| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Franz Volhard Clinic,*
Medical Faculty of the
Charité, Humboldt University of Berlin, Berlin, Germany; the
Institute of Biomedicine,
University of
Helsinki, Helsinki, Finland; the Max Delbrück Center for
Molecular Medicine,
Berlin, Germany; the
Medical School Hannover,§
Hannover, Germany; F.
Hoffmann-La Roche,¶
Basel, Switzerland; the
Institute of Pathology,||
Technische
Universität Dresden, Dresden, Germany; and the Department
of Immunology,**
Scripps Research Institute, La
Jolla, California
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B
(NF-B) and activator protein-1 (AP-1) activation, and c-fos
expression in dTGR hearts. NF-B subunit p65 and TF expression was
increased in the endothelium and media of cardiac vessels and markedly
reduced by valsartan treatment. To analyze the mechanism of TF
transcription, we then transfected human coronary artery smooth
muscle cells and Chinese hamster ovary cells overexpressing the
AT1 receptor with plasmids containing the human TF promoter
and the luciferase reporter gene. ANG II induced the full-length TF
promoter in both transfected cell lines. TF transcription was abolished
by AT1 receptor blockade. Deletion of both AP-1 and NF-B
sites reduced ANG II-induced TF gene transcription completely,
whereas the deletion of AP-1 sites reduced transcription. Thus,
the present study clearly shows an aberrant TF expression in the
endothelium and media in rats with ANG II-induced vasculopathy. The
beneficial effects of AT1 receptor blockade in this model
are mediated via the inhibition of NF-B and AP-1 activation,
thereby preventing TF expression, cardiac vasculopathy,
and microinfarctions.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
TF expression in cultured cells occurs in response to a variety of
stimuli (eg, lipopolysaccharides, tumor necrosis factor-
,
phorbol-12-myristate 13-acetate (PMA), and ANG II),10-15
but until now no evidence has been presented that TF is generated in
ANG II-induced cardiac vasculopathy in vivo. Because ANG II
may use similar signaling pathways as lipopolysaccharides, tumor
necrosis factor-, and PMA in vivo, it is quite likely
that TF is also induced by ANG II through the angiotensin II
(AT1) receptor, followed by a
subsequent activation of the transcription factors nuclear factor-B
(NF-B) and activator protein-1 (AP-1).10,16
Orthner et
al14
demonstrated that inhibition of NF-B after
stimulation with various agonists resulted in reduced TF activity in
endothelial cells.
We investigated the effect of AT1 receptor
blockade on the binding activity of NF-B and AP-1, as well as TF
expression in a model of ANG II-induced cardiac vasculopathy. Our
findings demonstrate that ANG II mediates its effect on vascular TF via
the AT1 receptor, followed by the subsequent
activation of NF-B and AP-1.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Four-week-old dTGR were divided into two groups, control (n = 26) and valsartan (n = 16) groups. Valsartan was given for 3 weeks by gavage once a day (10 mg/kg). Control dTGR and normotensive Sprague-Dawley (SD) rats (n = 15) rats received vehicle (1% sodium carboxymethylcellulose). The dTGR line and characteristics are described elsewhere.17 The rats were purchased from Biological Research Laboratories Ltd (Füllinsdorf, Switzerland) and were allowed free access to standard 0.3% sodium rat chow (SSNIFF Spezialitäten GmbH, Soest, Germany) and drinking water. The procedures were approved by the local Council on Animal Care (permit no. G408/97), whose standards correspond to those of the American Physiological Society. Systolic blood pressure was measured weekly by tail cuff under light ether anesthesia, 20 hours after the last drug dose, starting at age 5 weeks. The rats were killed at age 7 weeks. Blood samples for hormone analysis were drawn by aortic puncture into pre-chilled tubes containing EDTA (6.25 mmol/L) and phenantroline (26 mmol/L) as anticoagulant and inhibitor of ANG II breakdown in vitro, respectively. Remikiren (10 µmol/L) was added to plasma samples for ANG II measurement to prevent ANG II formation in vitro. The hearts were washed with ice-cold saline, weighed, frozen in liquid nitrogen, and stored at -80°C until assayed.
Isolated Perfused Heart
Transgenic rats (n = 5 or 6 in each group) were heparinized and anesthetized with thiopental (150 mg/kg rat, i.p.). Once the rat was deeply anesthetized, the heart was removed by sternectomy and placed in iced Krebs-Henseleit buffer. The heart was cannulated immediately via the aorta and retrograde perfusion was performed in a Langendorff apparatus under constant flow (10 ml/min) with a modified Krebs-Henseleit solution with the following composition: NaCl, 114.7 mmol/L; KCl, 4.7 mmol/L; MgSO4, 1.2 mmol/L; KH2PO4, 1.5 mmol/L; NaHCO3, 25 mmol/L; CaCl2, 2.5 mmol/L; and glucose, 11.1 mmol/L. The solution was gassed with 95% O2/5% CO2 and adjusted to pH 7.4. Coronary effluent was measured by an electromagnetic flow meter (Narcomatic RT 500, Narco BioSystems Inc., Houston, TX). A high fidelity microtip catheter was inserted via the aorta into the left ventricles to measure heart rate and left ventricular pressure. Protocols were started after 15 minutes’ equilibration perfusion. The coronary effluent was collected for 20 minutes into pre-chilled tubes containing the same inhibitor cocktail as was used for plasma ANG II measurements. The Ang II was extracted from the perfusate by reversible adsorption to octadecylsilyl-silica cartridges (Sep-Pak C18, Waters, Milford, MA) separated by high performance liquid chromatography and quantified by direct radioimmunoassay.
Cardiac Immunohistochemistry
For immunohistochemistry, the hearts were cut, snap-frozen in
isopentane (-35°C), and stored at -80°C. Frozen specimens were
cryosectioned at 6 µm thickness and air-dried. The sections were
fixed with cold acetone, air-dried, and washed with Tris-buffered
saline (TBS; 0.05 mol/L Tris buffer, 0.15 mol/L NaCl, pH 7.6). The
sections were incubated for 60 minutes in a humid chamber at room
temperature with primary monoclonal antibodies against rat
monocytes/macrophages (ED1; Serotec, Oxford, UK), NF-B subunit p65
(Roche Boehringer, Mannheim, Germany), VLA-4 (TA-4, Pharmingen, San
Diego, CA), and the polyclonal tissue factor antibody, and fibronectin
(Paesel & Lorei, Frankfurt, Germany). The p65 antibody recognizes an
epitope overlapping the nuclear location signal of p65 subunit and
therefore selectively stains released, activated NF-B after
dissociation of its inhibitor I-B.18
After washing
with TBS, the sections were incubated with a bridging antibody
(rabbit-anti-mouse IgG; Dako, Hamburg, Germany) for 30 minutes at room
temperature and washed again with TBS. The alkaline
phosphatase-anti-alkaline phosphatase complex (Dako, Hamburg,
Germany) was applied, and the sections were incubated for 30 minutes at
room temperature. The immunoreactivity was visualized by development in
a mixture of naphtol-AS-BI-phosphate (Sigma, Deisenhofen,
Germany) with neufuchsin (Merck, Darmstadt, Germany). Endogenous
alkaline phosphatase was blocked by addition of 10 mmol/L levamisole
(Sigma, Deisenhofen, Germany) to the substrate solution. The sections
were slightly counter stained in Mayer’s hemalaun (Merck),
blued in tap water, and mounted with GelTol (Coulter-Immunotech,
Hamburg, Germany). Preparations were examined under a Zeiss Axioplan-2
microscope (Zeiss, Jena, Germany) and photographed using a color
reversal film Agfa CTX 100. Semiquantitative scoring of ED-1-positive
cells in the heart was performed using computerized cell count program
(KS 300 3.0, Zeiss). Fifteen different areas of each heart samples
(n = 5 in both groups) were analyzed. The heart
samples were examined without knowledge of the rats’ identity.
Electrophoretic Mobility Shift Assay (EMSA)
Tissue extracts and EMSA were performed as described
earlier.19
Briefly, frozen total hearts were pulverized in
liquid nitrogen with a pestle and mortar, and resuspended in 3 ml 50
mmol/L Tris, pH 7.4, containing a Complete protease inhibitor tablet
(Roche Boehringer) and 1 mmol/L Na-ortho-vanadate (Sigma). The
suspension was centrifuged (4000 x g, 5 minutes,
4°C). The pellet was resuspended and lysed for 30 minutes in whole
cell lysate buffer (20 mmol/L Hepes pH 7.9, 350 mmol/L NaCl, 20%
glycerol, 1 mmol/L MgCl2, 0.5 mmol/L EDTA, 0.1
mmol/L EGTA, and 1% NP-40) and again centrifuged (13,000 x
g, 10 minutes, 4°C). The supernatant was aliquoted and
frozen in liquid nitrogen and stored at -80°C until use. The protein
concentration for EMSA was quantified by the Bradford
method.20
For EMSA, total heart homogenates were incubated
in binding reaction medium (2 µg poly-dI-dC, 1 µg bovine serum
albumin, 1 mmol/L dithiothreitol, 20 mmol/L Hepes pH 8.4, 60
mmol/L KCl and 8% Ficoll) with 0.5 ng of
32P-dATP end-labeled oligonucleotide, containing
the NF-B binding site from the MHC-enhancer (H2K,
5'-gatcCAGGGCTGGGGATTCCCCATCTCCACAGG) at 30°C for 30 minutes. The
DNA-protein complexes were analyzed on a 5% polyacrylamide gel (0.5%
Tris buffer), dried, and autoradiographed. NF-B activity could be
blocked by excess unlabeled NF-B probe, suggesting specificity of
the activation.
Isolation of mRNA and Gene Expression
After snap-freezing in liquid nitrogen, organs were kept at -80°C. Tissue was homogenized with mortar and pestle under liquid nitrogen. RNA was isolated following the TRIZOL protocol (Gibco Life Technology) and stored at -80°C. Reverse transcriptase-polymerase chain reaction (RT-PCR) primers and TaqMan-probe for GAPDH and TF were constructed with help of Primer Express (ABI Prism 7700 Sequence Detection System, Perkin Elmer, Foster City, CA): GAPDH forward: AAGCTGGTCATCAATGGGAAAC; GAPDH reverse: ACCCCATTTGATGTTAGCGG; GAPDH probe CATCACCATCTTCCAGGAGCGCGCGAT, FAM (6-carboxytetrafluorescein) and TAMRA (quencher) labeled; TF forward: CCACCTTTCTCGGCTTCCTT; TF reverse: CTTTCCCTGGAGGAGTGCC; TF probe: FAM-TCCTTCAGGTGGCCGTTGGTGC-TAMRA; c-fos forward: CCATGATGTTCTCGGGTTTCA, c-fos reverse: GCGCTACTGCAGCGGG, c-fos probe: FAM-CGCGGACTACGAGGCGTCATCC-TAMRA. oligonucleotides were synthesized by BioTez (Berlin-Buch, Germany). Manganese (Mn) and primer concentrations were optimized with a titration curve. The following concentrations were used: GAPDH Mn 3 mmol/L; TF 4 mmol/L, c-fos 4 mmol/L; GAPDH and TF: primer forward 200 nmol/L, primer reverse 600 nmol/L, probe 100 nmol/L, c-fos primer 200 nmol/L, probe 100 nmol/L. Real-time quantitative RT-PCR was performed using the TaqMan system (ABI’s Prism 7700 Sequence Detection System, Perkin Elmer, Foster City, CA) and following the instructions of TaqMan EZ RT-PCR TaqMan-kit protocol. 0.5–1µg total RNA was used for each PCR with the following time course: 50°C, 2 minutes; 60°C, 30 minutes; 95°C, 5 minutes; 40 cycles of 94°C, 20 seconds and 60°C, 1 minute. Each sample was tested twice. For quantification, gene expression of the target sequence was normalized in relation to the expressed housekeeping gene GAPDH.
Clotting Test
Thin sections (10 µm) of frozen tissue samples were homogenized with an Ultra Turrax in ice-cold extraction buffer, pH 7.5, containing 5 mmol/L n-octyl-b-D-glucopyranoside and 20 mmol/L HEPES saline (Sigma Chemie). For extraction, homogenates were gently agitated at 4°C for 6 hours followed by centrifugation (300 x g, 15 minutes). The supernatants were aliquoted and stored frozen at -80°C until use. Protein content was determined by the Micro BCA protein assay reagent kit (Pierce, Germany). The procoagulant activity (PCA) of left ventricle extracts was assayed in a one-stage clotting test. In this assay 25 µl of samples were incubated with 25 µl of citrated plasma from rats (Sigma) for 1 minute at 37°C. After addition of 25 µl of 25 mmol/L CaCl2, the clotting time was manually measured. The time recorded was converted to milliunits (mU) of PCA by reference to a TF standard curve derived from a preparation of rat brain acetone powder (Sigma). A clotting time of 50 seconds corresponded to 1000 mU of PCA. PCA was normalized in relation to the expressed total protein (mU/mg).
Transfection of Luciferase Promoter Construct and Analysis
Human coronary artery vascular smooth muscle cells (VSMC) were grown in SmGM2 (Clonetics, San Diego, CA) and Chinese hamster ovary (CHO) cells (cell lines were a kind gift of Dr. Wallukat, MDC, Berlin, Germany) stably overexpressing the AT 1 receptor (CHO-AT1) and CHO wild-type cells (CHO-WT) in DMEM/Ham’s F-12 containing geneticine (63 mg/L), 10% fetal calf serum, 0.1% penicillin/streptomycin, and glutamine to 75% confluence. The human TF luciferase promoters have been described previously.21 For the promoter studies, 2 µg of the appropriate luciferase promoter construct per milliliter of medium were transfected with Fugene6 (Roche Boehringer) according to the manufacturer’s description. Transfected cells were stimulated for 15 minutes with 1x10-6, or 10-7 mol/L ANG II. AT1 receptor was blocked by a 30-minute preincubation with 10-6 mol/L valsartan. Cells were harvested and lysed as described earlier.22 Luciferase activity assay was performed as described elsewhere.22 Relative luciferase units were calculated as percentage of basal luciferase activity of the nonstimulated cell line. The measurements were performed in duplicate. The data were confirmed in 3 to 5 independent transfections.
Statistics
Data are presented as means ± SE. Statistically significant differences in mean values were tested by two-way analysis of variance for repeated measures and the Scheffé test. A value of P < 0.05 was considered statistically significant. The data were analyzed using Statview statistical software.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
dTGR featured hypertension and cardiac hypertrophy. Sections of
myocardium from dTGR show hemorrhages and patchy areas of necrosis, as
well as an interstitial fibrosis. Twelve of 26 untreated dTGR died
before week 7. In contrast, none of the valsartan-treated rats died
before the end of the study. Untreated dTGR vessels show signs of
vasculopathy indicated by damaged lamina elastica interna and intimal
proliferation. Valsartan reduced cardiac hypertrophy,
prevented vascular injury, and inhibited extracellular matrix
formation (Figure 1, A
-D).
|
Blood pressure, coronary resistance, cardiac hypertrophy, and left
ventricular pressure were markedly increased in untreated dTGR.
Valsartan normalized blood pressure, coronary resistance and prevented
the development of cardiac hypertrophy (P <
0.0001, respectively, Figure 2, A
-C).
Plasma ANG II concentrations were fivefold higher in untreated dTGR
compared to normotensive SD rats. Valsartan did not affect plasma ANG
II levels. ANG II release from isolated perfused hearts was increased
threefold in dTGR. Plasma lactic acid dehydrogenase (LDH) was
significantly increased compared to valsartan-treated and nontransgenic
rats (4651 ± 1268 U vs. 1574 ± 523 U
vs. 640 ± 162 U, P < 0.05).
|
Monocyte adherence to fibronectin or engagement of VLA-4 has been
demonstrated to stimulate TF. Therefore, we analyzed the infiltration
monocyte/macrophage- and VLA-4-positive cells in cardiac perivascular
space of dTGR. Semiquantitative cell count analysis showed
significantly increased infiltration in dTGR with a 61% reduction for
ED-1-positive mononuclear cells (Figure 3A)
, as well as a 69% reduction for
VLA-4-positive cells (Figure 3B)
, after valsartan treatment (both
P < 0.0001). The localization of VLA-4 in the
interstitium was in the proximity of ED-1-positive cells. dTGR hearts
showed increased fibronectin, collagen I and IV, and laminin
expression, which was prevented by AT1 receptor
blockade (data not shown).
|
B and AP-1 DNA Binding Activity and c-fos mRNA in the Left
Ventricle
We then investigated the activation of the transcription factors
NF-B and AP-1, which regulate TF gene expression. EMSA for the
detection of NF-B and AP-1 showed a greater binding activity in
heart homogenates of dTGR compared to SD rats (Figure 4)
. Valsartan treatment reduced binding
activity of NF-B and AP-1 in the heart. The unrelated transcription
factor, CAAT enhancer binding protein was used as control and showed no
difference between dTGR and SD (data not shown). TaqMan analysis was
performed to assess c-fos (Figure 5A)
mRNA levels in dTGR hearts. Untreated dTGR show significantly increased
c-fos mRNA levels. Valsartan reduced both c-fos expression. mRNA levels
of the target gene was normalized for the housekeeping gene GAPDH.
|
|
TaqMan analysis was performed to assess TF (Figure 5B)
mRNA levels
in left ventricle of dTGR. Untreated dTGR show significantly increased
TF mRNA levels. Valsartan slightly reduced TF expression. mRNA levels
of TF gene was normalized for the housekeeping gene GAPDH. However, PCA
was not different between the groups when analyzed by ANOVA and
Scheffé test. Analyzing median values untreated dTGR showed low
levels of TF procoagulant activity per total protein 221 mU/mg
(15–4286) compared to relative highest levels in SD rats (549 mU/mg;
25–3192). Valsartan-treated dTGR 280 mU/mg (54–954). These results
are in agreement with relative low TF content in human myocardium with
pressure-overloaded hearts. In the present study 6 out of 9 dTGR showed
a lower PCA compared to the median of the non-transgenic group. Two
untreated dTGR with signs of end stage organ damage showed extremely
high PCA, indicating that the clotting hemostasis was impaired after
microinfarctions. Whereas valsartan treatment inhibited p65 and TF in
the vascular wall, valsartan mediated the reduction of hypertrophy, it
rather increased PCA per total protein in extracts of the left
ventricle. Fluctuation of PCA per total protein within the groups was
relatively high, indicating an inhomogeneous distribution of TF in the
left ventricle of dTGR.
NF-B Subunit p65 and TF Expression in Coronary Vessels
We also analyzed p65 and TF expression at the protein level
(Figure 6)
. Immunohistochemical analysis
(phase contrast resolution) showed increased expression of the NF-B
p65 subunit in the endothelium, and smooth muscles cells of dTGR
vessels, which was reduced by valsartan (Figure 6, A and B)
. No
immunoreaction was observed in the vessel wall of nontransgenic SD rats
(Figure 6C)
. The antibody recognizes an epitope overlapping the nuclear
location signal of p65 subunit and therefore selectively stains
released, activated NF-B after dissociation from its inhibitor
I-B.18
|
. The
staining pattern of TF resembles the localization of p65 in the vessel
wall. AT1 receptor blockade reduced ANG
II-induced TF expression (Figure 6E)
. No striking immunoreaction was
observed in the vessel wall of nontransgenic SD rats (Figure 6F)
.
Figure 7
shows a representative section
of a dTGR heart with increased TF expression in the vessel wall and
adventitia as well as infiltrated cells. TF immunostaining was markedly
reduced by valsartan.
|
To characterizes the effects of ANG II on human TF promoter
activity, VSMC and CHO cells overexpressing the
AT1 receptor were transfected with various
truncations of plasmids containing the human TF promoter (-244 to 121
bp, relative to the transcription start site) cloned upstream of a
firefly luciferase reporter gene. Luciferase activity of cells
transfected with the full-length TF promoter was increased 12-fold in
VSMC (Figure 8)
and 11-fold in
CHO-AT1 (Figure 9)
,
but not in CHO-WT (Figure 9)
, after
10-7
mol/L ANG II.
Preincubation with 10-6
mol/L valsartan completely abolished luciferase activity. Deletion of
both AP-1 and B sites also abolished ANG II-induced TF gene
transcription, whereas the pTF(-194)LUC promoter, which still contains
the kB binding site but no AP-1 sites, still showed a fourfold
induction of the TF gene in VSMC and CHO-AT1.
However, deletion of both AP-1 and NF-B sites abolished ANG
II-induced TF gene transcription completely in both cell lines.
Furthermore, ANG II induced TF promoter in both transfected cell lines
in a time- and dose-dependent manner (data not shown). Valsartan alone
had no influence on luciferase activity.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This study demonstrating expression of TF within the endothelium and
media of coronary dTGR arteries suggests that TF may participate in the
pathogenesis of ANG II-induced cardiac vasculopathy. In addition, our
data provide both in vitro and in vivo evidence
that inhibition of the transcription factors NF-B and AP-1 by
AT1 receptor blockade reduces TF expression in
vascular cells. In untreated dTGR, we found severe left ventricular
hypertrophy with focal areas of necrosis, probably on the basis of
fibrinoid necrosis and vascular occlusion. Chronic treatment with
valsartan normalized systemic and coronary resistance and prevented
cardiac vascular damage. Valsartan prevented inflammation, the
activation of NF-B, AP-1, and c-fos expression in dTGR hearts. TF
immunoreactivity in the vessel wall was reduced by valsartan, similar
to SD rats. We also investigated a putative mechanism responsible for
ANG II induction of human TF gene. TF promoter analysis showed that
deletion of both AP-1 and NF-B sites also abolished ANG II-induced
TF gene transcription, whereas the truncated promoter pTF(-194)LUC,
which still contains the NF-B binding site but no AP-1 sites, still
showed a partial luciferase activity.
TF is known to possess properties independent of its coagulation
capacity. Very recently, Luther et al26
described TF
localization in the myocardium. TF antigen was present in the
transversal part of the intercalated disks, where it was colocalized
with cytoskeletal proteins such as desmin and vinculin, but not with
its coagulation factor VII. The microtopography of TF at cardiomyocyte
contact sites and its distribution under physiological and
pathophysiological conditions suggest that TF also plays a structural
role in the maintenance of the cardiac muscle. In their study, patients
with hypertension and left ventricular hypertrophy showed lower TF
content compared to healthy patients. dTGR feature hypertension as well
as cardiac hypertrophy. Since hypertrophied hearts show less
intercalated disks per gram of tissue, it is quite likely that this was
the reason for the lower PCA levels in dTGR compared to normal
hearts.26
In the present study, 6 out of 9 dTGR also
showed a lower PCA compared to the median of the nontransgenic group.
Two untreated dTGR with signs of end stage organ damage showed
extremely high PCA, indicating that the clotting homeostasis was
impaired after microinfarctions. Although valsartan inhibited p65 and
TF in the vascular wall, valsartan increased PCA per total protein in
extracts of the left ventricle. Therefore, we speculate that there may
be an NF-B-dependent and independent TF regulation in different
compartments of the heart.
ANG II has various effects on function and the pathogenesis of ischemic heart disease. Blockade of the renin-angiotensin system has been shown to reduce the recurrence of cardiovascular events. However, the reduction cannot be completely explained by antihypertensive and antihypertrophic effects of the inhibitors. We suggest that ANG II exerts additional actions such as stimulation of inflammatory processes that may interact with the coagulation system. Nishimura et al27 showed that ANG II increases plasminogen activator inhibitor-1 (PAI-1) and TF mRNA expression in cultured rat aortic endothelial cells, without changing their counterregulators, tissue type plasminogen activator and tissue factor pathway inhibitor. We have recently shown that ANG II also stimulated PAI-1 in dTGR kidneys, which was suppressed by blockade of the renin-angiotensin system.28,29
Little is known about activation and inhibition of NF-B, AP-1, and
TF in the heart. Morishita et al30
showed that NF-B
inhibition by a decoy technique reduced the extent of myocardial
infarction after reperfusion. Moreover, TF expression is increased in
cardiac allograft vasculopathy and in cardiac and renal
ischemic-reperfusion injury.31-33
In our model, the
surface adhesion molecule expression on the vascular wall of dTGR is
reminiscent of histological findings observed in models of reperfusion
injury. We also showed increased expression of the NF-B subunit p65
in the endothelium, smooth muscles cells of dTGR vessels, and
infiltrated cells. The staining pattern resembled the localization of
the TF expression in the vessel wall. In addition to NF-B, the
transcription factor AP-1 is activated in inflammatory and
proliferative processes. EMSA for NF-B and AP-1 both showed
increased DNA binding activity in dTGR hearts compared to SD. Although
valsartan reduced cardiac NF-B binding activity completely, AP-1
activity was only partially inhibited. The latter result was
accompanied by suppressed c-fos mRNA and indicated additional jun/jun
complex formation, accounting for AP-1 binding activity. Recently,
Nemerson and coworkers showed that in addition to the scheme whereby
coagulation is initiated after vessel damage and blood exposure to
vessel wall-bound TF, even leukocytes are considered as a main source
of blood-borne TF.15,34
dTGR showed both vessel wall
damage and leukocyte activation, both of which may have influenced TF
activity.
We have recently shown that the inflammatory response in dTGR kidneys is associated with cell surface adhesion molecule expression, as well as their integrins LFA-1 and VLA-4, and can be prevented by blockade of the renin-angiotensin system.28,29 The surface expression of adhesion molecules, as well as release of a number of macrophage products, serve to coordinate the local inflammatory responses. Within the vascular space, monocyte adherence to the endothelium stimulates monocyte TF expression. Monocyte/macrophage TF induces fibrin deposits, which contributes to the development of inflammation.8 This process most likely contributes to local microvascular thrombosis,9 which we also observed in this model.24 Besides its important role in inflammation, integrin-matrix signaling is also known to influence coagulation.35 We have previously shown that the AP-1-regulated matrix protein fibronectin is up-regulated in dTGR.28,29 Several reports suggest that the ß1 integrin VLA-4 induces monocyte procoagulant activity.36,37 McGilvray et al36 showed that the VLA-4 integrin cross-linked on human monocytes induces TF expression by a mechanism involving mitogen-activated protein kinase. We found marked infiltration of VLA-4-positive cells in dTGR hearts, which was reduced after AT1 receptor blockade. We suggest that VLA-4/fibronectin signaling also stimulate TF expression via activation of AP-1 in our model. Recent data have demonstrated that TF not only initiates extrinsic coagulation, but also promotes cell adhesion and migration.7 Thus, TF may participate in cell adhesion and migration, inflammation with the macrophage TF expression, and coagulation.
In summary, our data provide the first evidence that inhibition of the
transcription factors NF-B and AP-1 by AT1
receptor blockade reduced TF expression in ANG II-induced cardiac
vasculopathy. Chronic treatment with the AT1
receptor blockade normalized systemic and coronary resistance and
prevented cardiac damage. Valsartan prevented inflammation, the
activation of NF-B, AP-1, and c-fos expression in dTGR hearts. TF
protein expression in the vessel wall were markedly reduced by
valsartan, almost to control values. Analysis of the human TF promoter
showed increased luciferase activity after ANG II stimulation. TF
transcription was completely reduced by AT1
receptor blockade and the deletion of both AP-1 and NF-B sites in
the TF promoter. In contrast, PCA of left ventricular extracts,
representing TF content of myocardium as well as heart vessels, seem
not to be reduced uniformly. Therefore, it is obvious that TF
regulation in the heart is quite complex. Future studies will clarify
the various functions of TF in the different compartments of the heart.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Supported by a grant-in-aid from Hoffmann-La Roche, Basel, Switzerland. E. M. A. M. and D. N. M. were supported by the Alexander von Humboldt Foundation, the Klinisch-pharmakologischer Verbund Berlin-Brandenburg, the Finnish Foundation for Cardiovascular Research, and the Academy of Finland.
D. N. M., E. M. A. M., and R. D. contributed equally to this work.
Accepted for publication March 6, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  N. Mackman, R. E. Tilley, and N. S. Key Role of the Extrinsic Pathway of Blood Coagulation in Hemostasis and Thrombosis Arterioscler. Thromb. Vasc. Biol., August 1, 2007; 27(8): 1687 - 1693. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. C. Tu, H. Sun, G. T. Bowden, and Q. M. Chen Involvement of oxidants and AP-1 in angiotensin II-activated NFAT3 transcription factor Am J Physiol Cell Physiol, April 1, 2007; 292(4): C1248 - C1255. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Vidal, Y. Sun, S. K. Bhattacharya, R. A. Ahokas, I. C. Gerling, and K. T. Weber Calcium paradox of aldosteronism and the role of the parathyroid glands Am J Physiol Heart Circ Physiol, January 1, 2006; 290(1): H286 - H294. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. W.J.H. Dielis, M. Smid, H. M.H. Spronk, K. Hamulyak, A. A. Kroon, H. ten Cate, and P. W. de Leeuw The Prothrombotic Paradox of Hypertension: Role of the Renin-Angiotensin and Kallikrein-Kinin Systems Hypertension, December 1, 2005; 46(6): 1236 - 1242. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Wang, R. Han, I. Lee, A. S. Hancock, G. Xiong, M. D. Gunn, and W. W. Hancock Permanent Survival of Fully MHC-Mismatched Islet Allografts by Targeting a Single Chemokine Receptor Pathway J. Immunol., November 15, 2005; 175(10): 6311 - 6318. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Wang, J. Zhang, G. Spinetti, L.-Q. Jiang, R. Monticone, D. Zhao, L. Cheng, M. Krawczyk, M. Talan, G. Pintus, et al. Angiotensin II Activates Matrix Metalloproteinase Type II and Mimics Age-Associated Carotid Arterial Remodeling in Young Rats Am. J. Pathol., November 1, 2005; 167(5): 1429 - 1442. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Pilz, E. Shagdarsuren, M. Wellner, A. Fiebeler, R. Dechend, P. Gratze, S. Meiners, D. L. Feldman, R. L. Webb, I. M. Garrelds, et al. Aliskiren, a Human Renin Inhibitor, Ameliorates Cardiac and Renal Damage in Double-Transgenic Rats Hypertension, September 1, 2005; 46(3): 569 - 576. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. G. Neri Serneri, M. Boddi, P. A. Modesti, M. Coppo, I. Cecioni, T. Toscano, M. L. Papa, M. Bandinelli, G. F. Lisi, and M. Chiavarelli Cardiac Angiotensin II Participates in Coronary Microvessel Inflammation of Unstable Angina and Strengthens the Immunomediated Component Circ. Res., June 25, 2004; 94(12): 1630 - 1637. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. T. Weber From Inflammation to Fibrosis: A Stiff Stretch of Highway Hypertension, April 1, 2004; 43(4): 716 - 719. [Full Text] [PDF]
|
|
|
|
|
|
D. N. Muller, J. Theuer, E. Shagdarsuren, E. Kaergel, H. Honeck, J.-K. Park, M. Markovic, E. Barbosa-Sicard, R. Dechend, M. Wellner, et al. A Peroxisome Proliferator-Activated Receptor-{alpha} Activator Induces Renal CYP2C23 Activity and Protects from Angiotensin II-Induced Renal Injury Am. J. Pathol., February 1, 2004; 164(2): 521 - 532. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Finckenberg, K. Inkinen, J. Ahonen, S. Merasto, M. Louhelainen, H. Vapaatalo, D. Muller, D. Ganten, F. Luft, and E. Mervaala Angiotensin II Induces Connective Tissue Growth Factor Gene Expression via Calcineurin-Dependent Pathways Am. J. Pathol., July 1, 2003; 163(1): 355 - 366. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. N. Muller, A. Mullally, R. Dechend, J.-K. Park, A. Fiebeler, B. Pilz, B.-M. Loffler, D. Blum-Kaelin, S. Masur, H. Dehmlow, et al. Endothelin-Converting Enzyme Inhibition Ameliorates Angiotensin II-Induced Cardiac Damage Hypertension, December 1, 2002; 40(6): 840 - 846. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. N. Muller, E. Shagdarsuren, J.-K. Park, R. Dechend, E. Mervaala, F. Hampich, A. Fiebeler, X. Ju, P. Finckenberg, J. Theuer, et al. Immunosuppressive Treatment Protects Against Angiotensin II-Induced Renal Damage Am. J. Pathol., November 1, 2002; 161(5): 1679 - 1693. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Kalinowski, T. Matys, E. Chabielska, W. Buczko, and T. Malinski Angiotensin II AT1 Receptor Antagonists Inhibit Platelet Adhesion and Aggregation by Nitric Oxide Release Hypertension, October 1, 2002; 40(4): 521 - 527. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. D. Schecter, A. B. Berman, L. Yi, A. Mosoian, C. M. McManus, J. W. Berman, M. E. Klotman, and M. B. Taubman HIV envelope gp120 activates human arterial smooth muscle cells PNAS, August 10, 2001; (2001) 181328798. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M.-S. Zhou, A. Adam, and L. Raij Review: Interaction among angiotensin II, nitric oxide and oxidative stress Journal of Renin-Angiotensin-Aldosterone System, March 1, 2001; 2(1_suppl): S59 - S63. [PDF]
|
|
|
|
|
|
Z. J. Cheng, T. Vaskonen, I. Tikkanen, K. Nurminen, H. Ruskoaho, H. Vapaatalo, D. Muller, J.-K. Park, F. C. Luft, and E. M. A. Mervaala Endothelial Dysfunction and Salt-Sensitive Hypertension in Spontaneously Diabetic Goto-Kakizaki Rats Hypertension, February 1, 2001; 37(2): 433 - 439. [Abstract] [Full Text] |
