| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |


From the Department of Pathology,*
Brigham and Womens
Hospital, Boston, Massachusetts; the Department of
Pathology,
Childrens Hospital Boston,
Massachusetts; and the Department of Pediatric
Oncology,§
Dana-Farber Cancer Institute,
Boston, Massachusetts; and the Department of
Pathology,
University of California, San
Diego Medical Center, San Diego, California
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The uncertain pathogenesis of IMTs, and the ongoing question of its neoplastic versus reactive nature, is reflected in the large number of names which have been bestowed on this disorder. IMTs arising in the lung, particularly those that are well circumscribed, are generally cured by surgical excision. Until recently, these were referred to as "plasma cell granulomas," "inflammatory pseudotumors," or "pseudosarcomatous myofibroblastic proliferations." Intra-abdominal IMTs may pursue a somewhat more aggressive clinical course with multiple recurrences and with potential for metastatic spread in rare cases. Such tumors have often been referred to as "inflammatory myofibroblastic tumor" or "inflammatory fibrosarcoma."1,2 However, most IMTs have overlapping histological characteristics and it is difficult to distinguish those with neoplastic potential from the potentially reactive subset that belong under the umbrella category of "inflammatory pseudotumor." Another complicating feature, with respect to classification, is that differences in clinical behavior, between different IMT subcategories, do not exclude a common pathogenesis.
Cytogenetic banding studies were the first assays to demonstrate unequivocal clonal mutationsindicative of a neoplastic pathogenesisin IMTs.5-10 Approximately 50% of soft-tissue IMT karyotypes contain clonal rearrangements of the chromosome 2 short arm,5-10 and each of two cytogenetically characterized IMTs arising in bone contained rearrangements of the HMGIC region on chromosome band 12q15.8 Recently, Griffin et al10 showed that IMT 2p rearrangements fall within an ~100-kb region containing the ALK receptor tyrosine-kinase locus, on chromosome band 2p23. These rearrangements were associated with striking ALK expression in the IMT myofibroblastic spindle cells.10 ALK is a receptor tyrosine kinase that was originally characterized as a component of the anaplastic large-cell lymphoma NPM-ALK fusion oncoprotein.11 ALK expression is normally restricted to the central nervous system,12-14 and expression of constitutively activated ALK, in anaplastic large-cell lymphoma, seems to be a pivotal transforming event. High-level ALK expression, in IMTs, is notable because ALK is expressed at low or undetectable levels in nonneoplastic fibroblasts. These findings suggest that IMTs might be neoplasms in which the myofibroblastic component is transformed, in some cases, by chromosomal mechanisms targeting ALK.
In the present study we show that chromosome 2p rearrangements in IMTs create ALK fusion genes. We characterize two such genes, tropomyosin 4 (TPM4)-ALK and tropomyosin 3 (TPM3)-ALK, and provide evidence for at least two additional fusion mechanisms that remain to be characterized. These studies also identify a diagnostically useful molecular marker in IMTs.
| Materials and Methods |
|---|
|
|
|---|
Immunostaining
All cases were re-evaluated histologically by three of the authors (APA, BPR, and CDMF). ALK immunostaining was performed using monoclonal antibody ALK-1 (DAKO, Carpinteria, CA) at a dilution of 1:50 after antigen retrieval, by pressure steaming, in an ethylenediaminetetraacetic acid solution (pH 8.0). Antibody detection was accomplished using a labeled streptavidin-biotin LSAB+ (DAKO) method.
5'-Rapid Amplification of cDNA Ends (RACE) and DNA Sequencing
Total RNA was extracted from frozen tissue using Trizol (Life Technologies, Inc., Gaithersburg, MD), according to the manufacturers protocol. One µg of RNA was then used for RACE using the Marathon Kit (Clontech, Palo Alto, CA) according to the manufacturers protocol. First round polymerase chain reaction (PCR) was with the Marathon kit AP1 adapter primer and ALK reverse primer ALK/4436/R (5'-CTGTTGAGAGACCAGGAGAGGAGGAA) at 94°C for 30 seconds and 68°C for 8 minutes for 25 cycles. Second round PCR was with the Marathon kit AP2 adapter primer and ALK reverse primer ALK/4161/R, (5'-ACTTCCTGGTTGCTTTTGCTGGGGTAT) at 94°C for 30 seconds and 68°C for 8 minutes for 30 cycles. A single RACE product band was observed and was gel purified using the Qiaquick gel extraction kit (Qiagen, Valencia, CA), and the RACE fragment was then cycle sequenced in forward and reverse directions using the AP2 primer and ALK reverse primer ALK/3638/R (5'-AATCCAGTTCGTCCTGTTCAGAGCACA), respectively. Cycle sequencing was performed using ABI BigDye terminators, and the sequences were analyzed using an ABI Prism 310 automated sequencer (Applied Biosystems, Foster City, CA).
Fluorescence in Situ Hybridization
Interphase cells from IMT case 1 were spread on glass slides and denatured according to standard protocols. Hybridization and washing steps were performed as described.15 ALK and TPM4 region rearrangements were evaluated using a dual-color ALK split-apart probe (Vysis, Downers Grove, IL) and a yeast artificial chromosome clone, 766_E_7, mapping to chromosome band 19p13.1, which was labeled 50:50 biotin:digoxigenin by random octamer priming.15 Detection was with streptavidin-fluorescein isothiocyanate (Zymed Laboratories, South San Francisco, CA) and rhodamine anti-digoxigenin (Zymed), and nuclei were counterstained with 0.4 mg/ml 4,6-diamidino-2-phenylindole-dihydrochloride. Images were captured using a charge-coupled device camera (Photometrics, Tucson, AZ).
RT-PCR and DNA Sequencing
Total RNAs were extracted from frozen tissue specimens using Trizol (Life Technologies, Inc.) and from paraffin-embedded tissues after a 5-day sodium dodecyl sulfate-proteinase K digestion.16 One µg of the RNAs were reverse transcribed (GeneAmp Kit; Perkin Elmer, Norwalk, CT) using the ALK/3638/R primer. TPM3-ALK and TPM4-ALK fusion genes were evaluated using a nested PCR method that was optimized for detection of either TPM3 or TPM4 fusions in the extensively degraded RNAs isolated from paraffin sections. The TPM primers correspond to regions of near sequence identity in TPM3 and TPM4 and, hence, anneal effectively to both genes. First-round PCR was with TPM3/249/F (5'-ACTGATAAACCCAAGGAGGCAGAGA) and ALK/3455/R (5'- AGGTCTTGCCAGCAAAGCAGTAGTT) at 94°C for 30 seconds, 67 to 62°C (touchdown) for 30 seconds, and 72°C for 30 seconds for 10 cycles, and then 94°C for 30 seconds, 62°C for 30 seconds, and 72°C for 30 seconds for 25 cycles. Second-round PCR was with TPM3/269/F (5'- AGAGACCCGTGCTGAGTTTGCTGA) and ALK/3399/R (5'- CGGAGCTTGCTCAGCTTGTACTC) at 94°C for 30 seconds, and 68°C for 30 seconds for 30 cycles. Five microliters of the second-round PCR product were gel purified and cycle sequenced using the ALK/3399/R primer to determine whether the tropomyosin-derived sequence was contributed by TPM3 or TPM4. TPM-ALK fusions were also subtyped using first-round TPM-ALK reverse transcriptase (RT)-PCR template (as described above) in a second-round PCR with a TPM3-specific forward primer, TPM3/284/F (5'-GTTTGCTGAGCGATCGGTAGCCAAGC) and ALK/3399R at 94°C for 30 seconds, and 68°C for 30 seconds for 30 cycles. Nested RT-PCR was required for consistent detection of the TPM-ALK fusion transcripts, irrespective of whether RNAs were isolated from frozen or paraffin specimens.
Integrity of both frozen tumor and paraffin-derived RNAs was evaluated by nested RT-PCR for the ubiquitously expressed glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene. Reverse transcription was performed using random primers (GeneAmp Kit, Perkin Elmer), and first-round PCR was performed using GAPDH/177/F (5'-CCTCAACTACATGGTTTACATGTTC) and GAPDH/488/R (5'-CTGTTGTCATACTTCTCATGGTTCA) at 94°C for 30 seconds and 70 to 60°C (touchdown) for 1 minute for 10 cycles, and then 94°C for 30 seconds, and 60°C for 1 minute for 25 cycles. Second-round PCR was with GAPDH/250/F (5'-AACGGGAAGCTTGTCATCAAT) and GAPDH/427/R (5'-CAGAGATGATGACCCT- TTTGG) at 94°C for 30 seconds, and 62°C for 30 seconds for 30 cycles.
In Vitro Kinase Assay and Western Blotting
Protein lysates were isolated from frozen tumor tissue in IMT
cases 1 and 2 and from a non-IMT spindle-cell sarcoma.
Three-mm3
tumor pieces were minced in ice-cold
lysis buffer (1% Nonidet P-40, 50 mmol/L Tris, pH 8.0, 100 mmol/L
sodium fluoride, 30 mmol/L sodium pyrophosphate, 2 mmol/L sodium
molybdate, 5 mmol/L ethylenediaminetetraacetic acid, 2 mmol/L sodium
vanadate, 10 µg/ml aprotinin, 10 µg/ml leupeptin, and 100 µg/ml
phenylmethylsulfonyl fluoride), homogenized further by 10 to 20 strokes
of a Dounce homogenizer, then rocked for 45 minutes at 4°C. Residual
cell debris was removed by centrifugation, and supernatant protein
concentrations were determined using the BioRad MMT assay. Cell
lysates (1.5 mg) were precleared with 20 µl of Protein G Sepharose
(Zymed Laboratories) for 1 hour at 4°C, followed by sequential
additions of 50 µl of anti-ALK hybridoma supernatant (ALK1; DAKO) and
20 µl of Protein G Sepharose with end-to-end rotation for 2 hours at
4°C after each addition. The immunoprecipitates were then washed
three times in lysis buffer and twice in kinase buffer (20 mmol/L
HEPES, pH 7.4, 10 mmol/L sodium fluoride, 10 mmol/L magnesium
chloride, 10 mmol/L manganese chloride, 1 mmol/L sodium vanadate)
before incubation in 20 µl of fresh kinase buffer containing 5 µCi
32P-(
)-ATP for 15 minutes at 25°C. Kinase
reactions were stopped by addition of sodium dodecyl
sulfate-polyacrylamide gel electrophoresis loading buffer, and 15 µl
of each reaction were resolved on 4 to 12% sodium dodecyl
sulfate-polyacrylamide gel electrophoresis gradient gels followed by
electrophoretic transfer to polyvinylidene difluoride membranes
(Millipore, Bedford, MA) and autoradiography. Tyrosylphosphorylation
was evaluated by staining the membranes with PY99 anti-phosphotyrosine
monoclonal antibody (Santa Cruz Biotechnology, Santa Cruz, CA). The
membranes were then stripped and restained with a rabbit anti-ALK
polyclonal antiserum (Sanbio, Uden, The Netherlands). Both PY99
and anti-ALK were detected by chemiluminescence (ECL; Pierce, Rockford,
IL).
| Results |
|---|
|
|
|---|
The 11 cases showed typical histomorphological features of IMTs,
being composed of a variably cellular proliferation of plump,
spindle-shaped fibroblasts/myofibroblasts set in a collagenous or
myxoid stroma containing numerous lymphocytes and plasma cells. The IMT
fibroblasts/myofibroblasts showed mild to moderate variation in
nuclear size but there was no significant nuclear hyperchromasia or
pleomorphism. Seven of 11 IMTs were ALK immunopositive, all having
strong staining of 50 to 90% of the lesional spindle cells (Table 1
, Figure 1A
). The ALK immunostaining was
cytoplasmic in six cases and nuclear in one, the latter being
concentrated in the nuclear membrane with no nucleolar accentuation.
ALK immunostaining was not detected in the IMT stromal inflammatory
cells (Figure 1A)
.
|
|
Cytogenetic analysis of IMT case 1 demonstrated a translocation
involving the chromosome band 2p23 ALK locus region and an
unidentified partner chromosome. FISH analysis demonstrated that the
2p23 rearrangement was within 200 kb of the ALK locus
(Figure 1B)
. 5'-RACE was then performed to evaluate the possibility of
a translocation-related ALK fusion transcript. A single RACE
product of ~1,650 bp was obtained using ALK-specific
primers corresponding to the ALK kinase domain. Sequence analysis
demonstrated that the 1,650-bp RACE product was an in-frame fusion of
the TPM4 and ALK genes. The predicted fusion
protein contains all but the 27 most C-terminal amino acids of TPM4,
joined (TIDDLE::VYRRKH) to the ALK juxtamembrane and kinase
domains. The ALK fusion breakpoint is identical to those in
NPM-ALK and TPM3-ALK fusions in anaplastic
large-cell lymphoma.11,17
The TPM4 locus maps
to chromosome band 19p13.1, and FISH confirmation of
TPM4-ALK fusion was obtained by co-hybridization of a
dual-color ALK FISH probe and a yeast artificial chromosome
clone, 766_E_7, mapping centromeric to the chromosome band 19p13.1
TPM4 locus (Figure 1C)
.
The first 186 bp of the TPM4-ALK 5'-RACE sequence differs
from the TPM4 sequence published previously. Both the
variant and previously published TPM4 transcripts contain
three TPM signature sequences, and virtually the entire protein
sequence, in each case, is expected to form a coiled-coil structure.
However, the variant TPM4 transcript lacks the first two
in-frame ATG codons found in the published TPM4, and hence
has a smaller open reading frame. Alternate TPM4-ALK fusion
transcripts containing the variant (designated type 1 hereafter) and
published (designated type 2 hereafter) 5' ends were evaluated by
RT-PCR using type 1- (5'-CGAGGCTCCCCCGCCTCGTC-3') or type 2-
(5'-GCCATGGCCGGCCTCAACTCC-3') specific forward primers and a common
reverse primer, ALK/3369/R (5'-TGCAGCTCCATCTGCATGGCTTG-3').
TPM4-ALK type 1 (609 bp) and TPM4-ALK type 2 (716
bp) RT-PCR products were detected reproducibly on each of three
separate PCR runs (Figure 2)
and
confirmed by sequencing (TPM4-ALK type 1 =
GenBank AF186110, and TPM4-ALK type 2 = GenBank
AF186109).
|
The coding sequences for TPM4 and TPM3 are
highly homologous, and the TPM3 locus maps to chromosome
bands 1q22-23. Notably, IMT case 2 contained a balanced translocation,
t(1;2)(q21;p23), suggestive of a TPM3-ALK fusion
event. We directed primers to homologous and nonhomologous regions of
TPM3 and TPM4, to establish RT-PCR screening
approaches detecting both TPM3-ALK and TPM4-ALK
fusions (method 1) versus TPM3-ALK fusion only
(method 2). Evaluation of 11 IMTs confirmed detection of a
TPM-ALK fusion in case 1 (TPM4-ALK) by
RT-PCR method 1 but not by method 2 (Figure 3)
. By contrast, fusion sequences,
consistent with TPM3-ALK, were identified by methods 1 and 2
in IMT cases 2 and 3 (Figure 3)
. Sequence analysis confirmed
TPM3-ALK fusions in the latter two cases. The
TPM3-ALK fusion breakpoints were identical to those reported
recently in anaplastic large-cell lymphoma,17
and the
TPM3 and ALK breakpoints were homologous and
identical, respectively, to the TPM4 and ALK
breakpoints in IMT case 1 (Figure 4)
.
|
|
Detection of putative ALK fusion proteins, and evaluation of
tyrosine kinase activities, was accomplished by anti-ALK
immunoprecipitation in protein lysates from IMT case 1
(TPM4-ALK) and case 2 (TPM3-ALK).
In vitro kinase assays revealed similar patterns of putative
ALK fusion proteins in the IMT but not in a non-IMT spindle cell
sarcoma (Figure 5A)
. Both IMTs contained
three kinase-active proteins ranging in size from 80 to 95 kd.
Confirmation of tyrosylphosphorylated ALK forms was then obtained by
sequential restaining with anti-phosphotyrosine and a polyclonal
anti-ALK antibody (Figure 5, BC)
. Notably, anti-ALK staining also
revealed a 200-kd protein, consistent with native ALK, which was
expressed strongly and weakly in IMT cases 1 and 2, respectively, and
which lacked in vitro kinase activity and
tyrosylphosphorylation.
|
| Discussion |
|---|
|
|
|---|
Receptor tyrosine-kinase oncogenes have been described in many tumors,
and the usual mechanisms of activation are point mutations or gene
fusions that result in constitutive, ligand-independent, receptor
oligomerization. Fusion receptor tyrosine-kinase oncoproteins are
typically composed of an N-terminal sequence, encoded by the non-RTK
member of the fusion pair, containing one or more oligomerization
domains and replacing the RTK transmembrane and/or extracellular
domains. Our studies indicate that either TPM3 or TPM4 can contribute
oligomerization domains to ALK fusion oncoproteins in IMTs. Notably,
the TPM3 sequences contained in IMT ALK oncoproteins are identical to
those found in TPM3-NTRK1 oncoproteins in papillary thyroid
carcinoma.18
TPM3 contributes a coiled-coil
self-association domain to the TPM3-NTRK1 oncoprotein and consequently
enables constitutive oligomerization and NTRK1 kinase activation.
Moreover, while our studies were in progress, TPM3-ALK
oncogenic fusions, containing the same TPM3 sequence, were
reported in a subset of anaplastic large-cell lymphomas.17
The TPM3-ALK and TPM4-ALK IMT fusion genes are
highly homologous in that the TPM gene sequences in each case encode a
related series of coiled-coil domains. In addition, the fusion
breakpoints are found in the corresponding location for both genes
(Figure 4)
. TPM3-ALK and TPM4-ALK are constitutively active
oncoproteins, as evidenced by high-level, ligand-independent, kinase
activity and resultant tyrosylphosphorylation (Figure 5)
.
TPM3 and TPM4 are highly expressed in mesenchymal
cell lineages: hence, both genes are expected to contribute active
promoter regions to the IMT ALK fusion
genes.19-21
Physiological ALK expression, by contrast, is
primarily restricted to the central nervous system and is low,
specifically, in nonneoplastic mesenchymal cells.12
Nonetheless, our studies reveal 200-kd ALK, consistent with expression
of a native, nonfusion, ALK protein and encoded presumably by the
nontranslocated allele, in neoplastic IMT myofibroblasts (Figure 5C)
.
Therefore, ALK signaling pathways might be important biologically in
IMT nonneoplastic progenitor cells. These pathways, when activated
constitutively, might contribute to neoplastic transformation. It will
be intriguing to determine whether other myofibroblastic neoplasms,
particularly those arising in children and young adults, result from
ALK activation. A speculative, but intriguing, aspect of the TPM-ALK
oncogenic mechanism is the possible interference, through
heterodimerization, with normal TPM cellular functions. Although there
is no direct evidence for a dominant-negative TPM-ALK mechanism,
several observations indicate a tumor suppressor role for certain TPM
isoforms. It is known that TPM expression can suppress the transformed
phenotype in both src- and ras-transformed fibroblasts.22
Furthermore, TPMs are down-modulated, in part through decreased
synthesis, in various retrovirus-induced neoplasms.23,24
These findings suggest that interference with normal TPM function,
which would potentially result from heterodimerization with TPM-ALK
oncoproteins, might contribute to neoplastic transformation of IMT
progenitor cells.
Both TPM4-ALK and TPM3-ALK fusions were
identified in this series of IMTs (Table 1)
. Myofibroblasts with
TPM4-ALK and TPM3-ALK fusions featured intense,
predominantly cytoplasmic, ALK staining patterns (Figure 1A)
, in
keeping with that reported for the TPM3-ALK oncoprotein in anaplastic
large-cell lymphoma.17
Four other IMTs expressed ALK at
high levels but did not seem to contain TPM-ALK (cases 4 to
7; Table 1
and Figure 3
) or NPM-ALK (data not shown)
fusions. These cases included three in which ALK localization was
cytoplasmic (cases 4, 5, and 6) and one in which ALK localization was
seen mainly in the nuclear membrane (case 7). None of the cases
demonstrated the nucleolar localization typical of NPM-ALK fusion
oncoproteins. Previous studies, in anaplastic large-cell lymphoma, have
shown that cellular sublocalization patterns, for the various ALK
fusion oncoproteins, are consistent and distinctive.25-27
In some cases, eg, NPM-ALK, a characteristic localization results from
shuttling of fusion oncoprotein heterodimers to those cellular
structures with which the ALK fusion partner is normally
associated.28
The subcellular localization patterns
establish morphological signatures for the different ALK fusion
proteins, notwithstanding the fact that the major site of oncogenic
actionat least with respect to activation of ALK signaling
pathwaysis undoubtedly cytoplasmic.26-28
Therefore, our
data imply the existence of at least two alternative ALK fusion
mechanisms in IMTs, and these putative fusions likely involve proteins
that are predominantly cytoplasmic (cases 4, 5, and 6) and
predominantly nuclear (case 7) in their native localization.
The studies described herein are of clinical relevance inasmuch as the
clinical behavior of IMT is often difficult to predict. IMTs can be
confused with various benign and malignant spindle-cell neoplasms or,
alternatively, with various inflammatory nonneoplastic processes.
Consequently, evaluation of ALK rearrangement and ALK
expression will likely be useful in distinguishing IMTs from other
myofibroblastic proliferations. Our preliminary studies show that ALK
is not expressed in a variety of non-IMT lesions, including nodular
fasciitis, inflammatory liposarcoma, inflammatory leiomyosarcoma, and
angiomatoid malignant fibrous histiocytoma, whichakin to IMTare
characterized by neoplastic spindle cells admixed with an inflammatory
component (CDM Fletcher, unpublished data). Based on our initial data,
it seems that a substantial subset of IMTs will contain TPM-ALK
fusions, whereas other cases will likely contain ALK fusions
involving genes other than TPM3 and TPM4. Still
other IMTs, as evidenced by the absence of immunohistochemical ALK
staining in a subset of cases (Table 1
, cases 8 to 11), probably lack
ALK fusion genes. This pathogenetic heterogeneity is
reminiscent of that in anaplastic large-cell lymphomas, where tumors
are increasingly divided into ALK-positive and ALK-negative categories.
Indeed, there is a growing sense that ALK status (rearranged and
expressed versus wild-type and nonexpressed) discriminates
between two fundamentally different types of anaplastic large-cell
lymphomas.29-31
Notably, the four ALK-negative IMTs in
this series (Table 1)
were diagnosed in 40- to 50-year-old patients,
whereas the seven ALK-positive IMTs were diagnosed in patients younger
than 30 years old. These data suggest that IMTs in children and young
adults might depend generally on ALK activation, whereas IMTs in older
adults might represent a different disease and/or have different
transforming mechanisms. However, additional studies are required to
determine whether ALK status correlates with histopathological features
and clinical behavior in IMT.
It is intriguing that ALK fusion genes, including an identical TPM3-ALK fusion, are found in both anaplastic large-cell lymphoma and IMTs.11,17,32-34 However, the preferred ALK fusion partners differ in anaplastic large-cell lymphoma and IMT. NPM-ALK fusions, found in 80% of anaplastic large-cell lymphomas, have not yet been identified in IMTs, and TPM3-ALK fusions are rare in anaplastic large-cell lymphoma. Anaplastic large-cell lymphoma and IMT are associated classically with systemic signs, particularly fever, and one wonders whether this is a direct consequence of unregulated and/or unscheduled ALK signaling. Recent studies show that specific RTK activating mechanisms can bring about transformation of different human cell lineages. For example, activating KIT point mutations are found in human mast cell neoplasms, myeloid leukemia, germ cell tumors, and gastrointestinal stromal tumors,35-38 and ETV6-NTRK3 fusion oncogenes are found in both myeloid leukemia and congenital fibrosarcoma.39,40 Irrespective, our studies reveal the first example of an identical RTK fusion oncogene in lymphoid and mesenchymal neoplasia. This finding is in keeping with the observation that activated RTKs are generally transforming in both lymphoid (Ba/F3 cell) and mesenchymal (3T3 cell) models, in vitro. In summary, we have demonstrated a recurring oncogenic mechanism, involving ALK activation, in IMTs. These findings highlight the substantial relevance of RTK mechanisms in human mesenchymal neoplasia, and they underscore that such mechanisms are not lineage-specific.
| Footnotes |
|---|
The sequences reported in this paper have been deposited in the GenBank database (accession nos. AF186109 and AF186110).
Accepted for publication May 4, 2000.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
U. McDermott, A. J. Iafrate, N. S. Gray, T. Shioda, M. Classon, S. Maheswaran, W. Zhou, H. G. Choi, S. L. Smith, L. Dowell, et al. Genomic Alterations of Anaplastic Lymphoma Kinase May Sensitize Tumors to Anaplastic Lymphoma Kinase Inhibitors Cancer Res., May 1, 2008; 68(9): 3389 - 3395. [Abstract] [Full Text] [PDF] |
||||
![]() |
B C Gleason and J L Hornick Inflammatory myofibroblastic tumours: where are we now? J. Clin. Pathol., April 1, 2008; 61(4): 428 - 437. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Slater and J. Shipley Clinical relevance of molecular genetics to paediatric sarcomas J. Clin. Pathol., November 1, 2007; 60(11): 1187 - 1194. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. M. Amin and R. Lai Pathobiology of ALK+ anaplastic large-cell lymphoma Blood, October 1, 2007; 110(7): 2259 - 2267. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Lim and K. S. J. Elenitoba-Johnson Mass Spectrometry-based Proteomic Studies of Human Anaplastic Large Cell Lymphoma Mol. Cell. Proteomics, October 1, 2006; 5(10): 1787 - 1798. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Shigematsu, Y. Sano, S. Kasahara, H. Yanai, and H. Date Calcifying fibrous tumor arising from the heart. J. Thorac. Cardiovasc. Surg., September 1, 2006; 132(3): e21 - e22. [Full Text] [PDF] |
||||
![]() |
K. S. J. Elenitoba-Johnson, D. K. Crockett, J. A. Schumacher, S. D. Jenson, C. M. Coffin, A. L. Rockwood, and M. S. Lim Proteomic identification of oncogenic chromosomal translocation partners encoding chimeric anaplastic lymphoma kinase fusion proteins PNAS, May 9, 2006; 103(19): 7402 - 7407. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Klener, M. Szynal, Y. Cleuter, M. Merimi, H. Duvillier, F. Lallemand, C. Bagnis, P. Griebel, C. Sotiriou, A. Burny, et al. Insights into Gene Expression Changes Impacting B-Cell Transformation: Cross-Species Microarray Analysis of Bovine Leukemia Virus Tax-Responsive Genes in Ovine B Cells J. Virol., February 15, 2006; 80(4): 1922 - 1938. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Wan, M. S. Albom, L. Lu, M. R. Quail, N. C. Becknell, L. R. Weinberg, D. R. Reddy, B. P. Holskin, T. S. Angeles, T. L. Underiner, et al. Anaplastic lymphoma kinase activity is essential for the proliferation and survival of anaplastic large-cell lymphoma cells Blood, February 15, 2006; 107(4): 1617 - 1623. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Melloni, A. Carretta, P. Ciriaco, G. Arrigoni, S. Fieschi, N. Rizzo, E. Bonacina, G. Augello, P. A. Belloni, and P. Zannini Inflammatory Pseudotumor of the Lung in Adults Ann. Thorac. Surg., February 1, 2005; 79(2): 426 - 432. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Cheuk and J. K. C. Chan Subcellular Localization of Immunohistochemical Signals: Knowledge of the Ultrastructural or Biologic Features of the Antigens Helps Predict the Signal Localization and Proper Interpretation of Immunostains International Journal of Surgical Pathology, July 1, 2004; 12(3): 185 - 206. [Abstract] [PDF] |
||||
![]() |
H. Sakurai, T. Hasegawa, S.-i. Watanabe, K. Suzuki, H. Asamura, and R. Tsuchiya Inflammatory myofibroblastic tumor of the lung Eur. J. Cardiothorac. Surg., February 1, 2004; 25(2): 155 - 159. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Tamborini, L. Bonadiman, A. Greco, A. Gronchi, C. Riva, R. Bertulli, P. G. Casali, M. A. Pierotti, and S. Pilotti Expression of Ligand-Activated KIT and Platelet-Derived Growth Factor Receptor {beta} Tyrosine Kinase Receptors in Synovial Sarcoma Clin. Cancer Res., February 1, 2004; 10(3): 938 - 943. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. D. Gascoyne, L. Lamant, J. I. Martin-Subero, V. S. Lestou, N. L. Harris, H.-K. Muller-Hermelink, J. F. Seymour, L. J. Campbell, D. E. Horsman, I. Auvigne, et al. ALK-positive diffuse large B-cell lymphoma is associated with Clathrin-ALK rearrangements: report of 6 cases Blood, October 1, 2003; 102(7): 2568 - 2573. [Abstract] [Full Text] [PDF] |
||||
![]() |
N Gale, N Zidar, J Podboj, M Volavsek, and B Luzar Inflammatory myofibroblastic tumour of paranasal sinuses with fatal outcome: reactive lesion or tumour? J. Clin. Pathol., September 1, 2003; 56(9): 715 - 717. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Debiec-Rychter, R. Croes, R. De Vos, P. Marynen, T. Roskams, A. Hagemeijer, R. Lombaerts, and R. Sciot Complex Genomic Rearrangement of ALK Loci Associated with Integrated Human Epstein-Barr Virus in a Post-Transplant Myogenic Liver Tumor Am. J. Pathol., September 1, 2003; 163(3): 913 - 922. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-C. Chang and V. B. Shidham Molecular Genetics of Pediatric Soft Tissue Tumors: Clinical Application J. Mol. Diagn., August 1, 2003; 5(3): 143 - 154. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. C. Shing, D. J. McMullan, P. Roberts, K. Smith, S.-F. Chin, J. Nicholson, R. M. Tillman, P. Ramani, C. Cullinane, and N. Coleman FUS/ERG Gene Fusions in Ewing's Tumors Cancer Res., August 1, 2003; 63(15): 4568 - 4576. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. S. Reading, S. D. Jenson, J. K. Smith, M. S. Lim, and K. S. J. Elenitoba-Johnson 5'-(RACE) Identification of Rare ALK Fusion Partner in Anaplastic Large Cell Lymphoma J. Mol. Diagn., May 1, 2003; 5(2): 136 - 140. [Full Text] [PDF] |
||||
![]() |
J. L. Kutok and J. C. Aster Molecular Biology of Anaplastic Lymphoma Kinase-Positive Anaplastic Large-Cell Lymphoma J. Clin. Oncol., September 1, 2002; 20(17): 3691 - 3702. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. F. Nascimento, R. Ruiz, J. L. Hornick, and C. D. M. Fletcher Calcifying Fibrous 'Pseudotumor': Clinicopathologic Study of 15 Cases and Analysis of its Relationship to Inflammatory Myofibroblastic Tumor International Journal of Surgical Pathology, July 1, 2002; 10(3): 189 - 196. [Abstract] [PDF] |
||||
![]() |
B. Falini and D. Y. Mason Proteins encoded by genes involved in chromosomal alterations in lymphoma and leukemia: clinical value of their detection by immunocytochemistry Blood, January 15, 2002; 99(2): 409 - 426. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. P. Rubin, S. Singer, C. Tsao, A. Duensing, M. L. Lux, R. Ruiz, M. K. Hibbard, C.-J. Chen, S. Xiao, D. A. Tuveson, et al. KIT Activation Is a Ubiquitous Feature of Gastrointestinal Stromal Tumors Cancer Res., November 1, 2001; 61(22): 8118 - 8121. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Meech, L. McGavran, L. F. Odom, X. Liang, L. Meltesen, J. Gump, Q. Wei, S. Carlsen, and S. P. Hunger Unusual childhood extramedullary hematologic malignancy with natural killer cell properties that contains tropomyosin 4-anaplastic lymphoma kinase gene fusion Blood, August 15, 2001; 98(4): 1209 - 1216. [Abstract] |