| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |

From the Department of Pathology,*
University of
Washington, Seattle, Washington; and the Department of
Biology,
Shizuoka University, Shizuoka, Japan
| Abstract |
|---|
|
|
|---|
B (NF-
B)-transactivating
gene RelA (p65) die at embryonic days
1415 with massive liver apoptosis. In the adult liver,
activation of the NF-
B heterodimer RelA/p50 can cause hepatocyte
proliferation, apoptosis, or the induction of
acute-phase response genes. We examined, during wild-type fetal
liver development, the expression of the Rel family member
proteins, as well as other proteins known to be important for
NF-
B activation. We found these proteins and active NF-
B
complexes in the developing liver from at least 2 days before the onset
of lethality observed in RelA knockouts. This suggests
that the timing of NF-
B activation is not related to the timing of
lethality. We therefore hypothesized that, in the absence of
RelA, embryos were sensitized to tumor necrosis
factor (TNF) receptor 1 (TNFR-1)-mediated apoptosis.
Thus, we generated mice that were deficient in both
RelA and TNFR-1 to determine whether
apoptotic signaling through TNFR-1 was responsible for the lethal
phenotype. RelA/TNFR-1 double knockout mice survived
embryonic development and were born with normal livers without evidence
of increased hepatocyte apoptosis. These animals became runted
shortly after birth and survived an average of 10 days, dying
from acute hepatitis with an extensive hepatic infiltration of immature
neutrophils. We conclude that neither RelA nor
TNFR-1 is required for liver development and that RelA
protects the embryonic liver from TNFR-1-mediated apoptotic signals.
However, the absence of both TNFR-1 signaling and RelA activity
in newborn mice makes these animals susceptible to endogenous hepatic
infection.
| Introduction |
|---|
|
|
|---|
B transcription factor modulates gene
expression in many cellular responses, including inflammation,
apoptosis, and liver regeneration.1-3
The NF-
B
transactivating subunit, RelA (p65), plays a critical role in mouse
liver development because RelA-/- mice
die during mid-gestation from massive hepatocyte
apoptosis.4,5
Whereas much work has been done establishing
the roles of NF-
B/Rel proteins in adult tissues, (for recent review,
see6
), little is known about their functions in the
developing animal. Except for RelA-/-
mice, other Rel knockouts have not demonstrated critical roles for Rel
proteins during development.7-9
Schmidt-Ullrich et al
generated transgenic mice expressing a NF-
B-driven LacZ reporter
gene construct to provide information on the timing and cellular
location of NF-
B activation during murine development. NF-
B
activity was detected late in
development, with no evidence of LacZ-positive cells until E12.5.
Furthermore, NF-
B transactivation was predominantly noted within the
developing brain, spinal medulla, and thymus of their transgenic lines.
Only one of their transgenic lines showed any expression in the fetal
liver, starting at E13.10
Thus, the finding by Beg et al
that RelA-/- embryos die of massive liver
apoptosis is particularly intriguing because of the lack of
demonstration of NF-
B activation during mouse liver development.
The tumor necrosis factor (TNF) rapidly and potently activates NF-
B
in a variety of cell types, including adult hepatocytes. TNF mediates
its cellular responses by signaling through two receptors, TNFR-1 and
TNFR-2, but most of its biological functions are signaled through
TNFR-1.11,12
TNFR-1 is a death domain-containing receptor
that, on ligand binding and trimerization, recruits the adapter protein
TRADD. The signals elicited in response to TNF bifurcate at the level
of TRADD binding. The overexpression of TRADD stimulates both
apoptosis and NF-
B activation through differential binding
domains.13
The C-terminal portion of TRADD binds the death
domain-containing protein FADD, resulting in apoptosis.14
The N-terminal portion of TRADD binds the TNF receptor-associated
factor 2 (TRAF-2), and other more recently identified proteins such as
RIP, ultimately resulting in the activation of
NF-
B.15,16
NF-
B activation is initiated by its release from the cytoplasmic
inhibitory proteins I
B
or I
Bß.17
Two I
B
kinases, IKK-1 and IKK-2, which are responsible for phosphorylating
I
B proteins, are components of a large multisubunit
complex.18,19
Phosphorylation of I
B leads to its
ubiquitination and subsequent degradation by the proteasome, resulting
in nuclear translocation of NF-
B.20,21
Recent work has
shown that IKK-2 knockouts die during development of liver
degeneration and apoptosis, similar to RelA
knockouts.22,23
This suggests that IKK-2 is directly
responsible for activating NF-
B in the developing liver.
Work from this and other laboratories demonstrated that TNF is required
for the initiation of liver regeneration in mice, and that its
proliferative effect on hepatocytes is strictly dependent on signaling
through TNFR-1.3,24
Mice lacking TNFR-1 have high
mortality during the early stages of liver regeneration and the
surviving animals have a deficit in DNA replication.
TNFR-1-/- mice fail to activate the
transcription factors NF-
B and STAT3 at the start of liver
regeneration. However, DNA synthesis can be restored in these animals
by interleukin 6 (IL-6) injection, which also restores STAT3 but not
NF-
B activation.3
These and other
experiments25,26
show that, on one hand, TNF, signaling
through TNFR-1 and downstream activation of NF-
B, IL-6, and STAT3,
is an important proliferative agent for hepatocytes. On the
other hand, direct blockage of NF-
B activation, both
in vivo and in hepatocyte cultures, switches the biological
effect of TNF from proliferative to apoptotic.27-30
If,
as in liver regeneration, TNFR-1-/- mice
fail to activate NF-
B during liver development, it is surprising
that these mice develop normally and show no obvious signs of hepatic
apoptosis.
To examine whether TNFR-1-mediated signaling is responsible for the
lethal phenotype of RelA knockouts, we generated mice
deficient in both RelA and TNFR-1. We show that
double-knockout mice survive embryonic development and that gestation
in these animals is apparently unaffected because newborn mice have
normal liver morphology with little detectable apoptosis. Thus,
RelA-/- mice die from apoptotic signals
mediated through TNFR-1 during liver development. RelA and p50, the
components necessary for NF-
B activation, are present during fetal
liver development in wild-type (WT) mice from at least E12, suggesting
that the timing of NF-
B activation is not related to the timing of
embryonic lethality in RelA-/- mice.
Survival of the RelA/TNFR-1 double knockouts suggests that
neither RelA nor TNFR-1 is critical for hepatic
development in mice. However, newborn animals with these deficiencies
become sensitive to infection and the neutrophilic invasion that cause
damage to the liver and other organs, resulting in early postnatal
mortality.
| Materials and Methods |
|---|
|
|
|---|
The C57BL/6J (WT) mice were obtained from Jackson Laboratories (Bar Harbor, ME).The RelA heterozygous breeder mice were obtained from Amer Beg (Columbia University, New York, NY), and the TNFR-1 knockout mice have been previously described.3 To obtain fetal samples, timed matings were performed, and the presence of a vaginal plug the following morning was considered embryonic day 0 (E0). To generate mice deficient in both RelA and TNFR-1, RelA+/- females were crossed with TNFR-1-/- males producing double heterozygous RelA+/-/TNFR-1+/- offspring that were subsequently back crossed. The breeding cages from RelA+/-/TNFR-1+/- matings were examined daily, and the first day that pups were found in the cage was considered day 1 of postnatal life. The number of pups born to each female was recorded, and, within 24 hours, a small piece of tail was removed from each newborn for DNA analysis.
Animals were maintained in a specific pathogen-free facility under 12-hour dark/light cycles and given standard diet and water ad libitum. All animal work was in accordance with policies at the University of Washington.
Isolation of Murine Liver Samples
For isolation of fetal livers, pregnant mice were sacrificed between E12 and E19. Fetuses were dissected free of extra embryonic membranes and decidual tissue and placed in phosphate-buffered saline; livers were carefully removed under a dissecting microscope at 30x. For the isolation of neonatal livers, newborn pups were killed at 2, 4, 7, and 16 days of age, and livers were carefully dissected from the animal.
Polymerase Chain Reaction (PCR) Genotyping
For fetal samples, a portion of the brain was isolated from each sample. For newborns, a small piece of tail was removed. All samples were digested in GNTK buffer, (50 mmol/L KCl, 1.5 mmol/L MgCl2, 10 mmol/L Tris-HCl, pH 8.5, 0.01% gelatin, 0.45% Nonidet P-40, 0.45% Tween-20) supplemented with 100 µg/ml proteinase K at 55°C. Proteinase K was heat inactivated, and 13 µl of the extract was used in PCR. For RelA PCR, a three-primer reaction amplified a 120-bp fragment of the WT allele and a 160-bp fragment of the RelA mutant allele. For TNFR-1, a four-primer PCR reaction amplified a 120-bp fragment of the WT allele and a 155-bp fragment of the mutant allele. The PCR products were run on 2% agarose (SeaKem, FMC BioProducts, Rockland, ME) gels and visualized with a UVP gel documentation system (Upland, CA).
Protein Extractions
Whole-cell extracts from the fetal livers were isolated by resuspension in a tissue lysis buffer (20 mmol/L 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), pH 7.5, 2 mmol/L ethylene glycol bis(ß-aminoethyl ether)-N,N,N',N'-tetraacetic acid (EGTA), 10% glycerol, 1% Tween-20, 1 mmol/L dithiothreitol, 0.5 mmol/L phenylmethyl sulfonyl fluoride, 0.5 mmol/L benzamidine-HCl, 10 µg/ml aprotinin, 10 µg/ml leupeptin, 10 µg/ml pepstatin A) and incubated on ice for 30 minutes. Extracts were cleared by centrifugation at 4°C at 16,000 x g for 15 minutes and stored at -80°C. Whole-cell extracts from the newborn-liver samples were homogenized in a glass homogenizer in 0.51 ml of the tissue lysis buffer before incubation on ice and centrifugation.
Nuclear extracts from the fetal liver were isolated in a manner similar to the methods described by Han and Brasier.31 All buffers were supplemented with the following protease inhibitors before use: 240 µg/ml antipain, 2 µg/ml aprotinin, 0.01 mol/L benzamidine-HCl, 0.2 mmol/L dithiothreitol, 10 µg/ml leupeptin, 10 µg/ml pepstatin A, 0.5 mmol/L phenylmethyl sulfonyl fluoride, 0.15 µmol/L spermine, 0.5 µmol/L spermidine. In a brief description of the procedure, livers were resuspended in Buffer A (50 mmol/L HEPES, pH 7.4, 10 mmol/L KCl, 1 mmol/L ethylenediaminetetraacetic acid (EDTA), 1 mmol/L EGTA, 0.5% Nonidet P-40) and kept on ice for at least 10 minutes. The samples were cleared by centrifugation at 4°C at 4000 x g for 5 minutes. Pellets were resuspended in 200500 µl of buffer B (1.7 mol/L sucrose, 50 mmol/L HEPES, pH 7.4, 10 mmol/L KCl, 1 mmol/L EDTA, 1 mmol/L EGTA) and centrifuged at 4°C at 16,000 x g for 30 minutes. Pellets were resuspended in buffer C (10% glycerol, 50 mmol/L HEPES, pH 7.4, 400 mmol/L KCl, 1 mmol/L EDTA, 1 mmol/L EGTA), incubated on ice for 30 minutes with frequent vortexing, and centrifuged at 4°C at 16,000 x g for 5 minutes. Extracts were stored at -80°C.
Nuclear extracts from newborn livers were isolated as previously described.3
Western Blot
Protein was quantitated by the Bradford method (Bio-Rad, Hercules,
CA) and 25 µg of protein per lane was resolved on a 10% sodium
dodecyl sulfate-polyacrylamide gel. The gels were transferred to
nitrocellulose membranes (Amersham, Piscataway, NJ) and blocked
overnight at 4°C in Tris-buffered saline containing 0.1%
Tween-20 and 5% nonfat milk. Antibodies were obtained from Santa Cruz
Biotechnologies, Inc. (Santa Cruz, CA). RelA (#SC-372-G), I
B
(#SC-371), and I
Bß (#SC-945) were used at 1:2000 dilutions and
TRAF-2 (#SC-876) was used at 1:1000 dilution. The membranes were
incubated for one hour at room temperature, washed with Tris buffered
saline-T, and bound with the appropriate horseradish
peroxidase-conjugated secondary antibody; blots were washed and,
subsequently, detected by ECL (Amersham).
Electrophoretic Mobility Shift Assay (EMSA)
Four µg of nuclear protein were preincubated at room temperature
for 10 minutes in a binding buffer (20 mmol/L HEPES, pH 7.5, 60 mmol/L
KCl, 5 mmol/L MgCl2, 0.2 mmol/L EDTA, 8%
glycerol, 1 µg poly dI/dC, 1% Nonidet P-40, 0.1 mmol/L
dithiothreitol, 0.1 mmol/L phenylmethyl sulfonyl fluoride). A
[32P]-labeled probe (1 x
105
cpm) was added per reaction, and incubation
was continued for an additional 30 minutes. Double-stranded probes were
obtained from Santa Cruz Biotechnologies, Inc. The NF-
B binding
sequence probe used is 5' AGTTGAGGGGACTTTCCCAGGC 3'. The SIE binding
sequence probe used for Stat3 is 5' GTGCATTTCCCGTAAATCTTGTCTACA 3'.
Reactions were electrophoresed through a 5% polyacrylamide, 1x
Tris-glycine-EDTA gel. For binding specificity, an unlabeled probe was
added to one reaction 30 minutes before the addition of the labeled
probe. For supershifts, after the 30-minute incubation of the labeled
probe, specific antibodies obtained from Santa Cruz Biotechnologies,
Inc. (RelA #SC-372X, p50 #SC-114X, p52 #SC-298X, c-Rel #SC-70X, and
Stat3 #SC-482X) were added to indicated samples for an additional 30
minutes. The gels were dried and exposed to film for the detection of
bands.
Immunohistochemistry
Embryos isolated at each gestational stage were fixed overnight in
10% buffered-formalin (Fisher Scientific, Pittsburgh, PA) and
processed for paraffin embedding. The sections were cut onto glass
slides and processed for immunohistochemistry by using the VECTASTAIN
ABC kit and protocol (Vector Laboratories, Burlingame, CA). Antibodies
were used at 1:100 dilution, and the control reactions were performed
with an antibody prebound to a control peptide (Santa Cruz) before
incubation on the slide (data not shown). The RelA, I
B
and TRAF-2
antibodies were the same as those used in Western blots. TNF- #SC-1348
and TNFR-1 #SC-1069 were also used. Biotinylated secondary antibodies
and VECTASTAIN ABC solution were used at 1:100 dilutions. Antigen
detection was through diaminobenzidine tetrahydrochloride
(Sigma, St. Louis, MO) staining. The slides were counterstained with
hematoxylin (Sigma).
Histology
The samples from newborn pups were fixed overnight in 10% buffered formalin (Fischer Scientific) and processed for paraffin embedding. The sections were cut onto glass slides and processed for routine hematoxylin and eosin staining.
| Results |
|---|
|
|
|---|
RelA-/- mice die within a specific
time period during development (E14E15). Therefore, we first
investigated in WT (C57BL/6J) mice whether the appearance of RelA
during liver development would coincide with the time of lethality
observed in RelA knockouts. Whole cell protein samples were
obtained from fetal livers of WT mice between E12 and E19. The top
panel of Figure 1
demonstrates that RelA
protein was present throughout liver development, from at least E12.
These livers also contained the p50 subunit of NF-
B (data not
shown), indicating that the components of the classic NF-
B
heterodimer were present from a very early stage of liver formation.
|
B is retained in
an inactive complex with an inhibitory I
B protein.17,32
Examination of I
B
and I
Bß proteins in WT fetal livers
demonstrated expression from E12 through E19 (Figure 1
B
, and I
Bß were all expressed in the
fetal liver from the earliest time points analyzed, these data
demonstrate that embryonic lethality in
RelA-/- mice (E14E15) does not
correspond to a critical time when expression of these proteins becomes
necessary in the fetal liver.
Proteins have been identified in the TNF-signaling pathway that are
important for the activation of NF-
B. TRAF-2 is a TNFR-associated
factor downstream of TNFR-1 that is important for NF-
B activation
after TNF stimulation.15
TRAF-2 is recruited to the TNFR-1
signaling pathway by the adapter molecule TRADD.14
Both
TRAF-2 (Figure 1
, bottom panel) and TRADD (data not shown) were
expressed in the E12E19 embryonic liver.
I
B
and I
Bß Protein Levels Are Altered during Fetal Liver
Development of RelA Knockouts but Not
TNFR-1 Knockouts
We next examined whether the expression of RelA, I
B
,
I
Bß, TRAF-2, and TRADD was altered in fetal livers of
RelA or TNFR-1 knockouts. We compared the
expression of these proteins to WT mice at E12E14 (Figure 2)
. As expected, RelA was absent from
RelA knockouts. In addition, the I
B
expression in the
RelA-/- fetal liver was decreased, and
I
Bß was undetectable. In contrast, levels of RelA, I
B
, and
I
Bß in TNFR-1 knockouts were similar to those observed
in WT mice. It should be noted that, in these samples, the level of the
I
Bß expression is lower at E12 when compared with E13 and E14.
These results suggest that, within the developing liver, NF-
B
participates in the regulation of I
B
. On the other hand, there
appears to be a strict dependence of the I
Bß protein on NF-
B
because this protein was not detectable in RelA knockouts.
All of these proteins were normally expressed in
TNFR-1-/- fetal livers, indicating that
TNFR-1 does not mediate the signal for the activation of these genes.
The expression of TRAF-2 (Figure 2
, bottom panel) and TRADD (data not
shown) was similar in WT mice and in RelA and
TNFR-1 knockouts during these days of gestation. The
evidence of TRADD and TRAF-2 proteins in the
RelA-/- fetal liver also illustrates that
not all proteins are aberrantly expressed in the developing liver of
RelA knockouts.
|
B and STAT3 during Development, whereas
RelA-/- Fetal Livers Have Only Active
STAT3
To determine whether the NF-
B proteins detected by Western blot
were capable of binding DNA, indicative of an active protein complex,
we performed EMSA using nuclear protein isolated from WT mice,
TNFR-1 knockout, and RelA knockout fetal livers
between 12 and 14 days gestation. The NF-
B complex formation
occurred in WT (Figure 3A)
and,
surprisingly, also in TNFR-1-/- (Figure 3B)
fetal livers. In these samples, as in adult liver, NF-
B was
composed of RelA/p50 heterodimers (top band) and p50 homodimers (bottom
band). Nuclear protein isolated from E12E14
RelA-/- fetal livers only demonstrated
p50 homodimer formation (Figure 3C)
. This suggests that the lack of
RelA is not compensated for by the formation of other
NF-
B heterodimers. RelA and p50 specificity was determined by
supershift analyses (shown in Figure 3, B and C
). These figures seem to
indicate that, in TNFR-1-/- fetal livers,
the amount of NF-
B binding decreases with age, whereas in WT samples
the inverse is seen. However, this was not a consistent finding when
multiple fetal liver samples were analyzed at these gestational ages.
It is interesting that, during E12E14 of fetal liver development
NF-
B complexes are forming, because in the adult liver there is
little to no basal NF-
B binding. Antibodies against other Rel
proteins, such as c-Rel and p52 (Figure 3B)
, did not cause band shifts
in any samples, indicating that RelA/p50 heterodimers and p50
homodimers were the active forms of NF-
B during fetal liver
development. In the RelA-/- samples, the
entire band was shifted with anti-p50 antibody, indicating that other
Rel proteins were not being used in the absence of RelA. We conclude
from these data that the embryonic lethality in
RelA-/- mice does not coincide with the
timing of NF-
B activation in liver development. The
RelA/p50 double knockouts33
have a similar
phenotype to that of RelA knockouts, but die earlier in
development (E12). Thus, the presence of p50 homodimers might provide
some protection against early lethality. The finding that
TNFR-1 knockouts have active NF-
B during liver
development is unexpected, as these mice fail to activate NF-
B in
the regenerating liver.3
|
B through induction of IL-6. STAT3 EMSA, and supershift
analyses were performed on WT, RelA knockout, and
TNFR-1 knockout fetal livers from E12 through E14. Figure 4, AC
B complex
is not required for STAT3 activation in the embryonic liver. The
TNFR-1 knockouts do not show a STAT3 deficit during liver
development, in contrast to the findings in liver
regeneration.3
|
B Proteins Is Not Altered
during Fetal Liver Development
The fetal liver contains diverse cell types, with hematopoietic
cells, hepatoblasts, and endothelial cells composing the predominant
types in mid-gestation. Whereas the expression of proteins and
transcription factor complex assembly can be analyzed by Western blot
and EMSA, respectively, they do not provide information regarding the
localization of these proteins. To investigate this issue, we performed
immunostaining for RelA, I
B
, TNFR-1, TRAF-2, and TNF-
in the
E13 fetal liver of WT mice and RelA knockouts and the E14
TNFR-1 knockout fetal liver. At E13,
RelA-/- mice have normal liver morphology
similar to that of WT embryos. We found that the staining patterns
observed in the fetal livers of WT mice, RelA knockouts, and
TNFR-1 knockouts were remarkably similar for all the
proteins tested. The results are summarized in Table 1
. In the WT mice and TNFR-1
knockouts, RelA and I
B
proteins were detected mostly in the
cytoplasm of endothelial cells, hepatoblasts, and hematopoietic cells.
Cytoplasmic expression of I
B
was also detected in RelA
knockout fetal livers. In all instances, we saw occasional cells
exhibiting nuclear staining of I
B
. The
RelA-/- samples did have a decreased
intensity of I
B
staining, likely due to diminished protein levels
observed by Western blot (Figure 2)
. Small hematopoietic cells were the
primary sites of the TNFR-1 expression in the fetal livers of both the
WT mice and RelA knockouts. Surprisingly, a minimal amount
of nuclear staining with the TNFR-1 antibody was observed in the
TNFR-1-/- fetal livers, whereas the WT
and RelA-/- samples only demonstrated
cytoplasmic and membrane-localized staining. However, the
TNFR-1-/- mouse is the result of a
functionally mutant TNFR-1 and not a completely absent gene; thus, we
may be detecting a small amount of nonfunctional protein sequestered
within the nucleus. In addition, the WT,
RelA-/-, and
TNFR-1-/- mice all had similar TNF and
TRAF-2 staining patterns. These data show that the liver development of
the RelA-/- and
TNFR-1-/- mice is similar to that of the
WT mice, at least through 13 days of gestation. After this time point,
the RelA-/- mice undergo rapid liver
degeneration and die, whereas the
TNFR-1-/- mice proceed through gestation
in a manner similar to the WT mice. Furthermore, these findings
indicate that TNF and TNFR-1 are expressed during gestation in the
fetal liver before the time of embryonic lethality seen in the
RelA-/- mice.
|
To determine whether signaling through TNFR-1 contributes to the
embryonic lethal phenotype of
RelA-/- fetuses, mice deficient in
both RelA and TNFR-1 were generated as described
in the Materials and Methods section. A total of 115 pups were examined
by PCR and monitored for survival. Only seven of nine theoretically
possible genetic outcomes were obtained in live-born animals. Table 2
summarizes the results of these
crosses. From 115 newborn pups analyzed, 7 (6.1%) had homozygous
mutations in RelA and TNFR-1. Nine newborns
(7.8%) had homozygous WT alleles for both genes, and 33 pups (28.7%)
were double heterozygous. However, only four of the remaining six
genetic possibilities were observed, because newborn mice carrying a
null RelA genotype were never observed unless
TNFR-1 was also absent. Taking these two lethal outcomes
(RelA-/-/TNFR-1+/+
and
RelA-/-/TNFR+/-)
into consideration, all live-born mice, including
RelA-/-/TNFR-1-/-,
were obtained with the expected Mendelian ratios. By monitoring the
pups daily, we observed that at birth all animals appeared healthy and
nursed well. However, within the first postnatal week, double-knockout
mice became runted, failed to thrive despite continuing to nurse, and
subsequently died. Our survival analysis on the first seven
double-knockout pups revealed that the average survival time was 10
days with a range of 6 to 17 days.
|
|
|
I
B
and I
Bß Proteins Are Altered in the Livers of
RelA-/-/TNFR-1-/- Mice
To determine whether rescuing the
RelA-/- lethal phenotype in the
RelA/TNFR-1 knockouts would correct the defects in the
I
B
and I
Bß proteins, Western blot analysis was performed.
Whole-cell proteins were isolated from the livers of the WT,
TNFR-1-/-, and
RelA-/-/TNFR-1-/-
mice at 2, 4, and 7 days of age, respectively (Figure 6)
. Similar to the RelA
knockouts at E12E14, RelA/TNFR-1 double knockouts had
decreased I
B
and no detectable I
Bß in comparison with the WT
mice and the TNFR-1 knockouts. This suggests that a
deficiency of these proteins is not causing the embryonic lethal
phenotype of the RelA knockouts. Nevertheless, it could
still be contributing to postnatal mortality. As expected, RelA
expression was absent in the RelA/TNFR-1 knockouts, whereas
TRAF-2 was unaffected in all of the mice.
|
Up-regulation of TNFR-2 has been shown to result in an inflammatory response.35 Therefore, we examined whether a TNFR-2 message was being up-regulated in the liver of the TNFR-1-/- or RelA-/-/TNFR-1-/- pups during the first week of life. We found that neither animal had up-regulated TNFR-2 messenger RNA compared with the WT mice (data not shown). We also examined whether the double knockouts had increased liver apoptosis that was contributing to their demise. Multiorgan slides of 2-, 4-, 7-, and 16-day-old WT, TNFR-1-/-, and RelA-/-/TNFR-1-/- pups were examined by terminal deoxynucleotidyltransferase-mediated uridine 5'-triphosphate end labeling assay (data not shown). We did not find an increase in incidence of apoptosis at any age, in any organ, including the liver. Therefore, TNF signaling through TNFR-2 does not result in TNFR-2 messenger RNA up-regulation or in an apoptotic phenotype in the newborn RelA-/-/TNFR-1-/- pup.
| Discussion |
|---|
|
|
|---|
B proteins are
synthesized or assembled during liver development. To examine this
possibility, we analyzed the expression of RelA, p50, I
B
, and
I
Bß in WT mice from E12E19. We also examined the formation of
active NF-
B complexes in the livers of WT mice from E12E14. These
analyses revealed that all of the proteins and NF-
B complexes,
consisting of RelA/p50 heterodimers and p50 homodimers, were present in
the liver from at least E12. Because NF-
B complexes are formed in
the developing liver of the WT mice at least 2 days before the onset of
embryonic death in the RelA-/- mice, it
is unlikely that lethality corresponds to the timing of NF-
B
activation during hepatic development. An investigation of fetal livers
from RelA knockouts revealed that they do not form NF-
B
heterodimers, but contain only p50 homodimers. Thus, it appears that,
during liver development, a RelA deficiency is not compensated for by
other Rel family members. However,
RelA-/-/p50-/-
embryos die with a similar phenotype to the
RelA-/- mice, but 2 days earlier in
development.33
It is, therefore, possible that, in the
RelA knockouts, p50 partially compensates for the
lack of RelA before E14.
In comparison with the WT mice, RelA-/-
fetal livers from E12E14 had lower levels of I
B
protein and no
detectable I
Bß protein. This finding is similar to data reported
in RelA-/- embryonic
fibroblasts.4
Here we measured I
B
and I
Bß
directly in the liver and illustrated that I
Bß regulation is
dependent on RelA, whereas I
B
is partially, but not completely,
dependent on RelA. Similar to the WT mice, the
TNFR-1-/- mice had no alterations in
RelA, p50, I
B
, or I
Bß throughout liver development. TRADD
and TRAF-2 proteins were not altered in any of the fetal livers
examined.
TNF is a potent NF-
B activator in the adult liver, and signaling
through TNFR-1 is required for the initiation of liver regeneration.
Although TNF by itself is not generally apoptotic for many cell
types,36
it can cause apoptosis when given in conjunction
with drugs that block transcription and translation.37
Moreover, TNF can cause hepatocyte apoptosis in vivo and
in vitro when NF-
B activation is blocked by an I
B
super-repressor.38,39
Because the TNFR-1
knockouts develop normally, we hypothesized that the elimination of
TNFR-1-mediated apoptotic signals could rescue the RelA
knockouts from embryonic lethality. Therefore, we generated mice that
were deficient in both RelA and TNFR-1 and showed
that these animals survive embryonic development. At birth
RelA-/-/TNFR-1-/-
pups have normal liver morphology, but, after 45 days of age, most
animals become runted and weigh significantly less than the WT mice of
the same age. The double knockouts develop acute hepatitis and die with
an average survival of 10 days. These data suggest that RelA
is not critical for liver development but may serve a vital protective
function against TNFR-1 apoptotic signaling. Additionally, the
RelA-/-/TNFR-1-/-
mice may have limited survival because RelA provides a
critical postnatal function. However, the
RelA-/-/TNFR-1-/-
pups do not die with massive liver apoptosis as seen in the
RelA knockouts. Instead, these animals develop acute
hepatitis and neutrophilic infiltration leading to focal necrosis of
the liver. Given the intense inflammatory infiltrate found in the
livers of the dying mice, it is likely that the lack of TNF signaling
and RelA makes these animals extremely susceptible to endogenous
infectious agents. However, we cannot rule out the possibility that
this phenotype is entirely caused by the absence of RelA in
the newborn. A conditional RelA knockout will be necessary
to examine which affects are due to the RelA deficiency and
which are due to the combined lack of TNFR-1 and
RelA. All animals, including the double knockouts, were
maintained in a specific pathogen-free facility, reducing the
possibility of contamination by external organisms, and were free of
murine hepatitis virus. The phenotype of RelA/TNFR-1
knockouts has similarities to phenotypic abnormalities described in the
RelB knockouts.8
These animals also had
neutrophilic inflammatory infiltrates and extramedullary hemopoiesis in
the liver. It is puzzling that the RelA knockouts die only
with liver abnormalities because RelA is ubiquitously expressed during
normal development. Perhaps RelB or other Rel proteins are compensating
for the loss of RelA in hematopoietic organs, although we found no
evidence of this within the liver.
While this manuscript was being prepared, Doi et al reported that RelA knockouts can be rescued from embryonic lethality by crossing them with TNF-/- mice.40 Similar to our findings, the RelA/TNF knockouts have normal liver morphology at birth; however, death does not occur until approximately 40 days of age. In RelA/TNFR-1 knockouts, we have not observed survival beyond 3 weeks of age. Histological analysis of 40-day-old RelA-/-/TNF-/- mice demonstrated lung and liver inflammation (similar to our findings in RelA/TNFR-1 knockouts), as well as kidney abnormalities that we did not observe. A lack of TNFR-1 signaling caused a more profound defect than TNF deficiency, and this might be due to TNF signaling via TNFR-2. However, signaling through TNFR-2 did not cause increased apoptosis in the double-knockout newborns, but it could be contributing to the intense inflammatory reaction. Preliminary evidence suggests that the TNFR-2-/- mice cannot rescue the RelA-/- lethal phenotype, indicating that, whereas a functional TNFR-2 may be contributing to the demise of RelA-/-/TNFR-1-/- mice, it is not playing a role in RelA-/- lethality. It has also been recently reported that TNFR-1-/- mice can rescue the embryonic lethal effects seen in IKK-2-/- mice that die from a similar phenotype to that of RelA-/- mice.22 However, details of these TNFR-1-/-/IKK-2-/- mice were not described.
Although the main goal of this work was to examine embryonic lethality
of RelA-/- mice, we also obtained
interesting information about TNFR-1 knockouts. These
animals develop normally, but show diminished resistance to infection
by intracellular bacteria.41
The TNFR-1
knockouts fail to activate NF-
B and STAT3 during liver regeneration,
leading to high mortality and deficient DNA replication.3
A major puzzle is to explain how these animals survive embryonic
development, if we assume that, as in liver regeneration, the
TNFR-1 knockouts have deficient NF-
B and STAT3 during
liver development. Surprisingly, we found that both NF-
B and STAT3
were active in the liver of the TNFR-1 knockouts. This
suggests that either TNF does not activate NF-
B during normal liver
development or that, in the TNFR-1 knockouts, an alternate
mechanism of NF-
B activation (perhaps through IL-1) is used. In any
event, these results point out that hepatocyte proliferation in liver
development and liver regeneration has different regulatory pathways.
Thus, the absence of RelA is not directly responsible
for fetal liver death, but its absence allows cells to become sensitive
to TNFR-1-mediated apoptotic signals. The removal of these signals in
RelA-/-/TNFR-1-/-
mice prevents embryonic lethality and does not interfere with liver
development.
| Acknowledgements |
|---|
| Footnotes |
|---|
Supported by CA-23226 and CA-74131 (to N. F.); M. E. R. is the recipient of a postdoctoral fellowship from the National Institutes of Health (F32 DK0992001).
Accepted for publication November 10, 1999.
| References |
|---|
|
|
|---|
B/Rel, and I
B gene families: mediators of immune response and inflammation. J Mol Med 1996, 74:749-769[Medline]
B transcription factors, and the control of apoptosis. Sem Cancer Biol 1997, 8:113-119[Medline]
B. Nature 1995, 376:167-170[Medline]
B relA-deficient lymphocytes: normal development of T cells and B cells, impaired production of IgA and IgG1 and reduced proliferative responses. J Exp Med 1997, 185:953-961
B, and Rel proteins: evolutionarily conserved mediators of immune responses. Annu Rev Immunol 1998, 16:225-260[Medline]
B/Rel family. Cell 1995, 80:331-340[Medline]
B activation, enhanced granulopoiesis, and neonatal lethality in I
B
-deficient mice. Genes Dev 1995, 9:2736-2746
B activity in transgenic mice: developmental regulation and tissue specificity. Development 1996, 122:2117-2128[Abstract]
B activation prevents cell death. Cell 1996, 87:565-576[Medline]
B activation. Cell 1995, 81:495-504[Medline]
B-
is necessary for activation of transcription factor NF-
B. Nature 1993, 365:182-185[Medline]
B and stabilizes a newly phosphorylated form of I
B-
that is still bound to NF-
B. EMBO J 1994, 13:5433-5441[Medline]
B-
proteolysis by site-specific, signal-induced phosphorylation. Science 1995, 267:1485-1488
B kinase 2 gene. Science 1999, 284:321-325
B activation in IKK-ß-deficient mice. Immunity 1999, 10:421-429[Medline]
inhibit liver regeneration after partial hepatectomy. Am J Physiol 1992, 263:G579-G585
-induced apoptosis by NF-
B. Science 1996, 274:787-789
B in preventing TNF-
-induced cell death. Science 1996, 274:782-784
B. Science 1996, 274:784-787
B/Rel blocks transforming growth factor ß1-induced apoptosis of murine hepatocyte cell lines. Cell Growth Differ 1997, 8:1049-1059[Abstract]
B1 nuclear translocation in tumor necrosis factor
-stimulated hepatocytes. J Biol Chem 1997, 272:9825-9832
B requires proteolysis of the inhibitor I
B-
: signal-induced phosphorylation of I
B-
alone does not release active NF-
B. Proc Natl Acad Sci USA 1995, 92:552-556
B-deficient fetal liver cells. Immunity 1997, 6:765-772[Medline]
, or the p55TNF-R. J Exp Med 1998, 188:1343-1352
: effects on proliferation of normal and transformed cells in vitro. Science 1985, 230:943-945
B in activated rat hepatic stellate cells by proteasome inhibitors and an I
B super-repressor. Hepatology 1998, 27:1285-1295[Medline]
B prevents apoptosis and liver dysfunction during liver regeneration. J Clin Invest 1998, 101:802-811[Medline]
This article has been cited by other articles:
![]() |
R. D. Schulteis, H. Chu, X. Dai, Y. Chen, B. Edwards, D. Haribhai, C. B. Williams, S. Malarkannan, M. J. Hessner, S. Glisic-Milosavljevic, et al. Impaired survival of peripheral T cells, disrupted NK/NKT cell development, and liver failure in mice lacking Gimap5 Blood, December 15, 2008; 112(13): 4905 - 4914. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Wullaert, G. van Loo, K. Heyninck, and R. Beyaert Hepatic Tumor Necrosis Factor Signaling and Nuclear Factor-{kappa}B: Effects on Liver Homeostasis and Beyond Endocr. Rev., June 1, 2007; 28(4): 365 - 386. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Quinton, M. R. Jones, B. T. Simms, M. S. Kogan, B. E. Robson, S. J. Skerrett, and J. P. Mizgerd Functions and Regulation of NF-{kappa}B RelA during Pneumococcal Pneumonia J. Immunol., February 1, 2007; 178(3): 1896 - 1903. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. C. Sadler, K. N. Krahn, N. A. Gaur, and C. Ukomadu Liver growth in the embryo and during liver regeneration in zebrafish requires the cell cycle regulator, uhrf1 PNAS, January 30, 2007; 104(5): 1570 - 1575. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Seymour, J. P. Sundberg, and H. HogenEsch Abnormal lymphoid organ development in immunodeficient mutant mice. Vet. Pathol., July 1, 2006; 43(4): 401 - 423. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nagashima, V. G. Sasseville, D. Wen, A. Bielecki, H. Yang, C. Simpson, E. Grant, M. Hepperle, G. Harriman, B. Jaffee, et al. Rapid TNFR1-dependent lymphocyte depletion in vivo with a selective chemical inhibitor of IKKbeta Blood, June 1, 2006; 107(11): 4266 - 4273. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-L. Cho, J.-W. Kang, Y.-M. Moon, H.-J. Nam, J.-Y. Jhun, S.-B. Heo, H.-T. Jin, S.-Y. Min, J.-H. Ju, K.-S. Park, et al. STAT3 and NF-{kappa}B Signal Pathway Is Required for IL-23-Mediated IL-17 Production in Spontaneous Arthritis Animal Model IL-1 Receptor Antagonist-Deficient Mice J. Immunol., May 1, 2006; 176(9): 5652 - 5661. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Haouzi, S. Baghdiguian, G. Granier, P. Travo, P. Mangeat, and U. Hibner Three-dimensional polarization sensitizes hepatocytes to Fas/CD95 apoptotic signalling J. Cell Sci., June 15, 2005; 118(12): 2763 - 2773. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. S. Pryhuber, H. L. Huyck, J. M. Roper, J. Cornejo, M. A. O'Reilly, R. H. Pierce, and E. N. Tsitsikov Acute Tumor Necrosis Factor-{alpha}-Induced Liver Injury in the Absence of Tumor Necrosis Factor Receptor-Associated Factor 1 Gene Expression Am. J. Pathol., June 1, 2005; 166(6): 1637 - 1645. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Liu, C. Li, Y. Chen, C. Burnett, X. Y. Liu, S. Downs, R. D. Collins, and J. Hawiger Nuclear Import of Proinflammatory Transcription Factors Is Required for Massive Liver Apoptosis Induced by Bacterial Lipopolysaccharide J. Biol. Chem., November 12, 2004; 279(46): 48434 - 48442. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. G. Cavin, M. Venkatraman, V. M. Factor, S. Kaur, I. Schroeder, F. Mercurio, A. A. Beg, S. S. Thorgeirsson, and M. Arsura Regulation of {alpha}-Fetoprotein by Nuclear Factor-{kappa}B Protects Hepatocytes from Tumor Necrosis Factor-{alpha} Cytotoxicity during Fetal Liver Development and Hepatic Oncogenesis Cancer Res., October 1, 2004; 64(19): 7030 - 7038. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Gugasyan, A. Voss, G. Varigos, T. Thomas, R. J. Grumont, P. Kaur, G. Grigoriadis, and S. Gerondakis The Transcription Factors c-rel and RelA Control Epidermal Development and Homeostasis in Embryonic and Adult Skin via Distinct Mechanisms Mol. Cell. Biol., July 1, 2004; 24(13): 5733 - 5745. [Abstract] [Full Text] [PDF] |
||||
![]() |
S Finotto, J Siebler, M Hausding, M Schipp, S Wirtz, S Klein, M Protschka, A Doganci, H A Lehr, C Trautwein, et al. Severe hepatic injury in interleukin 18 (IL-18) transgenic mice: a key role for IL-18 in regulating hepatocyte apoptosis in vivo Gut, March 1, 2004; 53(3): 392 - 400. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Y. Zhang, C. L. Green, S. Tao, and P. A. Khavari NF-{kappa}B RelA opposes epidermal proliferation driven by TNFR1 and JNK Genes & Dev., January 1, 2004; 18(1): 17 - 22. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Zeiss The Apoptosis-Necrosis Continuum: Insights from Genetically Altered Mice Vet. Pathol., September 1, 2003; 40(5): 481 - 495. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Chen, M. Kwong, R. Lu, D. Ginzinger, C. Lee, L. Leung, and J. Y. Chan Nrf1 Is Critical for Redox Balance and Survival of Liver Cells during Development Mol. Cell. Biol., July 1, 2003; 23(13): 4673 - 4686. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Cusson, S. Oikemus, E. D. Kilpatrick, L. Cunningham, and M. Kelliher The Death Domain Kinase RIP Protects Thymocytes from Tumor Necrosis Factor Receptor Type 2-induced Cell Death J. Exp. Med., July 1, 2002; 196(1): 15 - 26. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Chi, F. Diaz-Griffero, C. Wang, J. A. T. Young, and J. Brojatsch An NF-{kappa}B-Dependent Survival Pathway Protects against Cell Death Induced by TVB Receptors for Avian Leukosis Viruses J. Virol., May 3, 2002; 76(11): 5581 - 5587. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. Kupfner, J. J. Arcaroli, H.-K. Yum, S. G. Nadler, K.-Y. Yang, and E. Abraham Role of NF-{kappa}B in Endotoxemia-Induced Alterations of Lung Neutrophil Apoptosis J. Immunol., December 15, 2001; 167(12): 7044 - 7051. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hayashi and D. L. Faustman Genome and Hormones: Gender Differences in Physiology: Selected Contribution: Association of gender-related LMP2 inactivation with autoimmune pathogenesis J Appl Physiol, December 1, 2001; 91(6): 2804 - 2815. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Silverman and T. Maniatis NF-{kappa}B signaling pathways in mammalian and insect innate immunity Genes & Dev., September 15, 2001; 15(18): 2321 - 2342. [Full Text] [PDF] |
||||
![]() |
F. Chen, V. Castranova, and X. Shi New Insights into the Role of Nuclear Factor-{kappa}B in Cell Growth Regulation Am. J. Pathol., August 1, 2001; 159(2): 387 - 397. [Abstract] [Full Text] |
||||
![]() |
E. Alcamo, J. P. Mizgerd, B. H. Horwitz, R. Bronson, A. A. Beg, M. Scott, C. M. Doerschuk, R. O. Hynes, and D. Baltimore Targeted Mutation of TNF Receptor I Rescues the RelA-Deficient Mouse and Reveals a Critical Role for NF-{kappa}B in Leukocyte Recruitment J. Immunol., August 1, 2001; 167(3): 1592 - 1600. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. H. Pierce, J. S. Campbell, A. B. Stephenson, C. C. Franklin, M. Chaisson, M. Poot, T. J. Kavanagh, P. S. Rabinovitch, and N. Fausto Disruption of Redox Homeostasis in Tumor Necrosis Factor-Induced Apoptosis in a Murine Hepatocyte Cell Line Am. J. Pathol., July 1, 2000; 157(1): 221 - 236. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. S. Sylla, K. Murphy, E. Cahir-McFarland, W. S. Lane, G. Mosialos, and E. Kieff The X-linked lymphoproliferative syndrome gene product SH2D1A associates with p62dok (Dok1) and activates NF-kappa B PNAS, June 13, 2000; (2000) 130193097. [Abstract] [Full Text] |
||||
![]() |
B. S. Sylla, K. Murphy, E. Cahir-McFarland, W. S. Lane, G. Mosialos, and E. Kieff The X-linked lymphoproliferative syndrome gene product SH2D1A associates with p62dok (Dok1) and activates NF-kappa B PNAS, June 20, 2000; 97(13): 7470 - 7475. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |