| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Department of Molecular Ophthalmology,*
Lions
Eye Institute, Perth; and the Centre for Ophthalmology and Vision
Science,
University of Western Australia,
Perth, Australia
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Growth factors and cell adhesion molecules that have been implicated in CNV include ICAM-1, E-selectin, CD44,3 basic and acidic fibroblast growth factor (aFGF and bFGF),4 and vascular endothelial growth factor (VEGF). Although evidence does support a role for other growth factors in CNV,5-7 the potency and specificity of VEGF for vascular endothelial cells and the fact that it can be secreted would suggest it has a primary role in CNV development. VEGF, a homodimer of approximately 45 kd, is a very potent vascular endothelial cell mitogen.8,9 Six different isoforms of human VEGF have been identified to date,8,10-12 and all have different heparin binding capabilities, show varying tissue distribution, are up-regulated under hypoxic conditions,13 and are potent vasopermeability factors.9
Over the last decade it has been well established that VEGF is crucial for normal angiogenesis and that it also plays an important role in pathological angiogenesis. However, it remains to be established whether VEGF is the sole causal angiogenic factor in the development of CNV. VEGF possesses many attributes for such a role. It is strongly and preferentially induced by hypoxia in RPE cells,14 it is invariably associated with human CNVMs and in laser CNV models in animals,3,5,15-19 it is strongly secreted from the basal side of the RPE toward the choroid, and high levels of VEGF receptors KDR and flt-4 are found on the choriocapillaris endothelium facing the RPE layer.20
However, the role of VEGF as the only causal agent in CNV has been questioned by evidence showing that VEGF is prominently expressed by RPE cells in epiretinal membranes in which there are no blood vessels21 and rats implanted suprachoroidally with slow release VEGF pellets show no leakage or development of CNV.22 In addition to VEGF, transforming growth factor-ß (TGF-ß), aFGF, and bFGF have also been localized to human CNVMs.4 CNV has been shown to develop in the minipig model when bFGF was perfused into the suprachoroidal space, although the neovascularization did not penetrate the Bruch’s membrane.7 However, mice with a targeted disruption of the bFGF gene are able to develop CNV after laser photocoagulation, suggesting it is not an absolute requirement for new blood vessel growth.23
To investigate the role of VEGF in the development of CNV, we have adopted a recombinant adenovirus gene delivery strategy previously shown to specifically target the rat RPE.24-27 A recombinant adenovirus vector containing the rat VEGF164 cDNA (AdCMV.VEGF) was used to determine whether short-term in vivo overexpression of VEGF in RPE cells was sufficient to cause CNV in the rat.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The rat VEGF164 amino acid splice form cDNA was cloned from RCS/rdy rat RPE cells grown under hypoxic conditions (2% O2). Reverse transcriptase-polymerase chain reaction (RT-PCR) was carried out using the primers AGCGGGATCCTCGCAGTCCGAGCCGGA and CTCCGGATCCCAAAGTGCTCCTCGAAG. These primers generated a PCR product of 804 bp containing the coding region of the rat VEGF164 splice variant, flanked by 61 bp of 5' UTR and 170 bp of 3' UTR. The PCR product was cloned into the BamHI site of pGEM11 (Promega, Madison, WI). After DNA sequence verification, the rat VEGF cDNA was subcloned into the adenovirus shuttle vector, pCA13 (Microbix Biosystems Inc., Toronto, ON) behind the human cytomegalovirus (CMV) immediate early promoter/enhancer (from -299 to +72) and before SV40 polyadenylation signals. pCA13 is used to construct replication-incompetent Ad5 vectors with inserts in the early region 1 (E1). The 293-cell line,28 transformed with Ad5, supplies the necessary E1 function in trans. The resultant plasmid, pCA13.VEGF, was co-transfected, using the Ca2PO4 precipitation method, into 293 cells along with ClaI-restricted AdRSV.ßgal DNA as the viral backbone. The resultant AdCMV.VEGF virus (E1/partial E3 deletion) underwent several rounds of cloning by limiting dilution on 293 cells. All viruses used in this study were expanded and purified on a two-step CsCl gradient.29 Titer of the viral stocks was determined by limiting dilution on 293 cells. AdRSV.ßgal,30 AdCMV.ßgal,31 and AdCMV.GFP32 have been described previously and were used as controls.
Cell Culture
The 293-cell line was obtained from Microbix Biosystems Inc., human umbilical cord endothelial cells (HUVEC) from the American Type Culture Collection (Manassas, VA), the Long Evans and RCS/rdy rat primary RPE cells were from M. Hall, Jules Stein Eye Institute of the University of California Los Angeles (Los Angeles, CA), and the human RPE 51 cells were isolated from the retina of a 51-year-old donor as previously described.33 All cell lines were maintained in Dulbecco’s modified Eagle’s medium (DMEM) with 10% fetal bovine serum. HUVEC cell medium was supplemented with 100 µg/ml of heparin and 37 µg/ml of endothelial cell growth supplement (ECGS; Sigma-Aldrich, St. Louis, MO).
VEGF mRNA and Protein Analysis
VEGF mRNA and protein analysis was carried out basically as described.34 For analysis of mRNA production from AdCMV.VEGF, 1 x 105 human RPE 51 cells were transduced at an multiplicity of infection (MOI) of 50. Total RNA was isolated from cell monolayers at different time points using Trizol reagent (Life Technologies, Grand Island, NY) according to the manufacturer’s instructions. Northern blots (10 µg of RNA) were hybridized using random primed rat VEGF cDNA. For analysis of the VEGF protein produced by AdCMV.VEGF, 1.5 x 106 human RPE 51 cells (in 1.5 ml medium) were transduced at MOIs of 50 and 200. Conditioned media was removed (10 µl) from the cells at different time points and subject to Western blot analysis. Endogenous VEGF secreted by RPE 51 cells was also subject to Western blot analysis following concentration of the conditioned medium (1.5 ml) on heparin sepharose CL-6B (Amersham Pharmacia Biotech, Uppsala, Sweden) as previously described.35 The enhanced chemiluminescence system (Amersham Pharmacia Biotech) was used to detect rat VEGF protein expressed from AdCMV.VEGF in conjunction with a rabbit polyclonal antibody raised against 1–191 amino acid of the human VEGF protein (Santa Cruz Biotechnology, Santa Cruz, CA).
HUVEC Proliferation Assay
Long Evans rat RPE cells were seeded in six-well plates at 106 cells/well. Recombinant adenovirus, AdCMV.ßgal, and AdCMV.VEGF were added at a MOI of 10 and left for 18 hours. The media was then replaced and the cells left for an additional 48 hours. The Long Evans rat RPE cell conditioned media were collected, diluted 1:10, 1:100, or 1:1000 and then added to 24-hour ECGS-starved HUVEC cells plated in 96-well plates at 5 x 102 cells/well. Heparin was added at 100 µg/ml to potentiate VEGF and VEGF receptor interactions.36 Seven days later, proliferation of the HUVEC cells was measured by incubating at 37°C in 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma-Aldrich) 0.7 mg/ml for 4 hours. The cells were lysed in 20% sodium dodecyl sulfate in 50% dimethylformamide, pH 4.7, for several hours and the OD read at 570 nm.
Subretinal Injections
Pigmented and nonpigmented RCS/rdy and DA rats were used for subretinal injections. The animals were anesthetized by a mixture of ketamine (40 mg/kg) and xylazine (6 mg/kg) delivered intramuscularly. The eyes were further treated with topical amethocaine drops and the pupils dilated with 1% tropicamide and 2.5% phenylephrine hydrochloride drops. The conjunctiva was cut close to the limbus to expose the sclera. A 30-gauge needle was used to make a shelving puncture of the sclera. A 32-gauge needle was then passed through this hole in a tangential direction under an operating microscope. For histology and fluorescein angiogram studies, 2 µl of AdCMV.VEGF (4 x 105, 4 x 106, 4 x 107, or 4 x 108 pfu/eye), AdRSV.ßgal (8 x 108 or 2 x 108 pfu/eye), or AdCMV.GFP (4 x 107 pfu/eye) was delivered to the subretinal space. Immediately after the subretinal injection a circular bleb was usually observed under the operating microscope. The success of each subretinal injection was further confirmed by the observation of a partial retina detachment as seen by indirect ophthalmoscopy. The needle was kept in the subretinal space for 1 minute, withdrawn gently, and antibiotic ointment applied to the wound site.
Fluorescein Angiography
Fluorescein angiography was performed as previously described with an intraperitoneal injection of 10% sodium fluorescein (0.2 ml) and a modified Canon CF-60ZA retinal camera (Kawasaki, Kawagawa, Japan).37 All animal procedures adhered to the Animal Use guidelines of the Association for Research in Vision and Ophthalmology.
In Situ Hybridization
For in situ hybridization, nonpigmented RCS/rdy rats were co-injected subretinally with AdCMV.VEGF (2 x 108 pfu/eye) and AdCMV.GFP (2 x 107 pfu/eye) which expresses green fluorescent protein when excited by UV light (490 nm). The purpose of using AdCMV.GFP was to help locate the injection site during sectioning. Four days later, the eyes were enucleated and snap-frozen in OCT compound (Sakura Fine Technical Co., Tokyo, Japan). Seven-micron sections were cut, fixed in 4% paraformaldehyde for 15 minutes, washed, dehydrated, then re-hydrated through graded methanol/phosphate buffered saline steps and washed in phosphate buffered saline/0.1% Triton X-100. The sections were subject to Pronase E (100 µg/ml) treatment followed by DNase (20 U/ml) treatment, both for 15 minutes at 37°C. Postfixing in 4% paraformaldehyde for 10 minutes was followed by rinsing the slides in phosphate buffered saline/0.1% Triton X-100 and then 2 x SSC. The sections were acetylated in 0.1 mol/L triethanolamine with acetic anhydride for 10 minutes at room temperature. Following further rinsing in 2 x SSC, the sections were dehydrated through graded ethanol steps and air-dried. A digoxigenin RNA labeling kit (Roche Molecular Biochemicals, Mannheim, Germany) was used to generate VEGF RNA probes according to the manufacturer’s instructions using a murine VEGF164 cDNA as the template DNA. The RNA probes were incubated on the sections at a concentration of 500 ng/ml overnight at 50°C. Color detection was carried out using the digoxigenin color detection kit as according to instructions (Roche Molecular Biochemicals). Tissue sections were counterstained with methyl green and mounted.
Histology
For histology, eyes were enucleated and fixed in 4% paraformaldehyde for 4 hours and embedded in paraffin. Five-micron sections were cut and hematoxylin/eosin-stained for light microscopy.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
AdCMV.VEGF was successfully produced by homologous recombination
in 293 cells. Southern blot analysis of recombinant adenovirus DNA
showed the correct restriction enzyme pattern for AdCMV.VEGF (data not
shown). Northern blot analysis demonstrated that the recombinant
adenovirus produced VEGF mRNA that could be detected as early as 6
hours after transduction (Figure 1A)
with
the expression increasing up to 72 hours. AdCMV.VEGF produced a VEGF
mRNA of 804 bp, which distinguished it from the endogenously produced
VEGF mRNA of approximately 3.7 kb. Endogenous VEGF mRNA could only be
detected after extended autoradiograph exposure (data not shown).
|
.
Endogenously produced VEGF could be demonstrated only in nontransduced
RPE 51-conditioned medium after concentration of approximately 150-fold
(Figure 1B)
. Biological Activity of AdCMV.VEGF
To test the biological activity of VEGF produced from AdCMV.VEGF,
a HUVEC proliferation assay was performed. HUVEC cells were sparsely
plated in 96-well plates in the presence of 100 µg/ml of heparin but
without any ECGS. The conditioned media from Long Evans rat RPE cells
that had been transduced with AdCMV.VEGF and AdCMV.ßgal (both MOI 10)
were added to the HUVEC cells in increasing dilutions. Seven days
later, the relative proliferation of HUVEC cells in the presence of
exogenous and endogenous VEGF was determined. In conditioned media
diluted 1:10, there was still sufficient endogenous VEGF and other
growth factors produced by nontransduced and control virus
AdCMV.ßgal-transduced Long Evans RPE cells to induce HUVEC cell
proliferation compared to the nonconditioned medium control (Figure 1C)
. However, AdCMV.VEGF-transduced Long Evans rat RPE cells induced
significantly more cell proliferation. At a 1:100 dilution, the effect
of endogenous VEGF was no longer detectable, whereas
AdCMV.VEGF-transduced Long Evans rat RPE cell-conditioned medium still
exerted a proliferative effect (Figure 1C)
. However, at a dilution of
1:1000, there was no longer sufficient VEGF produced from Long Evans
rat RPE cells transduced with AdCMV.VEGF at a MOI of 10 to induce HUVEC
cell proliferation.
Expression of Recombinant VEGF mRNA in Vivo
VEGF164 protein is normally secreted from
the cell to exert its influence on vascular endothelial cells. To
verify that it was the RPE cells that were overexpressing VEGF mRNA,
in situ hybridization was performed 4 days postinjection of
2 x 108
pfu of AdCMV.VEGF into the eyes of
nonpigmented RCS/rdy rats. VEGF mRNA was not detected in the RPE away
from the injection area (Figure 2A)
. In
contrast, very strong staining was seen in the RPE layer of AdCMV.VEGF
injected eyes within the injection area (Figure 2B)
. This is in
agreement with previous work showing that adenovirus preferentially
transduces rat RPE cells in vivo when delivered
subretinally.24
The inner nuclear layer showed very low
level staining, indicative of endogenous VEGF mRNA expression (data not
shown). It was also noted that the occasional cells in the neural
retina, possibly Müller cells, stained strongly for VEGF mRNA,
suggesting that adenovirus transduction of these cells had occurred
(data not shown).
|
To determine whether overexpression of VEGF in the RPE had a
vasopermeability effect on blood vessels, fluorescein angiograms used
to detect vascular leakage. Sixteen eyes of pigmented RCS/rdy rats were
subject to subretinal injection with AdCMV.VEGF. Four eyes were each
injected with 4 x 105, 4 x
106, 4 x 107
or
4 x 108
pfu. Two eyes were injected with
control viruses, AdRSV.ßgal (2 x 108
pfu)
and AdCMV.GFP (4 x 107
pfu). Fluorescein
angiography was used to determine the extent of vascular leakage. All
animals were observed 10 and 31 days postinjection; certain individual
animals were observed more frequently, as documented in Table 1
. The three AdCMV.VEGF (4 x
108
pfu)-injected eyes were followed for 56 days
postinjection and the AdRSV.ßgal-injected eye for 80 days
postinjection; however, there was no change to their day 31 leakage
scores. It was difficult to determine leakage in three eyes due to
hemorrhaging or corneal haziness after the subretinal injection, and
they were totally excluded from Table 1
. The results summarized in
Table 1
show that, in general, as the amount of AdCMV.VEGF injected
increased, the size of the vascular leakage area and the number of
leaky areas also increased. Inconsistencies in Table 1
were attributed
to the technical difficulty of subretinal injections, resulting in some
variability. A fluorescein angiogram representative of a control
phosphate buffered saline-injected eye and a virus control
AdRSV.ßgal-injected eye is shown (Figure 3, A and B)
. The effect of AdCMV.VEGF at
the four different dilutions, 4 x 105
(Figure 3C)
, 4 x 106
(Figure 3D)
, 4 x
107
(Figure 3E)
, and 4 x
108
pfu (Figure 3F)
, representing the four
leakage scores, are also shown. Areas of intense white indicate
fluorescein leakage and are shown by the arrows. The leaky area at
4 x 106
pfu (Figure 3D)
was small and
localized to the area surrounding the injection site, whereas the
higher titer injections show leakage in the circular pattern of the
bleb caused during the injection (Figure 3F)
.
|
|
To determine whether the leakage detected by fluorescein
angiography preceded new blood vessel formation and was not due only to
leakage from existing blood vessels, eyes were harvested 80 days
postinjection and analyzed by histology. Normal rat retina is shown in
Figure 4, A and B
. Eyes injected with
high titers (8 x 108
pfu) of the control
virus, AdRSV.ßgal, showed no change except a small area around the
injection site. The injection site was identified by sclera damage from
the needle insertion (low magnification, Figure 4C
, black arrows). The
detachment of neural retina from the RPE cell layer on both sides of
the scar was caused during fixation and, provided all cell layers were
present, was considered normal. There were no major morphological
changes after the injection of AdRSV.ßgal except for a small area of
photoreceptor cell loss directly above the needle insertion site
(Figure 4C
, white arrows). Higher magnification shows the small
nonvascular scar that had formed, consisted of several layers of RPE
cells with reduced pigmentation (Figure 4D)
. The appearance of
nonvascular scar tissue observed in AdRSV.ßgal-injected eyes was in
strong contrast to eyes injected with AdCMV.VEGF. Of the 15 eyes
injected with AdCMV.VEGF that were examined, 12 showed some degree of
CNV. Three eyes injected with the lowest concentration of AdCMV.VEGF
showed no evidence of new blood vessels. Two of the examined eyes also
showed evidence of severe retinal degeneration thought to be a result
of the injection trauma. A CNV score for each eye is shown in Table 1
along with the corresponding leakage score. At relatively low titers of
4 x 105
and 4 x
106
pfu, highly vascularized CNVMs were observed
with overlying photoreceptor cell loss (Figure 4E
, black arrow). These
CNVMs were located away from the needle penetration site, as indicated
by no visible scleral damage. Under higher magnification, the nuclei of
vascular endothelial cells were clearly visible within the CNVM (Figure 4F
, black arrows). The higher titers of AdCMV.VEGF (4 x
107
and 4 x 108
pfu/eye) caused major disruptions to the RPE and photoreceptor layers
of the retina (Figure 4G and 4H
; 4 x 108
pfu/eye). Many new blood vessels (Figure 4G
, white arrows) and their
erythrocytes (Figure 4H, 4
x 108
pfu, black
arrow) can be seen extending from the choroid toward the neural retina
surrounded by proliferating RPE cells. The inner nuclear layer in the
more severe cases were also showing signs of degeneration. At the
higher titers of AdCMV.VEGF it was not unusual to see large blood
vessels in the inner nuclear layer, suggesting that retinal vessel
dilation had also occurred (Figure 5
,
white arrows).
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Alternatively, the needle puncture of Bruch’s membrane, which was required in this study to gain access to the subretinal space, could play a role in the development of the observed CNV. It has long been proposed that compromise of the intact barrier between the retina and choroid can lead to CNV.41 Although it is a rare complication, choroidal blood vessels are known to grow through induced breaks in Bruch’s membrane after surgery for retinal detachment.42,43 However, the frequency and severity of CNV observed in this study was much greater than that reported in surgical cases. In addition, vascular leakage and CNV extended far beyond the initial puncture site, whereas no evidence of CNV was observed in any control virus injections. This data also show that the amount of AdCMV.VEGF injected correlates to the extent of the resulting CNV. Nonetheless, using this experimental approach, we cannot completely discount the importance of rupturing Bruch’s membrane. The development of a suitable transgenic model or a less invasive injection route may help clarify this point.
In this study, recombinant adenovirus-mediated delivery of VEGF to the subretinal space resulted in the overexpression of VEGF in the RPE. This is in agreement with previous studies showing that subretinal mediated delivery of adenovirus vectors leads to transduction of the RPE.24-27 The duration of VEGF expression in this study was likely to have been short-term, as transgene expression in the RPE from subretinally delivered adenovirus vectors in immunocompetent hosts is generally transient in nature. It has been shown previously that by 3 to 4 weeks postinjection, most transgene expression from subretinally delivered recombinant adenovirus, as determined histologically, has disappeared,24,27,44 although individual positive cells can be detected for longer.25 Thus, the generation of CNV in this model required only short-term expression of VEGF in RPE cells, which was sufficient to induce permanent vascular structures at 80 days postinjection.
Previous experiments have shown that sustained intravitreal delivery of VEGF in animal models can cause widespread retinal vascular dilation.45 Similarly, it was observed in this study that eyes subretinally injected with the higher titers of AdCMV.VEGF showed dilation of retinal blood vessels in addition to CNV. One explanation is that neural retina cells were transduced with AdCMV.VEGF, leading to retinal expression of VEGF. This is supported by the in situ hybridization results that showed strong VEGF mRNA expression 4 days postinjection in the occasional neural retina cell. It has been noted previously that subretinal injection can lead to transgene expression in Müller cells.24,27 Alternatively, retinal blood vessel dilation could be the result of VEGF secreted in an apical direction from RPE cells. Apical secretion of VEGF does occur in RPE cells, albeit at a lower level than basal secretion.20 It remains to be determined whether the RPE cells transduced with AdCMV.VEGF and producing large amounts of VEGF are able to maintain the normal apical/basal expression ratio.
Although we showed that overexpression of VEGF in RPE cells is sufficient to induce CNV in the rat, we cannot exclude a role for other growth factors in the pathogenesis of human CNV. In addition to VEGF, transforming growth factor-ß (TGF-ß), aFGF, and bFGF have also been localized to human CNVMs, and it has been proposed that bFGF and aFGF, which contain no signal sequence for secretion, can be released from damaged RPE cells.4 Recent studies have suggested that VEGF and bFGF act synergistically on vascular endothelial cell proliferation,46,47 and it has been observed that VEGF isoforms containing exon 6 can release bioactive bFGF that had been sequestered by the extracellular matrix.48 Although VEGF may have a primary role in the development of human CNV, it likely does so in concert with bFGF and other growth factors.
Our model relies on the sudden and strong overexpression of VEGF that is unlikely to occur in the development of human CNV disease. Instead, in age-related macular degeneration patients, it is thought that the accumulated changes associated with aging gradually result in conditions suitable for CNV development. It has been suggested that chronic ischemia is one such condition, perhaps as a result of poor choroidal circulation.49 Ischemia could also potentially result from large drusen deposits becoming confluent, which is known to increase the risk of vascular invasion.2 Along with in vitro evidence showing VEGF can be up-regulated under hypoxic conditions,13 this has led to the proposal that CNV development is the result of RPE cells up-regulating VEGF expression due to an ischemic stimulus.50 Our results lend support to this hypothesis by showing that VEGF overexpression in the RPE is sufficient to induce CNV and, as such, is an ideal candidate for targeted anti-angiogenic gene therapy in the eye.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Supported by Meditech Research, Ltd (Australia).
Accepted for publication March 7, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  O. Tatar, K. Shinoda, E. Kaiserling, G. Pertile, C. Eckardt, A. Mohr, E. Yoeruek, P. Szurman, K. U. Bartz-Schmidt, and S. Grisanti Early Effects of Triamcinolone on Vascular Endothelial Growth Factor and Endostatin in Human Choroidal Neovascularization Arch Ophthalmol, February 1, 2008; 126(2): 193 - 199. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. G. Marneros, H. She, H. Zambarakji, H. Hashizume, E. J. Connolly, I. Kim, E. S. Gragoudas, J. W. Miller, and B. R. Olsen Endogenous endostatin inhibits choroidal neovascularization FASEB J, December 1, 2007; 21(14): 3809 - 3818. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Chen, Y. Hu, K. Lu, J. G. Flannery, and J.-x. Ma Very Low Density Lipoprotein Receptor, a Negative Regulator of the wnt Signaling Pathway and Choroidal Neovascularization J. Biol. Chem., November 23, 2007; 282(47): 34420 - 34428. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Tatar, A. Adam, K. Shinoda, T. Eckert, G. B Scharioth, M. Klein, E. Yoeruek, K. U. Bartz-Schmidt, and S. Grisanti Matrix metalloproteinases in human choroidal neovascular membranes excised following verteporfin photodynamic therapy Br. J. Ophthalmol., September 1, 2007; 91(9): 1183 - 1189. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A view on new drugs for macular degeneration DTB, July 1, 2007; 45(7): 49 - 52. [Full Text] [PDF]
|
|
|
|
|
|
M. L. Springer, A. Banfi, J. Ye, G. von Degenfeld, P. E. Kraft, S. A. Saini, N. K. Kapasi, and H. M. Blau Localization of vascular response to VEGF is not dependent on heparin binding FASEB J, July 1, 2007; 21(9): 2074 - 2085. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Ma, S. E. Lee, J. Guo, W. Qu, B. I. Hudson, A. M. Schmidt, and G. R. Barile RAGE Ligand Upregulation of VEGF Secretion in ARPE-19 Cells Invest. Ophthalmol. Vis. Sci., March 1, 2007; 48(3): 1355 - 1361. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Tatar, K. Shinoda, A. Adam, T. Eckert, C. Eckardt, K. Lucke, C. Deuter, K. U. Bartz-Schmidt, and S. Grisanti Effect of verteporfin photodynamic therapy on endostatin and angiogenesis in human choroidal neovascular membranes Br. J. Ophthalmol., February 1, 2007; 91(2): 166 - 173. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. T.V.M. de Jong Age-Related Macular Degeneration N. Engl. J. Med., October 5, 2006; 355(14): 1474 - 1485. [Full Text] [PDF]
|
|
|
|
 |
|
 E. W.M NG and A. P ADAMIS Anti-VEGF Aptamer (Pegaptanib) Therapy for Ocular Vascular Diseases Ann. N.Y. Acad. Sci., October 1, 2006; 1082(1): 151 - 171. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. A. Costa, R. Jorge, D. Calucci, J. A. Cardillo, L. A. S. Melo Jr, and I. U. Scott Intravitreal Bevacizumab for Choroidal Neovascularization Caused by AMD (IBeNA Study): Results of a Phase 1 Dose-Escalation Study. Invest. Ophthalmol. Vis. Sci., October 1, 2006; 47(10): 4569 - 4578. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Cashman, L. Bowman, J. Christofferson, and R. Kumar-Singh Inhibition of Choroidal Neovascularization by Adenovirus-Mediated Delivery of Short Hairpin RNAs Targeting VEGF as a Potential Therapy for AMD. Invest. Ophthalmol. Vis. Sci., August 1, 2006; 47(8): 3496 - 3504. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. G. Slomiany and S. A. Rosenzweig Hypoxia-Inducible Factor-1-Dependent and -Independent Regulation of Insulin-Like Growth Factor-1-Stimulated Vascular Endothelial Growth Factor Secretion J. Pharmacol. Exp. Ther., August 1, 2006; 318(2): 666 - 675. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Neu, A. Afzal, H. Pan, E. Gallego, N. Li, S. L. Calzi, S. Caballero, P. E. Spoerri, L. C. Shaw, and M. B. Grant The dipeptide arg-gln inhibits retinal neovascularization in the mouse model of oxygen-induced retinopathy. Invest. Ophthalmol. Vis. Sci., July 1, 2006; 47(7): 3151 - 3155. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Tatar, E. Kaiserling, A. Adam, F. Gelisken, K. Shinoda, M. Volker, B. A. Lafaut, K. U. Bartz-Schmidt, and S. Grisanti Consequences of verteporfin photodynamic therapy on choroidal neovascular membranes. Arch Ophthalmol, June 1, 2006; 124(6): 815 - 823. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C-M Lai, S A Dunlop, L A May, M Gorbatov, M Brankov, W-Y Shen, N Binz, Y K. Lai, C E Graham, C J Barry, et al. Generation of transgenic mice with mild and severe retinal neovascularisation Br. J. Ophthalmol., July 1, 2005; 89(7): 911 - 916. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G B Arden, R L Sidman, W Arap, and R O Schlingemann Spare the rod and spoil the eye Br. J. Ophthalmol., June 1, 2005; 89(6): 764 - 769. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. B. Bhisitkul, G. S. Robinson, R. S. Moulton, K. P. Claffey, E. S. Gragoudas, and J. W. Miller An Antisense Oligodeoxynucleotide Against Vascular Endothelial Growth Factor in a Nonhuman Primate Model of Iris Neovascularization Arch Ophthalmol, February 1, 2005; 123(2): 214 - 219. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N.H. V. Chong, J. Keonin, P. J. Luthert, C. I. Frennesson, D. M. Weingeist, R. L. Wolf, R. F. Mullins, and G. S. Hageman Decreased Thickness and Integrity of the Macular Elastic Layer of Bruch's Membrane Correspond to the Distribution of Lesions Associated with Age-Related Macular Degeneration Am. J. Pathol., January 1, 2005; 166(1): 241 - 251. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. G. Slomiany and S. A. Rosenzwe |
