x standard saline citrate (SSC), 50% formamide, and 1x Denhardts solution and hybridized in the same solution containing 0.8 µg/ml of digoxigenin-UTP-labeled riboprobe for 12 hours at 50°C. Sections were washed in SSC to a final concentration of 0.1 x SSC at 55°C. Hybridized probe was detected by incubation with 1:500 alkaline phosphatase-conjugated anti-digoxigenin antibody (Boehringer Mannheim, Mannheim, Germany) 4-nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indolyl-phosphate for 1 hour and color developed with either NBT/BCIP or fast red (Vector Laboratories).
Digoxigenin-UTP-labeled sense and antisense SDF-1ß riboprobes were
synthesized by in vitro transcription of the SDF-1ß cDNA
cloned in pcDNA3 plasmid. Linearized plasmids were transcribed
in vitro, using SP6 and T7 polymerases according to the
manufacturers protocol (Boehringer Mannheim). The full-length
antisense SDF-1ß riboprobe used (300 nucleotides) recognizes SDF-1
and SDF1-ß mRNA.
SDF-1 RT-PCR Analysis of Explanted Dendritic Cells
Human skin was obtained from patients undergoing breast plastic surgery. Samples were cleared of fat with fine forceps. Skin explants (5 x 5 mm) were floated dermal side down in 10-cm Petri dishes containing tissue culture media (RPMI 1640 supplemented with 10% fetal calf serum, 2 mmol/L glutamine, 1% penicillin/streptomycin, 10 mmol/L HEPES buffer, 1% nonessential amino acids, and 1 mmol/L sodium pyruvate; all from Life Technologies Laboratories, Charing Falls, OH) for 3 days. The nonadherent migratory cells were gently resuspended, filtered to remove debris, and counted with trypan blue before use. Migratory dendritic cells (DCs) were characterized by their dendritic morphology and CD1a FACS analysis. More than 98% of nonadherent cells were CD1a positive.24
For detection of SDF-1 mRNA by reverse transcriptase PCR (RT-PCR), total RNA from human CD1a+ cells, foreskin fibroblast, and peripheral blood mononuclear cells (PBMCs) was extracted and reverse transcribed by standard methods. For each sample an identical amount of RNA was incubated with (RT+) or without (RT-) reverse transcriptase. Amplification of SDF-1 cDNAs was performed by PCR, using the following primers: sense 5'ATGAACGCCAAGGTCGTGGT 3', antisense 5'CTTGTTTAAAGCTTTCTCCAG GTAC 3'. Aliquots of each sample were amplified with ß-actin primers14 as the cDNA loading control.
| Results |
|---|
|
|
|---|
SDF-1
and ß proteins diverge by the presence of four
additional amino acids at the carboxy-terminal end in the ß isoform.
The K15C mAb was generated against a modified amino-terminal-end
antigen shared by SDF-1
and ß. The specific recognition of both
SDF-1 isoforms by this antibody was assessed by transfecting expression
vectors carrying their respective cDNAs in TIGEF cells, which lack
detectable SDF-1 mRNA, as assessed by RT-PCR (data not shown).
Transfection of TIGEF cells with either SDF-1
or ß cDNA leads to
the secretion of active SDF-1 that is capable, as
expected,15,16
of promoting internalization of CXCR4 in a
T-cell line (Figure 1a)
. After cell
disruption, cytoplasmic proteins from SDF-1-transfected TIGEF cells
were fractionated by sodium dodecyl sulfate-polyacrylamide gel
electrophoresis, blotted, and probed with the K15C mAb. While no signal
was detected in lysates from the control, untransfected cells, the
antibody recognized molecular species migrating with the expected
molecular weight of either SDF-1
and ß (~8 kd). The use of
Brefeldine A inhibited secretion and promoted intracellular
accumulation of both forms of SDF-1, facilitating their detection
(Figure 1b)
. The ability of this antibody to specifically recognize
SDF-1 products by indirect immunofluorescence in intact cells was
also assessed. TIGEF cells were transfected with either SDF-1ß
cDNA or insertless DNA plasmids. Cotransfection of a GFP expression
vector made it possible to identify cells that were efficiently
transfected. Transfected cells were treated with Brefeldine A.
Intracellular accumulation of SDF-1 was detected by immunofluorescence
with K15C mAb in SDF-1ß-transfected cells, whereas no signal was
obtained in cells transfected with the insertless vector (Figure 2)
. Similar results were obtained when
SDF-1 cDNAs were expressed in cell lines from simian or human origin
(data not shown). The antibody failed to recognize any other chemokine
currently identified by Western blot (data not shown).
|
|
In normal skin, SDF-1 immunostaining was uniformly present in
blood vessels of different sizes. Small capillary vessels of the
subpapillary plexus showed SDF-1 staining in ECs as well as in
pericytes (Figure 3, C and D)
. Larger
arteriolar and venular vessels in deeper skin layers displayed weak
SDF-1 staining that was limited to ECs (Figure 3E)
. Preincubation of
K15C mAb with SDF-1 peptide completely abolished immunostaining (data
not shown). Expression of SDF-1 mRNA was confirmed in both ECs and
pericytes by ISH with antisense SDF-1 riboprobes (Figure 4, C and D)
.
|
|
Additional evidence corroborating the expression of SDF-1 in skin DCs
was obtained from highly purified CD1a+ cell populations. CD1a+ DCs
migrating out of skin explants were immunolabeled with the K15C mAb and
analyzed by FACS. Intracellular accumulation of SDF-1 was demonstrated
in permeabilized cells, whereas no SDF-1 labeling was detected in
nonpermeabilized cells (Figure 5)
. RT-PCR
amplification confirmed the presence of SDF-1 mRNA in CD1a+ sorted DCs
(Figure 6)
. Together, these findings
demonstrate that skin DCs produce SDF-1 constitutively.
|
|
Normal skin fibroblasts were not labeled by anti-SDF-1 mAb or SDF-1
antisense riboprobes. In contrast, in sections from inflammatory skin
diseases, fibroblasts close to inflammatory infiltrates showed strong
SDF-1 immunostaining (Figure 7, A and C)
.
The pattern was similar in scleroderma, cutaneous lupus, and
dermatomyositis skin sections. In addition to fibroblasts, in areas
close to or within inflammatory infiltrates, a high number of large
mononuclear cells with monocyte-macrophage morphology displayed SDF-1
immunostaining (Figure 7, A and C)
. Small lymphocytes of inflammatory
infiltrates were not stained by anti-SDF-1 mAb. This pattern was also
confirmed by ISH with SDF-1 antisense riboprobes (data not shown). In
cultured foreskin fibroblasts, but not in PBMCs, SDF-1 mRNA was also
detectable by RT-PCR (Figure 6)
.
|
In normal skin, CXCR4 protein was detected in most cell types by
immunohistochemistry with either 6H8 or 12G5 mAb. We found an identical
staining pattern with the two antibodies. The strongest CXCR4
immunostaining was observed in ECs and pericytes of small capillary
blood vessels and in epithelial cells of sweat glands (Figure 8, A and B)
. In larger vessels, EC but
not smooth muscle cells were immunostained. Keratinocytes showed weaker
positive CXCR4 immunostaining (Figure 8A)
. Sweat glands were uniformly
immunostained, contrasting with the pattern observed for SDF-1 (Figure 8B)
. Some fibroblasts and dermal cells with dendritic morphology also
displayed CXCR4 immunostaining (Figure 8, A and C)
. Because
immunostaining does not differentiate between intracellular and
membrane CXCR4, we analyzed surface CXCR4 expression in explanted DCs.
Explanted DCs were immunolabeled with 12G5 mAb and analyzed by FACS.
Low cell surface amounts of CXCR4 were detected in explanted CD1a+ DCs
by FACS analysis of nonpermeabilized cells (Figure 5)
. Cell
permeabilization permitted detection of a more intense CXCR4 staining
of DCs, suggesting the preferential accumulation of the receptor in
intracellular stocks.
|
| Discussion |
|---|
|
|
|---|
We here show that both SDF-1 and CXCR4 receptor are expressed by skin blood vessels of different sizes. Small capillary and larger venular and arteriolar vessels express SDF-1 protein. Given the capacity of ECs to internalize and accumulate chemokines from the extracellular environment,21 we first hypothesized that expression of SDF-1 in these cells could merely result from uptake of the chemokine secreted by pericytes. This possibility was supported by the selective expression of SDF-1 mRNA observed in pericytes, but not in the adjacent ECs, from intestinal tract vessels of mice embryos.8 However, we unambigously detect both the mRNA and product of the SDF-1 gene in skin ECs. These divergent data could be due to species or tissue differences, or alternatively, they could be the consequence of a different pattern of SDF-1 expression during embryogenesis. The abnormal development of gastrointestinal vascularization observed in CXCR4 knock-out mice8 and the capacity of cultured ECs to express CXCR4 and respond to SDF-125,26 suggest a role for the autocrine secretion of SDF-1 in the homeostasis of vascular endothelium. Whether this function is mediated by SDF signaling on ECs or by other cell populations activated by the chemokine is not known.
The production of SDF-1 by ECs or DCs raises questions on the autocrine responsiveness of these cells to SDF-1 in vivo. It is possible that in vivo, the autocrine constitutive secretion of the chemokine leads to down-regulation and desensitization of CXCR4 in both cell types. Thus a function of SDF-1 secreted by these cell types might be to induce haptotactical attraction of CXCR4+ leukocytes and participate in the regulation of their trafficking from blood to tissues. In keeping with this assumption, it should be noted that SDF-1 has the highest capacity described among chemokines to promote the attraction and arrest of circulating T lymphocytes on the luminal side of vascular endothelium.27 Moreover, tissue extravasation of circulating blood CD4 lymphocytes in transgenic mice with enforced CXCR4 expression in this T-cell subpopulation has been reported.28 Furthermore, when injected into nontransgenic animals, transgenic CD4 lymphocytes overexpressing CXCR4 rapidly leave the blood. This phenomenon is pertussis-toxin-sensitive, which indicates that, like SDF-1-mediated activation, it depends on heterotrimeric G protein-mediated cell signaling.28 It is conceivable that the disappearance of transgenic CXCR4+ T lymphocytes from blood could be due to interaction of the overexpressed receptor with SDF-1 produced by ECs.
Continuous exposure of circulating human blood T lymphocytes to SDF-1 may be related to the reduced cell surface expression of CXCR4 observed in these cells.29,30 Interestingly, with isolation and short incubation in vitro, human blood T lymphocytes, which do not express the SDF-1 gene, redistribute CXCR4 to the cell membrane from preexisting intracellular pools of the protein.29 Binding to CXCR4 of either soluble15,16 or EC membrane-bound SDF-1 could be responsible for the reversible cell surface down-regulation of CXCR4 in peripheral T lymphocytes.
We have recently shown that both SDF-1
and ß bind in a
CXCR4-independent manner to cell membrane heparan sulfates (HS),
including those of EC lines. Interaction of SDF-1 with HS is mediated
by a cluster of basic amino acids (Lys24
His25
Lys26) located in the first ß-strand of the
chemokine.31
Interestingly, while associated with EC
heparan sulfates, the amino-terminal domain of SDF-1, which is
recognized by the mAb K15C and is required for binding to and
activation of CXCR4, remains exposed and free for interaction with the
receptor. Together, these findings suggest that in vivo, the
functional form of the chemokine secreted by ECs might be a
proteoglycan-immobilized SDF-1 expressed on the EC luminal side of
sinusoid endothelia.
Although the constitutive expression of SDF-1 by endothelium and skin DCs does not support a primary proinflammatory chemoattractant function for this factor, the specific pattern of SDF-1 expression observed in the skin from autoimmune inflammatory diseases makes it possible to envisage its participation in these pathological phenomena. Whereas no SDF-1 mRNA or protein was observed in normal dermal fibroblasts, fibroblasts close to or within dermal inflammatory infiltrates strongly express SDF-1. Fibroblasts have been found to express many other chemokines in response to a variety of proinflammatory stimuli and may therefore represent a source of chemoattractants in connective tissue before infiltration by nonresident cells occurs.32 A recent report shows that the SDF-1 gene is induced in serum-activated fibroblasts.33 In keeping with these findings, we detect SDF-1 mRNA in human fibroblasts cultured with serum. It can be speculated that the expression of SDF-1 observed in dermal fibroblasts from autoimmune inflammatory disorders is related to the pathological activation status of these cells. In addition to fibroblasts, infiltrating mononuclear cells of monocyte-macrophage morphology also express SDF-1. Because peripheral blood leukocytes do not express SDF-1 constitutively,3 the expression of SDF-1 by mononuclear cells in inflammatory infiltrates is probably induced and deserves further analysis. Overall, these findings open the possibility that SDF-1 produced by fibroblasts and the accompanying mononuclear cells takes part in the pathogenesis of autoimmune inflammatory skin diseases.
In normal skin, DCs express SDF-1 mRNA and protein. DCs are a well-defined system of immune surveillance in many tissues. Expression of SDF-1 by DCs may be a mechanism for attracting naive T lymphocytes, which typically express CXCR4 receptor,34,35 into close contact with these antigen-presenting cells.36 Tissular extravasation of circulating naive T lymphocytes to be attracted by resident DCs could be ensured under physiological circumstances by SDF-1 constitutively produced by ECs.
Besides these physiological functions, the expression of CXCR4 in DCs and their autocrine secretion of SDF-1 could provide some clues to the preferential transmission of R5 and delayed propagation of X4 HIV isolates in infected individuals.17 Cells from DC lineage are thought to support the primary infection and replication of SIV in exposed mucosas,37 which appears to be a preferential site for early virus replication38 and CD4 T lymphocyte depletion,39,40 even when the viruses are inoculated intravenously.39 By using Langerhans cells from skin, which are immature DCs resembling resident DCs of intestinal and genital mucosa, it has been shown that this type of cell is not susceptible to infection by X4 HIV isolates, although it permits replication of R5 HIV viruses.19,41 Infection of DCs by X4 viruses strikingly and directly correlates with their CXCR4 cell surface expression. Interestingly, it has been shown that CXCR4 expression in resident skin DCs is preferentially intracellular.19 Given the production of SDF-1 by DCs, it is conceivable that the occupancy and the consecutive cell surface down-regulation of CXCR4 induced by the autocrine secretion of the chemokine may account for the reduced cell surface expression and intracellular accumulation of CXCR4. Thus SDF-1-down-regulated expression of CXCR4 in DCs may explain the refractory environment that they offer to X4 HIV strains. In addition, secretion of SDF-1 could also selectively interfere with transmission of X4 HIV viruses to DC-neighboring CD4 T lymphocytes, thus limiting their propagation. Our unpublished observations demonstrate that SDF-1 expression extends to DCs of lymph nodes, suggesting that this can be a general feature of DCs. It will be very important to determine whether SDF-1 production by DCs in lymphoid tissues has the capacity to interfere with X4 propagation within these organs.
In conclusion, this study provides new data on the identification of cells expressing the SDF-1 gene and producing SDF-1 protein. Our findings shed light on the physiological functions proposed for the SDF-1/CXCR4 system and make it possible to envisage its participation in pathological processes associated with inflammatory disorders or HIV infection. Further characterization of SDF-1 tissue expression and identification of cell types producing the chemokine will be critical to understanding the role played by the SDF-1/CXCR4 system in both physiological and pathological situations during postnatal life.
| Acknowledgements |
|---|
| Footnotes |
|---|
Supported by grants from the Ministerio de Educacion y Cultura (PM 96/0028) and Fondo de Investigaciones Sanitarias (FIS 98/0356), Spain, and from SIDACTION and ANRS, France. A. Caruz and A. Amara are supported by fellowships from ANRS, France.
Accepted for publication July 1, 1999.
| References |
|---|
|
|
|---|
-dependent internalization of the chemokine receptor CXCR4 contributes to inhibition of HIV replication. J Exp Med 1997, 186:139-146
associates with heparan sulfates through the first ß-strand of the chemokine. J Biol Chem 1999, 274:23916-23925This article has been cited by other articles:
![]() |
S. M. Kerfoot, G. Andonegui, C. S. Bonder, and L. Liu Exogenous stromal cell-derived factor-1 induces modest leukocyte recruitment in vivo Am J Physiol Heart Circ Physiol, June 1, 2008; 294(6): H2524 - H2534. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hasegawa, D. S. McLeod, T. Prow, C. Merges, R. Grebe, and G. A. Lutty Vascular Precursors in Developing Human Retina Invest. Ophthalmol. Vis. Sci., May 1, 2008; 49(5): 2178 - 2192. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Madge, M. S. Kluger, J. S. Orange, and M. J. May Lymphotoxin-{alpha}1{beta}2 and LIGHT Induce Classical and Noncanonical NF-{kappa}B-Dependent Proinflammatory Gene Expression in Vascular Endothelial Cells J. Immunol., March 1, 2008; 180(5): 3467 - 3477. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-Y. Chang, H.-R. Cha, S. Uematsu, S. Akira, O. Igarashi, H. Kiyono, and M.-N. Kweon Colonic Patches Direct the Cross-Talk Between Systemic Compartments and Large Intestine Independently of Innate Immunity J. Immunol., February 1, 2008; 180(3): 1609 - 1618. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Yang, L. K. Pham, C.-P. Liao, B. Frenkel, A. H. Reddi, and P. Roy-Burman A Novel Bone Morphogenetic Protein Signaling in Heterotypic Cell Interactions in Prostate Cancer Cancer Res., January 1, 2008; 68(1): 198 - 205. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kabashima, N. Shiraishi, K. Sugita, T. Mori, A. Onoue, M. Kobayashi, J.-i. Sakabe, R. Yoshiki, H. Tamamura, N. Fujii, et al. CXCL12-CXCR4 Engagement Is Required for Migration of Cutaneous Dendritic Cells Am. J. Pathol., October 1, 2007; 171(4): 1249 - 1257. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D Canete, B. Santiago, T. Cantaert, R. Sanmarti, A. Palacin, R. Celis, E. Graell, B. Gil-Torregrosa, D. Baeten, and J. L Pablos Ectopic lymphoid neogenesis in psoriatic arthritis Ann Rheum Dis, June 1, 2007; 66(6): 720 - 726. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Asperti-Boursin, E. Real, G. Bismuth, A. Trautmann, and E. Donnadieu CCR7 ligands control basal T cell motility within lymph node slices in a phosphoinositide 3-kinase- independent manner J. Exp. Med., May 14, 2007; 204(5): 1167 - 1179. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Li, S. Basu, M.-K. Han, Y.-J. Kim, and H. E. Broxmeyer Influence of ERK activation on decreased chemotaxis of mature human cord blood monocyte-derived dendritic cells to CCL19 and CXCL12 Blood, April 15, 2007; 109(8): 3173 - 3176. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bogunovic, F. Ginhoux, A. Wagers, M. Loubeau, L. M. Isola, L. Lubrano, V. Najfeld, R. G. Phelps, C. Grosskreutz, E. Scigliano, et al. Identification of a radio-resistant and cycling dermal dendritic cell population in mice and men J. Exp. Med., November 27, 2006; 203(12): 2627 - 2638. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Salvucci, M. de la Luz Sierra, J. A. Martina, P. J. McCormick, and G. Tosato EphB2 and EphB4 receptors forward signaling promotes SDF-1-induced endothelial cell chemotaxis and branching remodeling Blood, November 1, 2006; 108(9): 2914 - 2922. [Abstract] [Full Text] [PDF] |
||||
![]() |
L Banaei-Bouchareb, M Peuchmaur, P Czernichow, and M Polak A transient microenvironment loaded mainly with macrophages in the early developing human pancreas. J. Endocrinol., March 1, 2006; 188(3): 467 - 480. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Narducci, E. Scala, A. Bresin, E. Caprini, M. C. Picchio, D. Remotti, G. Ragone, F. Nasorri, M. Frontani, D. Arcelli, et al. Skin homing of Sezary cells involves SDF-1-CXCR4 signaling and down-regulation of CD26/dipeptidylpeptidase IV Blood, February 1, 2006; 107(3): 1108 - 1115. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Krumbholz, D. Theil, S. Cepok, B. Hemmer, P. Kivisakk, R. M. Ransohoff, M. Hofbauer, C. Farina, T. Derfuss, C. Hartle, et al. Chemokines in multiple sclerosis: CXCL12 and CXCL13 up-regulation is differentially linked to CNS immune cell recruitment Brain, January 1, 2006; 129(1): 200 - 211. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Urosevic, R. Dummer, C. Conrad, M. Beyeler, E. Laine, G. Burg, and M. Gilliet Disease-Independent Skin Recruitment and Activation of Plasmacytoid Predendritic Cells Following Imiquimod Treatment J Natl Cancer Inst, August 3, 2005; 97(15): 1143 - 1153. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Dalakas, P. N. Newsome, D. J. Harrison, and J. N. Plevris Hematopoietic stem cell trafficking in liver injury FASEB J, August 1, 2005; 19(10): 1225 - 1231. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Florin, N. Maas-Szabowski, S. Werner, A. Szabowski, and P. Angel Increased keratinocyte proliferation by JUN-dependent expression of PTN and SDF-1 in fibroblasts J. Cell Sci., May 1, 2005; 118(9): 1981 - 1989. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Balabanian, B. Lagane, J. L. Pablos, L. Laurent, T. Planchenault, O. Verola, C. Lebbe, D. Kerob, A. Dupuy, O. Hermine, et al. WHIM syndromes with different genetic anomalies are accounted for by impaired CXCR4 desensitization to CXCL12 Blood, March 15, 2005; 105(6): 2449 - 2457. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Mori, J. Kim, T. Yamano, H. Takeuchi, S. Huang, N. Umetani, K. Koyanagi, and D. S.B. Hoon Epigenetic Up-regulation of C-C Chemokine Receptor 7 and C-X-C Chemokine Receptor 4 Expression in Melanoma Cells Cancer Res., March 1, 2005; 65(5): 1800 - 1807. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Weidt, B. Niggemann, W. Hatzmann, K. S. Zanker, and T. Dittmar Differential Effects of Culture Conditions on the Migration Pattern of Stromal Cell-Derived Factor-Stimulated Hematopoietic Stem Cells Stem Cells, November 1, 2004; 22(6): 890 - 896. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Sadir, A. Imberty, F. Baleux, and H. Lortat-Jacob Heparan Sulfate/Heparin Oligosaccharides Protect Stromal Cell-derived Factor-1 (SDF-1)/CXCL12 against Proteolysis Induced by CD26/Dipeptidyl Peptidase IV J. Biol. Chem., October 15, 2004; 279(42): 43854 - 43860. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. G. Coleman Jr, R. K. Polanowska-Grabowska, M. Marcinkiewicz, and A. R. L. Gear LDL oxidized by hypochlorous acid causes irreversible platelet aggregation when combined with low levels of ADP, thrombin, epinephrine, or macrophage-derived chemokine (CCL22) Blood, July 15, 2004; 104(2): 380 - 389. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Hecht, R. Hershkoviz, S. Shivtiel, T. Lapidot, I. R. Cohen, O. Lider, and L. Cahalon Heparin-disaccharide affects T cells: inhibition of NF-{kappa}B activation, cell migration, and modulation of intracellular signaling J. Leukoc. Biol., June 1, 2004; 75(6): 1139 - 1146. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Heidemann, H. Ogawa, P. Rafiee, N. Lugering, C. Maaser, W. Domschke, D. G. Binion, and M. B. Dwinell Mucosal angiogenesis regulation by CXCR4 and its ligand CXCL12 expressed by human intestinal microvascular endothelial cells Am J Physiol Gastrointest Liver Physiol, June 1, 2004; 286(6): G1059 - G1068. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Schaerli, L. Ebert, K. Willimann, A. Blaser, R. S. Roos, P. Loetscher, and B. Moser A Skin-selective Homing Mechanism for Human Immune Surveillance T Cells J. Exp. Med., May 3, 2004; 199(9): 1265 - 1275. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Bartolome, B. G. Galvez, N. Longo, F. Baleux, G. N. P. van Muijen, P. Sanchez-Mateos, A. G. Arroyo, and J. Teixido Stromal Cell-Derived Factor-1{alpha} Promotes Melanoma Cell Invasion across Basement Membranes Involving Stimulation of Membrane-Type 1 Matrix Metalloproteinase and Rho GTPase Activities Cancer Res., April 1, 2004; 64(7): 2534 - 2543. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hamon, E. Mbemba, N. Charnaux, H. Slimani, S. Brule, L. Saffar, R. Vassy, C. Prost, N. Lievre, A. Starzec, et al. A syndecan-4/CXCR4 complex expressed on human primary lymphocytes and macrophages and HeLa cell line binds the CXC chemokine stromal cell-derived factor-1 (SDF-1) Glycobiology, April 1, 2004; 14(4): 311 - 323. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. De La Luz Sierra, F. Yang, M. Narazaki, O. Salvucci, D. Davis, R. Yarchoan, H. H. Zhang, H. Fales, and G. Tosato Differential processing of stromal-derived factor-1{alpha} and stromal-derived factor-1{beta} explains functional diversity Blood, April 1, 2004; 103(7): 2452 - 2459. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Yao, O. Salvucci, A. R. Cardones, S. T. Hwang, Y. Aoki, M. De La Luz Sierra, A. Sajewicz, S. Pittaluga, R. Yarchoan, and G. Tosato Selective expression of stromal-derived factor-1 in the capillary vascular endothelium plays a role in Kaposi sarcoma pathogenesis Blood, December 1, 2003; 102(12): 3900 - 3905. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Villalba, O. Salvucci, Y. Aoki, M. D. L. L. Sierra, G. Gupta, D. Davis, K. Wyvill, R. Little, R. Yarchoan, and G. Tosato Serum inactivation contributes to the failure of stromal-derived factor-1 to block HIV-I infection in vivo J. Leukoc. Biol., November 1, 2003; 74(5): 880 - 888. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Vanbervliet, N. Bendriss-Vermare, C. Massacrier, B. Homey, O. de Bouteiller, F. Briere, G. Trinchieri, and C. Caux The Inducible CXCR3 Ligands Control Plasmacytoid Dendritic Cell Responsiveness to the Constitutive Chemokine Stromal Cell-derived Factor 1 (SDF-1)/CXCL12 J. Exp. Med., September 2, 2003; 198(5): 823 - 830. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. WERNER and R. GROSE Regulation of Wound Healing by Growth Factors and Cytokines Physiol Rev, July 1, 2003; 83(3): 835 - 870. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hoshino, N. Aoike, M. Takahashi, Y. Nakamura, and T. Nakagawa Increased immunoreactivity of stromal cell-derived factor-1 and angiogenesis in asthma Eur. Respir. J., May 1, 2003; 21(5): 804 - 809. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. de la Rosa, N. Longo, J. L. Rodriguez-Fernandez, A. Puig-Kroger, A. Pineda, A. L. Corbi, and P. Sanchez-Mateos Migration of human blood dendritic cells across endothelial cell monolayers: adhesion molecules and chemokines involved in subset-specific transmigration J. Leukoc. Biol., May 1, 2003; 73(5): 639 - 649. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Pablos, B. Santiago, M. Galindo, C. Torres, M. T. Brehmer, F. J. Blanco, and F. J. Garcia-Lazaro Synoviocyte-Derived CXCL12 Is Displayed on Endothelium and Induces Angiogenesis in Rheumatoid Arthritis J. Immunol., February 15, 2003; 170(4): 2147 - 2152. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Krug, R. Uppaluri, F. Facchetti, B. G. Dorner, K. C. F. Sheehan, R. D. Schreiber, M. Cella, and M. Colonna Cutting Edge: IFN-Producing Cells Respond to CXCR3 Ligands in the Presence of CXCL12 and Secrete Inflammatory Chemokines upon Activation J. Immunol., December 1, 2002; 169(11): 6079 - 6083. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Stumm, J. Rummel, V. Junker, C. Culmsee, M. Pfeiffer, J. Krieglstein, V. Hollt, and S. Schulz A Dual Role for the SDF-1/CXCR4 Chemokine Receptor System in Adult Brain: Isoform-Selective Regulation of SDF-1 Expression Modulates CXCR4-Dependent Neuronal Plasticity and Cerebral Leukocyte Recruitment after Focal Ischemia J. Neurosci., July 15, 2002; 22(14): 5865 - 5878. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Okada, V. N. Ngo, E. H. Ekland, R. Forster, M. Lipp, D. R. Littman, and J. G. Cyster Chemokine Requirements for B Cell Entry to Lymph Nodes and Peyer's Patches J. Exp. Med., July 1, 2002; 196(1): 65 - 75. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Luther, A. Bidgol, D. C. Hargreaves, A. Schmidt, Y. Xu, J. Paniyadi, M. Matloubian, and J. G. Cyster Differing Activities of Homeostatic Chemokines CCL19, CCL21, and CXCL12 in Lymphocyte and Dendritic Cell Recruitment and Lymphoid Neogenesis J. Immunol., July 1, 2002; 169(1): 424 - 433. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Valenzuela-Fernandez, T. Planchenault, F. Baleux, I. Staropoli, K. Le-Barillec, D. Leduc, T. Delaunay, F. Lazarini, J.-L. Virelizier, M. Chignard, et al. Leukocyte Elastase Negatively Regulates Stromal Cell-derived Factor-1 (SDF-1)/CXCR4 Binding and Functions by Amino-terminal Processing of SDF-1 and CXCR4 J. Biol. Chem., May 3, 2002; 277(18): 15677 - 15689. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Blades, A. Manzo, F. Ingegnoli, P. R. Taylor, G. S. Panayi, H. Irjala, S. Jalkanen, D. O. Haskard, M. Perretti, and C. Pitzalis Stromal Cell-Derived Factor 1 (CXCL12) Induces Human Cell Migration into Human Lymph Nodes Transplanted into SCID Mice J. Immunol., May 1, 2002; 168(9): 4308 - 4317. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Salvucci, L. Yao, S. Villalba, A. Sajewicz, S. Pittaluga, and G. Tosato Regulation of endothelial cell branching morphogenesis by endogenous chemokine stromal-derived factor-1 Blood, April 15, 2002; 99(8): 2703 - 2711. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Dubois-Laforgue, H. Hendel, S. Caillat-Zucman, J.-F. Zagury, C. Winkler, C. Boitard, and J. Timsit A Common Stromal Cell-Derived Factor-1 Chemokine Gene Variant is Associated With the Early Onset of Type 1 Diabetes Diabetes, May 1, 2001; 50(5): 1211 - 1213. [Abstract] [Full Text] |
||||
![]() |
R. Gillitzer and M. Goebeler Chemokines in cutaneous wound healing J. Leukoc. Biol., April 1, 2001; 69(4): 513 - 521. [Abstract] [Full Text] |
||||
![]() |
Y. Bakri, C. Schiffer, V. Zennou, P. Charneau, E. Kahn, A. Benjouad, J. C. Gluckman, and B. Canque The Maturation of Dendritic Cells Results in Postintegration Inhibition of HIV-1 Replication J. Immunol., March 15, 2001; 166(6): 3780 - 3788. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. L. Gear, S. Suttitanamongkol, D. Viisoreanu, R. K. Polanowska-Grabowska, S. Raha, and D. Camerini Adenosine diphosphate strongly potentiates the ability of the chemokines MDC, TARC, and SDF-1 to stimulate platelet function Blood, February 15, 2001; 97(4): 937 - 945. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Dejucq, G. Simmons, and P. R. Clapham T-cell line adaptation of human immunodeficiency virus type 1 strain SF162: effects on envelope, vpu and macrophage-tropism J. Gen. Virol., December 1, 2000; 81(12): 2899 - 2904. [Abstract] [Full Text] |
||||
![]() |
J. A. Burger, N. Tsukada, M. Burger, N. J. Zvaifler, M. Dell'Aquila, and T. J. Kipps Blood-derived nurse-like cells protect chronic lymphocytic leukemia B cells from spontaneous apoptosis through stromal cell-derived factor-1 Blood, October 15, 2000; 96(8): 2655 - 2663. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Buckley, N. Amft, P. F. Bradfield, D. Pilling, E. Ross, F. Arenzana-Seisdedos, A. Amara, S. J. Curnow, J. M. Lord, D. Scheel-Toellner, et al. Persistent Induction of the Chemokine Receptor CXCR4 by TGF-{beta}1 on Synovial T Cells Contributes to Their Accumulation Within the Rheumatoid Synovium J. Immunol., September 15, 2000; 165(6): 3423 - 3429. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Hirose, H. Kawashima, O. Yoshie, K. Tashiro, and M. Miyasaka Versican Interacts with Chemokines and Modulates Cellular Responses J. Biol. Chem., February 9, 2001; 276(7): 5228 - 5234. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Sadir, F. Baleux, A. Grosdidier, A. Imberty, and H. Lortat-Jacob Characterization of the Stromal Cell-derived Factor-1alpha -Heparin Complex J. Biol. Chem., March 9, 2001; 276(11): 8288 - 8296. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Valenzuela-Fernandez, T. Palanche, A. Amara, A. Magerus, R. Altmeyer, T. Delaunay, J.-L. Virelizier, F. Baleux, J.-L. Galzi, and F. Arenzana-Seisdedos Optimal Inhibition of X4 HIV Isolates by the CXC Chemokine Stromal Cell-derived Factor 1alpha Requires Interaction with Cell Surface Heparan Sulfate Proteoglycans J. Biol. Chem., July 6, 2001; 276(28): 26550 - 26558. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |