help button home button Am J Pathol Epitomics, Inc.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mempel, M.
Right arrow Articles by Musette, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mempel, M.
Right arrow Articles by Musette, P.
(American Journal of Pathology. 2000;157:509-523.)
© 2000 American Society for Investigative Pathology


Regular Articles

Comparison of the T Cell Patterns in Leprous and Cutaneous Sarcoid Granulomas

Presence of V{alpha}24-Invariant Natural Killer T Cells in T-Cell-Reactive Leprosy Together with a Highly Biased T Cell Receptor V{alpha} Repertoire

Martin Mempel*{dagger}, Beatrice Flageul{dagger}, Felipe Suarez*, Catherine Ronet*, Louis Dubertret{dagger}, Philippe Kourilsky*, Gabriel Gachelin* and Philippe Musette*{dagger}

From the Institut Pasteur,*
Unité de Biologie Moléculaire du Gène, INSERM U277, Département d’Immunologie, Paris; and the Institut de Recherche sur la Peau,{dagger}
INSERM U312, l’Hôpital St.-Louis, Paris, France


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The T-cell-reactive (eg, tuberculoid and reversal) forms of leprosy represent a well-defined granulomatous reaction pattern against an invading pathogen. The immune response in cutaneous sarcoidosis is a granulomatous condition that pathologically is very similar to T-cell reactive leprosy. However, it lacks a defined causative agent. In view of the role of NKT cells in murine granulomas induced by mycobacterial cell walls, we have searched for the presence of NKT cells in the cutaneous lesions of both leprosy and sarcoidosis. These cells were present in T-cell-reactive leprosy but were undetectable in cutaneous sarcoidosis. We have also studied the TCR V{alpha} repertoire in the two diseases. In addition to V{alpha}24+ NKT cells, all patients with T-cell-reactive leprosy showed a very restricted T-cell-reactive V{alpha} repertoire with a strong bias toward the use of the V{alpha}6 and V{alpha}14 segments. V{alpha}6 and V{alpha}14+ T cells were polyclonal in terms of CDR3 length and J{alpha} usage. In contrast, most sarcoidosis patients showed a diverse usage of V{alpha} chains associated with clonal or oligoclonal expansions reminiscent of antigen-driven activation of conventional T cells. Thus the origin and perpetuation of the two kinds of granulomatous lesions appear to depend on altogether distinct T-cell recruiting mechanisms.



    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The formation of granulomas represents a particular defense mechanism aimed at preventing the spread of a potentially hazardous organism that has invaded a tissue compartment. Granulomas are the histological hallmark of infections with mycobacteria and are well known as a clinical manifestation of leprosy. In this disease, the immune response varies from the unreactive, T-cell-poor, multibacillary form of polar lepromatous leprosy (LL) with loosely organized granulomas to the T-cell-rich, paucibacillary forms of T-cell reactive leprosy (eg, polar tuberculoid (TT)) with well-organized granulomatous structures. Reversal leprosy (RR) represents an acute cellular immune response against Mycobacterium leprae, which may correspond to the early events of T cell reactivity.

Pathologically, granulomatous reactions highly similar to the T-cell-reactive forms of leprosy are found in diseases of unknown origin, such as sarcoidosis. Many cell types of the innate and adaptive immune systems participate in the elaboration of cutaneous granuloma formation in both diseases, with the typical feature of a central accumulation of histiocytes surrounded and infiltrated by lymphocytes. The lymphocytic rim is composed of {alpha}ß, {gamma}{delta} T lymphocytes and occasionally NK cells. These cells invade the site of granulomatous inflammation after a variety of stimuli, including antigenic ones, such as mycobacterial peptides, lipoproteins, and glycolipids,1-8 or chemoattraction by cytokines and chemokines.9-11 In view of the pathological similarity of the two kinds of diseases, a common etiology has been suggested, inasmuch as sarcoidosis represents the inflammatory response to an as yet unidentified microorganism, most probably of mycobacterial origin.12-14 The causative association of mycobacteria and sarcoidosis is still a focus of controversial discussions.15,16

Over recent years the T cell response to mycobacteria has been extensively studied and found to display original features; the response to various antigens, and particularly to mycobacterial glycolipids, is well documented.17,18 In an animal model, NKT cells, a CD1d-restricted T-cell subpopulation with very unique features,19 have been found to be recruited by mycobacterial glycolipids.20 Moreover, in this model, NKT cells are needed for the granulomatous lesions to develop. These NKT cells, however, have to our knowledge not yet been identified in human mycobacteria-induced granulomas.

One way to test the "mycobacterial" origin of sarcoidosis is to analyze and compare the T-cell populations and the T-cell receptor usage in cutaneous mycobacteria-induced granulomas such as leprosy, and in the cutaneous granulomatous lesions of sarcoidosis, as performed for pulmonary patients in earlier studies.21-23 As cutaneous manifestations are currently found in a subgroup of sarcoidosis patients, the comparison of cutaneous sarcoidosis and leprosy lesions offers a convenient model for the study of the characteristics of granulomas in identical tissue compartments and without the difficulties of pulmonary specimen sampling or the bias of using bronchoalveolar lavage fluids.

Using a combination of immunohistochemistry, polymerase chain reaction (PCR)-based technology, and DNA sequencing, we have analyzed the T-cell population in human leprosy patients and compared them to cutaneous sarcoidosis. The present data lead to the conclusion that the two kinds of granulomas, although histologically similar, are composed of different T-cell populations and argue against a mycobacterial origin of sarcoidosis.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Patients Included in the Study

The diagnosis of leprosy and sarcoidosis was confirmed by clinical and histological criteria. Leprosy patients were classified according to the criteria of Ridley and Jopling into polar tuberculoid (TT), borderline tuberculoid (BT), polar lepromatous (LL), borderline lepromatous (BL), and midborderline (BB).24 A total of five patients with tuberculoid leprosy (TT, BT), three patients with lepromatous leprosy (LL, BL), two patients with the reversal form of leprosy (RR), and six patients with cutaneous sarcoidosis were included in the study. Furthermore, the skin biopsy of one healthy individual undergoing plastic surgery served as the control for unaffected skin. After informed consent was obtained, 4-mm lesional punch biopsies were taken in local anesthesia and snap-frozen in liquid nitrogen, and specimens were cut into two fragments for immunohistochemistry and molecular biology analysis, respectively. A summary of the included patients is shown in Table 1 .


View this table:
[in this window]
[in a new window]
 
Table 1. Summary of Patients

 
Immunohistochemical Staining

Frozen sections were analyzed for the expression of CD3, CD4, CD8, CD16, CD56, CD57, CD68, panTCR{alpha}ß, and panTCR{gamma}{delta} (Dako, Trappes, France); CD1a, CD1b, CD1c, CD83, and V{alpha}24 (Immunotech, Marseille, France); and CD1d (Biosource, Camarillo, Calif., USA), using commercially available monoclonal antibodies, and a streptavidin-biotin immunoperoxidase technique, using 3-amino-ethylcarbazole to produce positive brownish staining (Beckman-Coulter, Paris, France). For staining with anti-V{alpha}24 we used a noncoupled primary antibody, followed by a biotin-labeled secondary antibody to reduce nonspecific background staining.

The percentage of positive cells was calculated by determining the number of stained cells among the total number of cells within the granulomas (eg, hematoxylin-stained nuclei).

As control samples, healthy skin from patients undergoing plastic breast surgery were used to test the staining pattern in unaffected skin.

RNA Extraction and cDNA Preparation

Specimens were disrupted in Trizol (Gibco) with a Polytron homogenizer. RNA extraction and cDNA preparation were carried out according to standard protocols, using AMV reverse transcriptase (RT) from Boehringer Mannheim (Mannheim, Germany).

TCR {alpha}-Chain Analysis

The "Immunoscope" technique for determining complementary region 3 (CDR3) length and distribution has been described elsewhere.25-27 Briefly, standardized amounts of cDNA (ie, the product of the reverse transcription of 10 µg of total RNA) were PCR amplified, using each of the 29 V{alpha}-specific probes and a common C{alpha}-specific probe. Each V{alpha}-C{alpha} PCR product was analyzed by electrophoresis in an agarose gel. For CDR3 length diversity, PCR-amplified products were submitted to five cycles of primer extension, using an internal, fluorescent, C{alpha}-specific probe. The labeled material was loaded on a sequencing gel and analyzed with an automatic sequencer (Applied Biosystem) equipped with a computer program (Immunoscope; Applied Biosystems) that enables the determination of the intensity of fluorescence of each band as well as its actual size. The results are depicted as peaks, the surfaces of which are proportional to the amount of material and the locations of which are dictated by the length of the CDR3 region. The size distribution of the V{alpha}-C{alpha} is Gaussian in the case of nonactivated or polyclonally activated lymphocytes, whereas proliferating T cells generated a non-Gaussian distribution with amplified peaks corresponding to clones with a definite CDR3 length within a V{alpha}-C{alpha} combination.

Primer and PCR Conditions and Detection of Invariant V{alpha} Chains

To amplify the V{alpha} repertoire of the invaded T cells we used a panel of 29 V{alpha}-specific primer together with a C{alpha}-specific primer as well as an internal C{alpha} run-off primer, which have previously been described.26 The run-off primer for the J{alpha}33 (5'-CCAGATTAACTGATAGTTGCTATC-3'), the J{alpha}29 (5'-AAGAGGTGTGTTTCCTACGTC-3'), the J{alpha}48 (5'-TAATTTCTCATTTCCAAAGTT-3'), and the J{alpha}18 (5'-GCCTCCCCAGGGTTGAGCCTCTG-3') clonotypes were designed according to the publications of Porcelli et al and Han et al.28,29 Primers for human CD3 and CD1d were as follows: CCAGGCTGATAGTTCGGTGA (CD3–5') and TGTCTGAGAGCAGTGTTCCCAC (CD3–3') and AGCCTGTATGGGTGAAGTGG (CD1d-5') and TAAAGCCCACAATGAGGAGG (CD1d-3'). For the primary PCR reaction cDNA was amplified in 40 cycles (30' 94°—30' 60°—30' 72°) followed by five cycles (30' 94°—30' 60°—30' 72°) with the fluorescent run-off primer. To exclude a higher affinity of individual primers as a reason for a positive amplification product, various primers were tested in a kinetics of 20/25/30/35 and 40 cycles with a positive control of peripheral blood mononuclear cell (PBMC) cDNA of a healthy individual in which all V{alpha} chains had been found to be amplified.

Direct DNA Sequencing

Direct sequencing of PCR products was carried out with a Sequenase kit (USB-Amersham, Cleveland, OH) according to the manufacturer‘s instructions, after separation of the PCR products by electrophoresis in a 2% agarose gel and electroelution of the proper DNA fragments.

Cloning and Sequencing of PCR Products

PCR products were ligated into a commercially available vector (Zero blunt; Invitrogen, Groningen, the Netherlands) and transformed into Escherichia coli (Invitrogen). Sequence analysis was carried out according to standard protocols (Perkin Elmer) and analyzed with ABI-Prism 373 software (Applied Biosystems).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Main Histological Features of the Leprosy and Sarcoidosis Biopsies Used in the Present Study

Biopsies were frozen, sectioned, and immunostained. We first determined the number of macrophages, dendritic cells, and NK lymphocytes, using simple staining for CD68, CD1a, CD16, CD56, CD57, and CD83 molecules, respectively. The staining pattern showed comparable numbers of cells within the T-cell-reactive forms of leprosy and sarcoidosis patients, whereas lepromatous leprosy patients showed no or only weak staining for the analyzed cell types, with the exception of CD68, which stained positive in all lepromatous leprosy patients, confirming the presence of macrophages within the lesions (data not shown). In addition, comparable numbers of {gamma}{delta} T cells as well as a similar ratio of CD4+ to CD8+ cells were detected in TCR leprosy as well as in sarcoidosis. Lepromatous leprosy patients showed only poor infiltration by any of the investigated T-cell subpopulations. The identified T cells dominated in both types of granuloma (sarcoidosis and leprosy) in the areas surrounding the central eptheloid cell accumulation. The immunochemical features of the samples under study are in agreement with previous findings showing that the composition of granuloma infiltrating immunocytes in cutaneous sarcoidosis is similar to that of T-cell-reactive leprosy.4

In view of the involvement of CD1 molecules in the response to mycobacterial antigens, the expression of CD1a–d molecules was examined. Few or no CD1a+, CD1b+, CD1c+, or CD1d+ cells were found in lepromatous leprosy patients, but remarkable levels of expression of CD1a, b, c were found in all TCR leprosy patients, as reported in a previous publication.30 To our surprise, even higher numbers of CD1b+ cells and a remarkable expression of the other CD1 molecules was found within the investigated sarcoidosis patients (Figures 1 and 2) . The positive staining cells in both diseases accumulated within the dermal granulomas, with the exception of CD1a, which, in addition, constantly stained positive for epidermal cells, most probably because of the presence of epidermal dendritic cells. This epidermal staining pattern was also seen in healthy control biopsies. CD1b and CD1c stained positive for epidermal cells only occasionally, without showing associations with one of the investigated disorders. Some of the biopsies showed positive staining of CD1d, also in the basal layer of the epidermis, suggesting an expression of this molecule by human keratinocytes, as described earlier,31 but this pattern was seen for leprosy and sarcoidosis patients and was also found in the uninvolved skin of healthy control subjects. The positive staining pattern was paralleled by the detection of CD1d-RNA by RT-PCR in all sarcoidosis and TCR leprosy patients (data not shown).



View larger version (128K):
[in this window]
[in a new window]
 
Figure 1. Staining patterns of CD1a, CD1b, CD1c, and CD1d expression in patient R2 (A–D) and S1 (E–H). Cells were stained with the adequate primary antibody, followed by a streptavidin-biotin immunoperoxidase reaction. Positive cells are stained in brown; counterstaining was performed with hematoxylin. Whereas staining for CD1b and CD1c was strongly associated with the granulomatous structures, CD1a also stained positive in the epidermis (epidermal dendritic cell marker), and CD1d showed additional association with basal layers of the keratinocytes. To identify the nature of the CD1d+ cells within the granulomas, serial sections were stained with various cell markers. CD1d+ cells were found to colocalize with CD83, a marker for the dendritic cell lineage (data not shown).

 


View larger version (18K):
[in this window]
[in a new window]
 
Figure 2. Quantification of CD1+ cells in leprosy and sarcoidosis. Positive cells in the granulomas were counted and are expressed as a percentage of the total cell numbers within the analyzed field (eg, 100 cells). Whereas lepromatous leprosy patients (L) showed no or only exceptional positive staining (CD1b) with the investigated molecules, sarcoidosis (S) and T-cell-reactive leprosy patients (T, R) yielded expression of all CD1 molecules in part even at higher levels for sarcoidosis biopsies (CD1b, CD1c). *Staining for CD1d could not be performed in all patients because of limitations in biopsy material, but RT-PCR for CD1 showed positive results in all T/R and S patients.

 
To define the nature of the CD1d+ cells, for some of the patients we used serial sections that were stained with various cell surface markers. Using this technique CD1d+ cells within the granulomas colocalized with CD83+ cells, suggesting dendritic cells as the predominant CD1d+ cell population within the granulomas. In addition, staining for CD1d was strong in the central areas of the granulomas and only weak for the periphery of the granulomas where CD3 T lymphocytes dominated, thus rendering unlikely a major contribution of CD1+ T lymphocytes to the staining patterns in both diseases.

NKT Cells Are Present in TCR Leprosy but Not in Sarcoidosis Patients

Human NKT cells are T cells with NK cell surface markers, using an invariant V{alpha}24-J{alpha}18 TCR {alpha} chain, associated preferably with the Vß11 chain and restricted by the MHCIb CD1d molecule. Their murine V{alpha}14-J{alpha}281 counterparts have been shown to be necessary for the development of the granulomatous lesions that follow the injection of deproteinized mycobacterial cell walls.20

All samples were assayed for the presence of V{alpha}24+ transcripts, followed by the research of the NKT-specific, V{alpha}24-J{alpha}18 transcripts.28 The V{alpha}24-C{alpha} PCR products were studied by primer extension, using a fluorescent C{alpha}-specific probe. Patients T1, T5, R1, and R2 displayed a Gaussian-like distribution of their CDR3 length; patients T2-T4 patients displayed a unique peak with a size compatible with that of the invariant chain of the TCR {alpha} chain of NKT cells (Figure 3a) . On primer extension with the V{alpha}24-J{alpha}18 clonotypic probe, all TT and RR samples showed the presence of NKT cells. The resulting peak was superimposable on the V{alpha}24-C{alpha} products in patients T2-T4, showing that NKT cells are predominant among the V{alpha}24+ T cells of these patients.



View larger version (49K):
[in this window]
[in a new window]
 
Figure 3. a: Immunoscope analysis of the V{alpha}24-C{alpha} (left) and the V{alpha}24-J{alpha}18 (right) amplification product in patients S5, T1, and T3. Whereas patients S5 and T1 show polyclonal distributions of the V{alpha}24-positive population (indicated by the Gaussian or comb-like profile with various peaks), patient T3 shows infiltration by a T-cell population with homogeneous V{alpha}24-C{alpha} distribution, as indicated by the single peak expansion. For patients T1 and T3 the clonotypic runoff experiment with the NKT-specific J{alpha}18 primer shows a single peak signal indicative of the V{alpha}24-J{alpha}18 rearrangement. Whereas in patient T3 the NKT population is superimposable on the V{alpha}24+ population, in patient T1 this population represents only a subfraction of the total V{alpha}24+ T-cell population. Patient S5 shows no positive signal in the V{alpha}24-J{alpha}18 runoff, indicating the absence of the particular NKT population in this patient. Sequence analysis showed for all T-cell-reactive leprosy patients the CDR3 sequence of the originally described clonotype (V{alpha}24-TGT GTG GTG AGC GAC AGA-J{alpha}18), with the exception of patient T3, who showed in addition a second sequence in which the serine was encoded by another triplet (V{alpha}24-TGT GTG GTG TCT GAC AGA-J{alpha}18). b: Localization of V{alpha}24+ cells in the biopsy of patient R2 with a form of reversal leprosy. The arrows mark positive cells (brownish), which are located within the granulomatous structures, suggesting a recruitment by the invaded mycobacterial structures. Presence of the canonical V{alpha}24-J{alpha}18 rearrangement was confirmed by Immunoscope and sequence analysis.

 
In contrast, none of the sarcoidosis or lepromatous leprosy patients showed evidence of an infiltration by NKT cells. In sarcoidosis patients S1, S5, and S6, we could detect a weak V{alpha}24-C{alpha} amplification product, but we could not detect the clonotypic V{alpha}24-J{alpha}18 transcript. Patients S2, S3, S4, and L1–L3 did not show any V{alpha}24-C{alpha} amplification signal and were also found to be negative in the V{alpha}24-J{alpha}18 runoff experiments.

We then stained tissue sections, using a V{alpha}24-specific monoclonal antibody raised against a V{alpha}24-J{alpha}18+ DN T-cell clone.32,33 No positive cells were found in any of the sarcoidosis or LL specimens, whereas two T-cell-reactive leprosy patients also scored positive in immunohistochemistry. Figure 3b shows the staining pattern for V{alpha}24+ in patient R2.

To confirm the presence of NKT cells seen in the immunoscope analysis, we then cloned and sequenced the V{alpha}24-C{alpha} transcripts in all seven T-cell-reactive leprosy patients. Whereas we could find in all patients the canonical sequence V{alpha}24-TGT GTG GTG AGC GAC AGA-J{alpha}18, patient T3 showed, in addition to this sequence, a V{alpha}24-TGT GTG GTG TCT GAC AGA-J{alpha}18 rearrangement in which the serine at the V{alpha}-J{alpha} junction was encoded by a triplet (TCT) other than the germline transcribed triplet AGC, which is usually associated with the NKT cell population.28 This finding argues for a TCR-mediated selection process within the lesion of this patient.

Thus classical V{alpha}24-J{alpha}18 NKT cells are present in T-cell-reactive leprosy lesions but are absent from cutaneous sarcoidosis lesions.

TCR {alpha}-Chain Usage in Leprosy Lesions

To further define the T cells detected by immunohistochemistry, we examined their TCR {alpha}-chain usage with a panel of 29 different primers covering almost 95% of the described V{alpha} families.34 The analysis of the {alpha} chain was preferred to that of the ß chain because it allows simultaneously the characterization of the T-cell repertoire together with the screening for possible invariant TCR {alpha} chains.

In addition to the V{alpha}24 segment, which we have shown to be mostly associated with NKT cells, all seven T-cell-reactive leprosy patients showed the preferential usage of either V{alpha}6 and/or V{alpha}14 (Figure 4) . On Immunoscope analysis of the V{alpha}6/14 -C{alpha} PCR products with a C{alpha}-specific primer, a Gaussian-like or, in some instances, a comb-like distribution of the TCR {alpha}-chain CDR3 profile was observed. The absence of dominant peaks is indicative of a polyclonal origin of the infiltrating T cells.



View larger version (37K):
[in this window]
[in a new window]
 
Figure 4. The graph gives the usage of TCR-V{alpha} chains within the granulomatous lesions of patients with cutaneous sarcoidosis (S), tuberculoid leprosy (T), reversal leprosy (R), and lepromatous leprosy (L), from RT-PCR and the Immunoscope technique. Sarcoidosis patients showed unbiased V{alpha} usage with at least one single peak-shaped V{alpha} ({blacksquare}), which is suggestive of clonal populations. T-cell-reactive leprosy patients (T, R), however, showed a bias toward V{alpha} 6, V{alpha} 14, and V{alpha} 24, with a Gaussian-like or comb-like distribution of the CDR3 size (), which is suggestive of poly- or oligoclonal expansions. The V{alpha}24+ expansions in patients T2, T3, and T4 were found to consist exclusively of V{alpha}24-J{alpha}18+ cells, as shown by clonotype experiments.

 
Single transcripts of the V{alpha}6- and V{alpha}14-C{alpha} PCR products in various patients were cloned and sequenced to examine recurrency in their CDR3 region sequence (including the presence of invariant {alpha} chains) or biases in the usage of J{alpha} segments.

We did not find invariant sequences within the analyzed clones; however, the DNA sequences showed a bias of the associated J{alpha}, because J{alpha} segments were preferentially associated with V{alpha}6 and others were more often found to be associated with V{alpha}14. They were segments J{alpha} 4, 5 with V{alpha}6 and J{alpha} 30, 31, 32, 33, 34, 48, and 49 with V{alpha}14. The J{alpha} 1, 2, 14, 18, 24, 25, 28, 35, 36, 38, 46, 50, 51, 59, 60, 61 segments were not detected among the 220 sequences we have determined within the different leprosy patients (Figure 5A) .



View larger version (75K):
[in this window]
[in a new window]
 
Figure 5. Usage of J{alpha} segments within the obtained V{alpha}6 and V{alpha}14 populations of T-cell-reactive leprosy (A) and sarcoidosis (B) patients. PCR products were cloned, and random clones were used for sequence analysis. Gray cells represent J{alpha} segments that were found only once within one patient; dotted cells indicate J{alpha} segments that were used in two or three analyzed sequences; black cells represent J{alpha} segments that were found four times or more (including recurrent sequences). J{alpha} segments indicated by open cells were not found at all. Preferential usage of J{alpha} segments in leprosy patients was observed for both V{alpha}6 (J{alpha} 4, 5) and V{alpha}14 (J{alpha} 30–34, 48, 49), a finding that was less dominant in cutaneous sarcoidosis.

 
When we compared the isolated sequences in detail, we found no identical sequences between different patients. The recurrent finding of the same or a highly similar sequence within the different clones of a patient (V{alpha}6 in patients T1, T2, and T5) could indicate a dominant sequence within an otherwise polyclonal pattern. Moreover, one rearrangement sequence (V{alpha}6-J{alpha}5) was found to be quite similar in CDR 3 size and amino acid sequence in patients T1 and T2, which could be suggestive of a common antigenic structure that selected the similar clones in the two patients (Table 2) .


View this table:
[in this window]
[in a new window]
 
Table 2. Obtained CDR3 Sequences (Amino Acid Code) within the Analyzed V{alpha}6 and V{alpha}14 Population in T-cell-Reactive Leprosy Patients and the Cutaneous Sarcoidosis Patients Expressing the Respective TCR {alpha} Chain within Their Lesions

 
DN and CD4-/CD8+ human T cells have consistently been shown to react with mycobacteria-derived lipophilic antigens with no significant restriction in their TCR {alpha}ß-chain usage.35 However, the V{alpha}7.2-J{alpha}33, the V{alpha}4-J{alpha}29, and the V{alpha}19-J{alpha}48 rearrangements have been described to be preferentially associated with DN or CD4-/CD8+ T cells28,29,36 As immunohistochemical analysis of the DN population was not found to be a suitable screening technique, we decided to search for the described invariant TCR{alpha} rearrangements by PCR and Immunoscope techniques. Fluorescent primers coding for the J{alpha}33, J{alpha}29, and J{alpha}48 segments were designed and used for runoff experiments of the V{alpha}7-C{alpha}, V{alpha}4-C{alpha}, and V{alpha}19-C{alpha} PCR products. No signal was observed in the material recovered from the T-cell-reactive leprosy lesions, showing the absence of V{alpha}-invariant T cells other than the V{alpha}24-invariant NKT cell population.

Thus the local {alpha}ß T-cell response in cutaneous leprosy consists chiefly of NKT cells and oligoclonal/polyclonal V{alpha}6/V{alpha}14 T cells.

TCR {alpha}-Chain Usage in Cutaneous Sarcoidosis Lesions

All biopsies of cutaneous sarcoidosis granulomas were studied in a similar way. We have already shown the absence of NKT cells by RT-PCR. On agarose gel electrophoresis of the V{alpha}-C{alpha} PCR products, and in contrast with what we observed in leprosy, all patients with cutaneous sarcoidosis showed the usage of a limited number of individual V{alpha} chains (except patient S1, who yielded usage of 28 of the screened 29 TCR {alpha} chains) within their granulomatous lesions, without any markable bias toward the usage of a particular V{alpha} region. It is worth noting that, as previously reported for pulmonary specimens,37 we found in five of six patients an amplification for V{alpha}2 in cutaneous sarcoidosis lesions (Figure 4) .

On immunoscope analysis of the distribution of the CDR3 length of the different TCR {alpha} chains in all patients, we found Gaussian-like distributions of the V{alpha}-C{alpha} peaks, representing polyclonal expansions of the infiltrating T lymphocytes, as well as distorted profiles with dominant peaks, for V{alpha} chains that were different in each patient and indicated the presence of T-cell populations with a conserved length of the CDR3 region of the TCR {alpha} chain, correlating with oligo- or monoclonal expansions. In this respect, the patterns observed in cutaneous sarcoidosis are very reminiscent of those observed in a number of human diseases involving antigen-driven T-cell proliferation.27

We determined the sequence of the most dominating expansions in each patient, either by direct sequencing (which proved successful in patients S1 and S4) or following the cloning of the V{alpha}-C{alpha} PCR product and determination of the expanded sequence (S2, S3, S5, and S6) by sequencing several clones. In four patients (S1, S2, S3, and S4) a single sequence of the CDR3 region typical for clonal expansions was recurrently determined. The sequences obtained from the different patients showed no similarities at the amino acid level, even when the same V{alpha} was studied (V{alpha}9 for patients S1 and S2) (Table 3 ).


View this table:
[in this window]
[in a new window]
 
Table 3. Selected Single Peaks Suggestive of Clonal Expansions Sequenced in Sarcoidosis Patients

 
Some "peaks" were not of clonal origin: we could not identify a predominant CDR3 sequence within the 10-aa peak of V{alpha}20 in patient S5 and within the 10-aa expansion of V{alpha}16 in patient S6. The comparison of the CDR3 amino acid sequences, however, was reminiscent of the recognition of the same antigen in a given patient: in patient S5 the CDR3 sequences had a very similar sequence containing a CLVG-X-X-DTG motif (16 of 19) or a motif in which D-T was replaced by another hydrophilic amino acid (S or G); in addition, 10 of 19 of the 10-aa CDR3-containing sequences were found to include the J{alpha}5 chain. Although the similarities were less striking in the CDR3 region analysis of the V{alpha}16-C{alpha} amplification in patient S6, we still found some common features shared by most amino acid sequences (Table 3) .

To compare for possible similarities between the T cells invading sarcoidosis and leprosy at a molecular level, we extended the sequence analysis of the CDR3 region in the V{alpha}6+ and V{alpha}14+ T-cell populations to the sarcoidosis patients showing infiltration of the respective chains, who were S1, S2, and S5 for V{alpha}6 and S1, S5, and S6 for V{alpha}14. This analysis showed, in parallel to the T-cell-reactive leprosy patients, an oligoclonal pattern with few clones on expansion in an otherwise polyclonal composition of the V{alpha}6+ or V{alpha}14+ T-cell populations (Table 2) . When comparing for the association with various J{alpha} chains, we did not find the same segments preferably used in cutaneous sarcoidosis as in leprosy (eg, J{alpha}33 was not used at all in sarcoidosis but was used in several leprosy specimens); still a preferred pairing of the two analyzed TCR {alpha} chains could be observed (Figure 5B) .

Using the Immunoscope technique and the V{alpha}7.2-J{alpha}33-, the V{alpha}4-J{alpha}29-, and the V{alpha}19-J{alpha}48-specific clonotypic primers, we found that patients S1 and S5 showed a clonotypic peak of 190 bp (indicative of the V{alpha}7.2-J{alpha}33 rearrangement), and S1 showed the 196-bp peak indicative of the V{alpha}19-J{alpha}48 rearrangement. The canonical V{alpha}4-J{alpha}29 rearrangement was not detected in any of the patients. To rule out a bias on the level of J{alpha} usage, we looked for transcription of the J{alpha} segments 18 and 33 in all identified V{alpha} chains. These experiments showed that the use of the segments J{alpha}18, J{alpha}29, J{alpha}33, and J{alpha}48 was not restricted to the populations of V{alpha}4+, V{alpha}7+, V{alpha}19+, or V{alpha}24+ cells as identified by runoff experiments (data not shown) with all identified V{alpha} chains in the sarcoidosis patients and sequence analysis of the V{alpha}6 and V{alpha}14 populations (Table 2) .


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The formation of granulomatous skin reactions is a well-known feature shared by T-cell-reactive leprosy and cutaneous sarcoidosis. As a very similar composition of the cellular subsets is found in the two diseases (eg, macrophages, dendritic cells and lymphocytes, which surround and infiltrate an inflammatory granulomatous site), it has been proposed for a long time that granuloma formation in sarcoidosis is induced in a fashion similar to that of leprosy in response to an antigenic stimulation of mycobacterial origin (reviewed in ref 13 ). Conversely, if "atypical" mycobacteria are associated with the development of sarcoidosis granulomas, the T-cell responses in sarcoidosis and T-cell-reactive leprosy are expected to share traits in common.

The samples we have collected possess the immunohistochemical features already described4 and are thus characteristic of the different forms of leprosy as well as of cutaneous sarcoidosis, and the cell content of the sarcoidosis lesions mimics that of T-cell reactive leprosy. However, the T-cell responses in these two families of diseases, analyzed by a combination of RT-PCR, Immunoscope, and systematic DNA sequencing carried out on material with similar T-cell content, appear to be profoundly different. First, NKT cells are present among the T cells infiltrating T-cell-reactive leprosy lesions but are absent from sarcoidosis lesions. Second, the immune response in leprosy is dominated by a polyclonal V{alpha}6 and V{alpha}14 usage, whereas the immune response in cutaneous sarcoidosis is dominated by a mixture of polyclonal infiltrates associated with monoclonal or oligoclonal cell expansions, reminiscent of an antigen-driven proliferation of T cells and profoundly different from the patterns observed in the presence of mycobacteria. The oligoclonality we have observed in cutaneous sarcoidosis patients correlates well with previous analyses of pulmonary granulomas,22,38,39 although a restricted repertoire has not been found in all studies.40 Oligoclonality cannot be due to the limited amount of material, inasmuch as we have observed a large panel of V{alpha} segments in patient S1, who otherwise did not show higher percentages of invading T cells; moreover, the Immunoscope technique has been shown to detect one cell in 105 cells,41 a sensitivity sufficient to identify even very minor lymphocytic populations.

However, biases in the cutaneous TCR repertoire may be associated with the processes of homing to inflamed skin, which are highly complex and require a variety of cellular interactions favoring activated and/or antigen-specific T-cell populations.42 In this respect, Klein and co-workers showed a restricted Vß usage with oligoclonal expansions within the sites of Kveim reagent injections, a diagnostic reaction appearing 4 weeks after intradermal injection of extracts of sarcoidosis spleen or lymph nodes, which leads to granuloma formation virtually identical to that of primary cutaneous sarcoidosis.43 The expansions identified in our patients were seen within different V{alpha}-C{alpha} expansions and revealed CDR3 shapes with only limited similarities between the clones present in different individuals, thus suggesting an individual predisposition to a yet unidentified antigenic stimulus. This idea is further supported by the observations we made in patients S5 and S6, where the peak-shaped sequences were not identical but contained a limited number of similar sequences, which could well have been stimulated by a single antigen. In conclusion, our results suggest that altogether different mechanisms underlie the development of granulomas in T-cell-reactive leprosy and reversal leprosy and in cutaneous sarcoidosis, and this may be taken as meaning that (atypical) mycobacteria do not contribute to the progression of cutaneous sarcoidosis. Moreover, were it to be proved that the observed expansions are locally induced by some antigen-driven process, the presence of oligoclonally expanded T cells in the lesions leads to the conclusion that a systematic search for sarcoidosis-associated antigens, whether of self or nonself origin, could be a fruitful alternative approach to the etiology of the disease.

The T-cell response in leprosy lesions is worth discussing. In the investigated patients with leprosy we found the well-known differences in APC and T-cell infiltration between the T-cell-reactive forms with a high immunocellular content and the lymphocyte-poor form of lepromatous leprosy. This expected finding represents one of the criteria for the classification of leprosy patients.24 When analyzing the V{alpha} repertoire of the patients with TT and RR, we found a striking bias of the {alpha} chains used versus V{alpha}6, V{alpha}14, and V{alpha}24. Because major differences in the efficiency of the primers used were ruled out,34 only three V{alpha} segments are predominantly used by the T cells infiltrating T-cell-reactive leprosy patients. The strong bias versus V{alpha}6 and V{alpha}14 was somehow surprising, although Strohal had shown in earlier studies that T cells using these two V{alpha} segments are preferentially found in normal skin.44 The V{alpha}6 and V{alpha}14 T cells of all lesions were polyclonally expanded in terms of CDR3 length, amino acid sequence, and J{alpha} usage. No invariant chain could be identified on the basis of identical recurrent sequences and unique J{alpha} usage. The polyclonal expansion of cells using solely V{alpha}6 and 14 is difficult to account for. The bias in the Vß usage (Vß 6,12,14,19) previously described in leprosy patients45 associated with the currently reported selective usage of V{alpha}6 and V{alpha}14 (two {alpha} segments that are structurally related)46 may reveal a particular response to a nominal mycobacterial antigen. However, one would expect a highly skewed diversity within the expanded {alpha} chains that is due to an antigen-driven process or to preferential selection of an invariant {alpha} chain and thus a constant J{alpha} usage, none of which was observed in the present studies. The usage of V{alpha}6 and V{alpha}14 segments may also reveal the stimulation of T cells by some TCR {alpha}-specific superantigen secreted by proliferating mycobacteria as described for TCR ß chains.47 As TCR {alpha}-specific superantigens have not yet been identified, this remains questionable, but the contribution of the {alpha} chain to superantigen recognition is currently under debate, with some authors favoring an important role in TCR-superantigen interaction.48,49

The analysis of the V{alpha}24+ cells showed, in most of our T-cell-reactive leprosy patients, a disturbed distribution of the Immunoscope profile with an expanded peak corresponding to the CDR3 length of the known V{alpha}24-J{alpha}18 clonotype. The presence of this clonotype, which is typical of human NKT cells, was further confirmed by J{alpha}18-specific runoff experiments and sequence analysis, which showed an amplification product in all T-cell-reactive but not in lepromatous leprosy patients. The presence of NKT cells in leprous granulomas had not previously been described, and the presence of this distinctive T-cell subset is clearly associated with T-cell-reactive forms of leprosy. The finding that the invading NKT cell population at least in one patient displayed differences at the nucleotide level in their V{alpha}24-J{alpha}18 transcript with an identical sequence at the amino acid level enforces the idea that NKT cells in the leprous granulomas have undergone a selection process.

The V{alpha}24-J{alpha}18 TCR invariant NKT cells are restricted by the CD1d molecule and have a homolog in the murine V{alpha}14-J{alpha}281 TCR invariant NKT cells.50 These cells have been found to carry markers of the NK lineage, such as CD161 or NK1.1 together with the {alpha}ßTCR. They are predominantly found in the DN or CD4+CD8- pool. The physiological role of the NKT cells in humans and mice is pleiotropic; they have been implicated in the induction of a Th2 immune response,51 the control of autoimmune disease,52 and an antitumoral activity after activation via interleukin-12 or specific ligands.53-55 In a murine model of granuloma development by mycobacterial cell wall components, these cells have recently been demonstrated to be almost exclusively recruited by glycolipids belonging to the phosphatidylinositolmannoside family and to be of crucial importance for granuloma formation.20 However, an activation of NKT by CD1d+ cells supplemented with mycobacterial cell wall extracts has not yet been observed in vitro, and the nature of the activation process of NKT cells remains elusive. It is possible that the mycobacterial cell wall-induced NKT-cell-dependent granuloma formation is not dependent on mCD1; an alternative activation could be induced through lectin-like structures that are common to NK and NKT cells.56 NKT cells were found in all patients with T-cell-reactive leprosy but not in lepromatous leprosy patients who lack a sufficient cellular immune response against M. leprae. They were not found in sarcoidosis patients, although CD1 molecules were detectable at high levels in the lesions. In any event, the formation of a granuloma in the absence of an obvious bacterial load, as in cutaneous sarcoidosis, clearly does not require the local recruitment of NKT cells. The identification of two further T-cell rearrangements previously described with DN T cells (V{alpha}7.2-J{alpha}33 and V{alpha}19-J{alpha}48) within the sarcoidosis lesions is difficult to explain. As no functional role for these TCR{alpha}-invariant cells has been described, their presence might be due to a yet unknown specific mechanism. However, as we found the V{alpha}7.2-J{alpha}33 rearrangement in only two of six and the V{alpha}19-J{alpha}48 rearrangement in only one of six patients, we would favor a nonspecific infiltration into the inflamed skin.

In contrast, the recruitment of NKT cells in T-cell-reactive leprosy strengthens the hypothesis that NKT cells have an important role in the innate immune response toward substances produced by mycobacteria in the present case and by intracellular bacteria in general.57,58


View this table:
[in this window]
[in a new window]
 
Table 2B. Continued

 

View this table:
[in this window]
[in a new window]
 
Table 2C. Continued

 

    Acknowledgements
 
We thank Philippe Bousso for helpful discussions and A. Lim for her help with the sequence analysis.


    Footnotes
 
Address reprint requests to Dr. G. Gachelin, Département d’Immunologie, Institut Pasteur, 25 rue du Dr. Roux, 75015 Paris, France. E-mail: ggachel{at}pasteur.fr

Supported by grants from La Ligue Nationale centre le cencer l’Association pour la Recherche contre le Cencer, the European Community, and the College de France.

M.M. was supported by a scholarship from the Deutsche Forschungsgemeinschaft.

Accepted for publication May 19, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Constant P, Davodeau F, Peyrat M, Poquet Y, Puzo G, Bonneville M, Fournier J: Stimulation of human gd T cells by nonpeptidic mycobacterial ligands. Science 1994, 264:267-270[Abstract/Free Full Text]
  2. Fournié, J-J, Mullins RJ, Basten A: Isolation and structural characteristics of a monoclonal antibody defined cross reactive phospholipid antigen from Mycobacterium tuberculosis and Mycobacterium leprae. J Biol Chem 1991, 266:1211–1219
  3. Jullien D, Stenger S, Ernst W, Modlin R: CD1 presentation of microbial nonpeptide antigens to T cells. J Clin Invest 1997, 100:s29-s32
  4. Modlin R, Hofman F, Meyer P, Sharma O, Taylor C, Rea T: In situ demonstration of T lymphocytes subsets in granulomatous inflammation: leprosy, rhinoscleroma, and sarcoidosis. Clin Exp Immunol 1983, 51:430-438[Medline]
  5. Sieling PA, Chatterjee D, Porcelli SA, Prigozy TI, Mazzaccaro RJ, Soriano T, Bloom BR, Brenner MB, Kronenberg M, Brennan PJ, Modlin RL: CD1-restricted T cell recognition of microbial lipoglycan antigens. Science 1995, 269:227-230[Abstract/Free Full Text]
  6. Tanaka Y, Sano S, Nieves E, De Libero G, Rosa D, Modlin RL, Brenner MB, Bloom BR, Morita CT: Nonpeptide ligands for human gd T cells. Proc Natl Acad Sci USA 1994, 91:8175-8179[Abstract/Free Full Text]
  7. Thole J, Janson A, Cornelisse Y, Schreuder G, Wieles B, Naafs B, de Vries R, Ottenhoff T: HLA-class II-associated control of antigen recognition by T cells in leprosy: a prominent role for the 30/31-kDa antigens. J Immunol 1999, 162:6912-6918[Abstract/Free Full Text]
  8. Verhagen C, Faber W, Klatser P, Buffing A, Naafs B, Das P: Immunohistochemical analysis of in situ expression of mycobacterial antigens in skin lesions of leprosy patients across the histopathological spectrum-association of mycobacterial lipoarabinomannan (LAM) and Mycobacterium leprae phenolic glycolipid-I (PGL-I) with leprosy reactions. Am J Pathol 1999, 154:1793-1804[Abstract/Free Full Text]
  9. Bergeron A, Bonay M, Kambouchner M, Lecossier D, Riquet M, Soler P, Hance A, Tazi A: Cytokine patterns in tuberculous and sarcoid granulomas—correlations with histopathologic features of the granulomatous response. J Immunol 1997, 159:3034-3043[Abstract]
  10. Chensue S, Warmington K, Ruth J, Sanghi P, Lincoln P, Kunkel S: Role of the monocyte chemoattractant protein-1 (MCP-1) in Th1 (mycobacterial) and Th2 (schistosomal) antigen-induced granuloma formation-relationship to local inflammation, Th cell expression, and IL-12 production. J Immunol 1996, 157:4602-4608[Abstract]
  11. Agostini C, Cassatella M, Zambello R, Trentin L, Gasperini S, Perin A, Piazza F, Siviero M, Facco M, Dziejman M, Chilosi M, Qin S, Luster A, Semenzato G: Involvement of the IP-10 chemokine in sarcoid granulomatous reactions. J Immunol 1998, 161:6413-6420[Abstract/Free Full Text]
  12. El-Zaatari F, Naser S, Markesich D, Kalter D, Engstand L, Graham D: Identification of Mycobacterium avium complex in sarcoidosis. J Clin Microbiol 1996, 34:2240-2245[Abstract/Free Full Text]
  13. Newman L, Rose C, Maier L: Sarcoidosis. N Engl J Med 1997, 336:1224-1234[Free Full Text]
  14. Popper H, Klemen H, Hoefler G, Winter E: Presence of mycobacterial DNA in sarcoidosis. Hum Pathol 1997, 28:796-800[Medline]
  15. Hance A: The role of mycobacteria in the pathogenesis of sarcoidosis. Semin Res Infect 1998, 13:197-205
  16. Vokurka M, Lecossier D, du Bois R, Wallaert B, Kambouchner M, Tazi A, Hance A: Absence of DNA from mycobacteria of the M. tuberculosis complex in sarcoidosis. Am J Respir Crit Care Med 1997, 156:1000–1003
  17. Beckman EM, Porcelli SA, Morita CT, Behar SM, Furlong ST, Brenner MB: Recognition of a lipid antigen by CD1 restricted ab+ T cells. Nature 1994, 372:691-694[Medline]
  18. Beckman EM, Melian A, Behar SM, Sieling PA, Chatterjee D, Furlong ST, Matsumoto R, Rosat J, Modlin RL, Porcelli SA: CD1c restricts responses of mycobacteria-specific T cells. J Immunol 1996, 157:2795-2803[Abstract]
  19. Bendelac A, Rivera MN, Park SH, Roark JH: Mouse CD1-specific NK1 T cells: development, specificity, and function. Annu Rev Immunol 1997, 15:535-562[Medline]
  20. Apostolou I, Takahama Y, Belmant C, Kawano T, Huerre M, Marchal G, Cui J, Taniguchi M, Nakauchi H, Fournie J-J, Kourilsky P, Gachelin G: Murine natural killer T-cells contribute to the granulomatous reaction caused by mycobacterial cell walls. Proc Natl Acad Sci USA 1999, 96:5141-5146[Abstract/Free Full Text]
  21. Forman J, Klein J, Silver R, Liu M, Greenlee B, Moller D: Selective activation and accumulation of oligoclonal Vb-specific T cells in active pulmonary sarcoidosis. J Clin Invest 1994, 94:1533-1542
  22. Vissinga C, Springmeyer S, Concannon P: TCR expression and clonality analysis in pulmonary sarcoidosis. Hum Immunol 1996, 48:98-106[Medline]
  23. Moller DR: T-cell receptor genes in sarcoidosis. Sarcoidosis Vasc Diffuse Lung Dis 1998, 15:158-164[Medline]
  24. Ridley DS, Jopling WH: Classification of leprosy according to immunity. A five-group system. Int J Lepr Other Mycobact Dis 1966, 34:255-273[Medline]
  25. Pannetier C, Levraud JP, Lim A, Even J, Kourilsky P: The immunoscope approach for the analysis of T cell repertoires. Oksenberg JR eds. The Antigen T Cell Receptor: Selected Protocols and Applications. 1998, :pp 287-325 Chapman and Hall, New York
  26. Pannetier C, Cochet M, Darche S, Casrouge S, Zàller M, Kourilsky P: The sizes of the CDR3 hypervariable regions of the murine T-cell receptor b chain vary as a function of the recombined germ-line segments. Proc Natl Acad Sci USA 1993, 90:4319-4323[Abstract/Free Full Text]
  27. Even J, Lim A, Puisieux I, Ferradini L, Dietrich P-Y, Toubert A, Hercend T, Triebel F, Pannetier C, Kourilsky P: T-cell repertoires in healthy and diseased human tissues analysed by T-cell receptor b-chain CDR3 size determination: evidence for oligoclonal expansions in tumours and inflammatory diseases. Res Immunol 1995, 146:65-80[Medline]
  28. Porcelli S, Yockey C, Brenner M, Balk S: Analysis of T cell antigen receptor (TCR) expression by human peripheral blood CD4–8- a/b T cells demonstrates preferential use of several Vb genes and an invariant TCR a chain. J Exp Med 1993, 178:1-16[Abstract/Free Full Text]
  29. Han M, Harrison L, Kehn P, Stevenson K, Currier J, Robinson M: Invariant or highly conserved TCR a are expressed on double-negative (CD3+CD4-CD8-) and CD8+ T cells. J Immunol 1999, 163:301-311[Abstract/Free Full Text]
  30. Sieling P, Jullien D, Dahlem M, Tedder T, Rea T, Modlin R, Porcelli S: CD1 expression by dendritic cells in human leprosy lesions: correlation with effective host immunity. J Immunol 1999, 162:1851-1858[Abstract/Free Full Text]
  31. Nickoloff B, Wrone-Smith T, Bonish B, Porcelli S: Response of murine and normal human skin to injection of allogeneic blood-derived psoriatic immunocytes. Arch Dermatol 1999, 135:546-552[Abstract/Free Full Text]
  32. Dellabona P, Casorati G, Friedli B, Angman L, Sallusto F, Tunnacliffe A, Roosneck E, Lanzavecchia A: In vivo persistence of expanded clones specific for bacterial antigens within the human T cell receptor a/b CD4–8- subset. J Exp Med 1993, 177:1763-1771[Abstract/Free Full Text]
  33. Padovan E, Casorati G, Dellabona P, Meyer S, Brockhaus M, Lanzavecchia A: Expression of two T cell receptor a chains: dual receptor T cells. Science 1993, 262:422-424[Abstract/Free Full Text]
  34. Genevee C, Diu A, Nierat J, Caignard A, Dietrich P, Ferradini L, Roman-Roman S, Triebel F, Hercend T: An experimentally validated panel of subfamily-specific oligonucleotide primers (V alpha 1-w29/V beta 1-w24) for the study of human T cell receptor variable V gene segment usage by polymerase chain reaction. Eur J Immunol 1992, 22:1261-1269[Medline]
  35. Grant E, Degano M, Rosat, J-P, Stenger S, Modlin R, Wilson I, Porcelli S, Brenner M: Molecular recognition of lipid antigens by T cell receptors. J Exp Med 1999, 189:195–205
  36. Tilloy F, Treiner E, Park S-H, Garcia C, Lemonnier F, Delasalle H, Bendelac A, Bonneville M, Lantz O: An invariant TCR-a chain defines a novel TAP-independent MHC class Ib-restricted ab T cell subpopulation in mammals. J Exp Med 1999, 189:1907-1921[Abstract/Free Full Text]
  37. Grunewald J, Janson C, Eklund A, Oehrn M, Olerup O, Persson U, Wigzell H: Restricted Va2.3 gene usage by CD4+ T lymphocytes in bronchoalveolar lavage fluid from sarcoidosis patients correlates with HLA-DR3*. Eur J Immunol 1992, 22:129–135
  38. Jones C, Lake R, Wijeyekoon J, Mitchell D, du Bois R, O’Hehir R: Oligoclonal V gene usage by T lymphocytes in bronchoalveolar lavage fluid from sarcoidosis patients. Am J Respir Cell Mol Biol 1996, 14:470-477[Abstract]
  39. Forrester J, Wang Y, Ricalton N, Fitzgerald J, Loveless J, Newman L, King T, Kotzin B: TCR expression of activated T cell clones in the lungs of patients with pulmonary sarcoidosis. J Immunol 1994, 153:4291-4302[Abstract]
  40. Hoshino T, Suzuki R, Tsuruta Y, Matsutni T, Kikuchi M, Kawamoto M, Gouhara R, Shiraishi T, Mochizuki M, Itoh K, Oizumi K: Non-restricted T cell receptor (TCR)-Va and-Vb gene usage in patients with pulmonary sarcoidosis. Clin Exp Immunol 1997, 108:529-538[Medline]
  41. Lim A, Toubert A, Pannetier C, Dougados M, Charron DPK, Even J: Spread of clonal T-cell expansions in rheumatoid arthritis patients. Hum Immunol 1996, 48:77-83[Medline]
  42. Santamaria Babi L, Moser R, Perez Soler M, Picker L, Blaser K, Hauser C: Migration of skin-homing T cells across cytokine-activated human endothelial cell layers involves interaction of the cutaneous lymphocyte-associated antigen (CLA) the very late antigen-4 (VLA-4), and the lymphocyte function associated antigen-1 (LFA-1). J Immunol 1995, 154:1543–1550
  43. Klein J, Horn T, Formann J, Silver R, Teirstein A, Moller D: Selection of oligoclonal Vb-specific T cells in the intradermal response to Kveim-Siltzbach reagent in individuals with sarcoidosis. J Immunol 1995, 154:1450-1460[Abstract]
  44. Strohal R, Paucz L, Pehamberger H, Stingl G: T-cell repertoire of lymphocytes infiltrating cutaneous melanoma is predominated by Va specificities present in T-cells of normal human skin. Cancer Res 1994, 54:4734-4739[Abstract/Free Full Text]
  45. Wang X, Golkar L, Uyemura K, Ohmen J, Villahermosa L, Fajardo T, Cellona R, Walsh G, Modlin R: Selection of T lymphocytes bearing limited T-cell receptor b chains in the response to a human pathogen. J Immunol 1993, 151:7105-7116[Abstract]
  46. Arden B, Clark SP, Kabelitz D, Mak TW: Human T-cell receptor variable gene segment families. Immunogenetics 1995, 42:455-500[Medline]
  47. Ohmen J, Barnes P, Grisso C, Bloom B, Modlin R: Evidence for a superantigen in human tuberculosis. Immunity 1994, 1:35-43[Medline]
  48. Andersen P, Lavoie P, Sekaly, R-P, Churchill H, Kranz D, Schlievert P, Karjalainen K, Mariuzza R: Role of the T cell receptor a chain in stabilizing TCR-superantigen-MHC class II complexes. Immunity 1999, 10:473–483
  49. Daly K, Nguyen P, Hankley D, Zhang W, Woodland D, Blackman M: Contribution of the TCR alpha-chain to the differential recognition of bacterial and retroviral superantigens. J Immunol 1995, 155:27-34[Abstract]
  50. Lantz O, Bendelac A: An invariant T cell receptor a chain is used by a unique subset of major histocompatibility complex class 1-specific CD4+ and CD4-CD8- T cells in mice and humans. J Exp Med 1994, 180:1097-1106[Abstract/Free Full Text]
  51. Yoshimoto T, Bendelac A, Watson C, Hu-Li J, Paul WE: Role of NK1.1+ T cells in a TH2 response and in immunoglobulin E production. Science 1995, 270:1845–1847
  52. Wilson S, Kent S, Patton K, Orban T, Jackson R, Exley M, Porcelli S, Schatz D, Atkinson M, Balk S, Strominger J, Hafler D: Extreme Th1 bias of invariant Va24JaQ T cells in type 1 diabetes. Nature 1998, 391:691-694[Medline]
  53. Kawano T, Cui J, Koezuka Y, Toura I, Kaneko Y, Sato H, Kondo E, Harada M, Koseki H, Nakayama T, Tanaka Y, Taniguchi M: Natural killer-like nonspecific tumor cell lysis mediated by specific ligand-activated Va14 NKT cells. Proc Natl Acad Sci USA 1998, 95:5690-5693[Abstract/Free Full Text]
  54. Kawano T, Cui J, Koezuka Y, Toura I, Kaneko Y, Motoki K, Ueno H, Nakagawa R, Sato H, Kondo E, Koseki H, Taniguchi M: CD1d-restricted and TCR-mediated activation of Va14 NKT cells by glycosylceramides. Science 1997, 278:1626-1629[Abstract/Free Full Text]
  55. Cui J, Shin T, Kawano T, Sato H, Kondo E, Toura I, Kaneko Y, Koseki H, Kanno M, Taniguchi M: Requirement for Va14 NKT cells in IL-12 mediated rejection of tumors. Science 1997, 278:1623-1626[Abstract/Free Full Text]
  56. Exley M, Garcia J, Balk SP, Porcelli S: Requirements for CD1d recognition by human invariant Va24+, CD4-CD8- T cells. J Exp Med 1997, 186:109-120[Abstract/Free Full Text]
  57. Fairhurst RM, Wang C-X, Sieling PA, Modlin RL, Braun J: CD1 restricted T cells and resistance to polysaccharide-encapsulated bacteria. Immunol Today 1998, 19:257-259[Medline]
  58. Schofield L, McConville MJ, Hansen D, Campbell AS, Fraser-Reid B, Grusby MJ, Tachado SD: CD1d-restricted immunoglobulin G formation to GPI-anchored antigens mediated by NKT cells. Science 1999, 283:225-229[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Respir. Cell Mol. Bio.Home page
L. C. Zaba, G. P. Smith, M. Sanchez, and S. D. Prystowsky
Dendritic Cells in the Pathogenesis of Sarcoidosis
Am. J. Respir. Cell Mol. Biol., January 1, 2010; 42(1): 32 - 39.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
A. Peterfalvi, E. Gomori, T. Magyarlaki, J. Pal, M. Banati, A. Javorhazy, J. Szekeres-Bartho, L. Szereday, and Z. Illes
Invariant V{alpha}7.2-J{alpha}33 TCR is expressed in human kidney and brain tumors indicating infiltration by mucosal-associated invariant T (MAIT) cells
Int. Immunol., December 1, 2008; 20(12): 1517 - 1525.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
M. C. Iannuzzi, B. A. Rybicki, and A. S. Teirstein
Sarcoidosis
N. Engl. J. Med., November 22, 2007; 357(21): 2153 - 2165.
[Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
J. Grunewald and A. Eklund
State of the Art. Role of CD4+ T Cells in Sarcoidosis
Proceedings of the ATS, August 15, 2007; 4(5): 461 - 464.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. S. Im, N. Tapinos, G.-T. Chae, P. A. Illarionov, G. S. Besra, G. H. DeVries, R. L. Modlin, P. A. Sieling, A. Rambukkana, and S. A. Porcelli
Expression of CD1d Molecules by Human Schwann Cells and Potential Interactions with Immunoregulatory Invariant NK T Cells
J. Immunol., October 15, 2006; 177(8): 5226 - 5235.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
S. Kobayashi, Y. Kaneko, K.-i. Seino, Y. Yamada, S. Motohashi, J. Koike, K. Sugaya, T. Kuriyama, S. Asano, T. Tsuda, et al.
Impaired IFN-{gamma} production of V{alpha}24 NKT cells in non-remitting sarcoidosis
Int. Immunol., February 1, 2004; 16(2): 215 - 222.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
Z. Illes, M. Shimamura, J. Newcombe, N. Oka, and T. Yamamura
Accumulation of V{alpha}7.2-J{alpha}33 invariant T cells in human autoimmune inflammatory lesions in the nervous system
Int. Immunol., February 1, 2004; 16(2): 223 - 230.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. L. Gansert, V. Kiebler, M. Engele, F. Wittke, M. Rollinghoff, A. M. Krensky, S. A. Porcelli, R. L. Modlin, and S. Stenger
Human NKT Cells Express Granulysin and Exhibit Antimycobacterial Activity
J. Immunol., March 15, 2003; 170(6): 3154 - 3161.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Ingen-Housz-Oro, A. Bussel, B. Flageul, L. Michel, L. Dubertret, P. Kourilsky, G. Gachelin, H. Bachelez, and P. Musette
A prospective study on the evolution of the T-cell repertoire in patients with Sezary syndrome treated by extracorporeal photopheresis
Blood, August 28, 2002; 100(6): 2168 - 2174.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Mempel, C. Ronet, F. Suarez, M. Gilleron, G. Puzo, L. Van Kaer, A. Lehuen, P. Kourilsky, and G. Gachelin
Natural Killer T Cells Restricted by the Monomorphic MHC Class 1b CD1d1 Molecules Behave Like Inflammatory Cells
J. Immunol., January 1, 2002; 168(1): 365 - 371.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. Ronet, M. Mempel, N. Thieblemont, A. Lehuen, P. Kourilsky, and G. Gachelin
Role of the Complementarity-Determining Region 3 (CDR3) of the TCR-{{beta}} Chains Associated with the V{{alpha}}14 Semi-Invariant TCR {{alpha}}-Chain in the Selection of CD4+ NK T Cells
J. Immunol., February 1, 2001; 166(3): 1755 - 1762.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mempel, M.
Right arrow Articles by Musette, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mempel, M.
Right arrow Articles by Musette, P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS