| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |

§
From the Departments of Medicine,*
Pediatrics,
and Cell Biology and
Physiology,§
Washington University School of
Medicine, St. Louis, Missouri; and the Department of
Pathology,
Nippon Medical School,
Tokyo, Japan
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Intratracheal instillation of bleomycin is commonly used as an experimental model of lung injury having features of fibrosing alveolitis. Although many aspects of bleomycin-induced lung injury have been investigated,7 information about gelatinase B in this model is limited.8-10 Recently, we generated mice with a targeted mutation of gelatinase B that results in complete deficiency of gelatinase B.11 These gelatinase B-deficient mice were used in this study to investigate the role of gelatinase B in the development of bleomycin-induced fibrosing alveolitis.
| Materials and Methods |
|---|
|
|
|---|
Gelatinase B null 129 SvEv mice (gelatinase B-/-) were generated by targeted mutagenesis11 and housed with wild-type littermates (gelatinase B+/+) in a pathogen-free animal facility. Matrilysin (MMP-7) null C57BL/6 mice were kindly provided by Carole L. Wilson, Ph.D. (Washington University School of Medicine, St. Louis, MO).12 Mice were used at 3 to 4 months of age. All procedures were approved by the Washington University Animal Studies Committee.
Experimental Protocol
Mice were anesthetized with intraperitoneal ketamine and xylazine. The trachea was surgically exposed and 50 µl of sterile isotonic saline or 0.05 U of bleomycin sulfate (Blenoxane, Nippon Kayaku Co. Ltd., Tokyo, Japan) in 50 µl sterile isotonic saline was instilled into the trachea through a 28-gauge needle inserted between the cartilaginous rings. The surgical site was then sutured. The mice were killed 3, 7, 14, or 21 days later. The lungs from different animals were processed for morphological and biochemical studies or bronchoalveolar lavage (BAL) because both lungs were required for each type of analysis considering the heterogeneous distribution of the lesions in the lungs.
Bronchoalveolar Lavage
Twenty-one days after the intratracheal instillation of bleomycin or saline, animals were killed by CO2 narcosis and the lungs were lavaged in situ with a total of 1.8 ml of isotonic saline in three aliquots of 0.6 ml, as previously described.13 The leukocyte count and differential of the BAL fluid were determined using a hemocytometer and cytospins stained with LeukoStat (Fisher Scientific, Pittsburgh, PA).
Hydroxyproline and Desmosine
To assess the collagen and elastin content of lungs, whole lung hydrolysates were analyzed for hydroxyproline and desmosine as described.14
Quantitative Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) for Gelatinase B and TIMP-1
Immediately after animals were killed, the thorax was opened and
the lungs were removed and pulverized on dry-ice using a mortar and
pestle. Lung RNA was extracted by ToTally (Ambion, Austin, TX). One
µg of RNA was added to each reverse transcription (RT) reaction
mixture including 20 pmoles of each primer. RT was done using random
hexamers by incubating at 25°C for 10 minutes, 42°C for 30 minutes,
and 94°C for 5 minutes. The oligonucleotide primers for gelatinase B
were derived from exon 1 and exon 3 of the murine gelatinase B gene
(Table 1)
. Primers for
glycerylaldehyde-3-phosphate dehydrogenase (gAPDH) were
amplified along with gelatinase B, but were added later in the
reaction. All primers were obtained from Life Technologies, Inc., Grand
Island, NY. Amplification was done for 27 cycles consisting of 94°C
for 30 seconds, 60°C for 30 seconds, and 72°C for 30 seconds
(PTC-100; MJ Research, Inc., Waltham, MA). GAPDH primers were added
after 11 cycles. The reaction products were resolved in 1.5% agarose
gels, transferred onto positively charged nylon membranes
(BrightStar-Plus; Ambion, Austin, TX), and hybridized with
32P-labeled oligonucleotides specific for
gelatinase B or GAPDH in standard saline citrate, 1% sodium dodecyl
sulfate, 1x Denhardts, and 50 µg/ml of denatured salmon sperm DNA at
43°C for overnight. Filters were washed in 6x standard saline
citrate, 0.1% sodium dodecyl sulfate for 15 minutes at room
temperature, followed by 15 minutes at 52°C. The intensity of the
signal for gelatinase B mRNA was normalized to the signal for GAPDH
mRNA using a phosphorimager (Molecular Imager System GS-525; Bio-Rad,
Hercules, CA). For RT-PCR analysis of TIMP-1, the PCR annealing
temperature was 68°C and the GAPDH primers were added after six
cycles. The primers and probe for TIMP-1 are shown in Table 1
.
|
Lungs were perfused with saline through the right ventricle to remove blood and inflated with 10% buffered formalin or 4% paraformaldehyde at a constant pressure of 20 cm H2O via the trachea for 20 minutes. The lungs were then excised, immersion-fixed with 10% buffered formalin or 4% paraformaldehyde overnight, dehydrated and embedded in paraffin, and cut into 3-µm sections.
Antibody to Gelatinase B
A polyclonal antibody to murine gelatinase B was raised in rabbits against a recombinant protein corresponding to the catalytic domain of murine gelatinase B, Phe108-Gly444. The catalytic domain of murine gelatinase B was amplified by PCR with the primers 5'TGTCCCTTCATATGTTCCAAACCTTCAAAGGCC3' and 5'TACCAACTCATATGTCAACCATACAGATACTGGATGC3'. The PCR product was subcloned into the NdeI site of pET-14b (Novagen, Madison, WI), and expressed in BL21 (DE3) bacterial cells as a fusion protein containing an N-terminal His-Tag having a molecular mass of 40 kd. Induction of the fusion protein was achieved with 0.4 mmol/L isopropylthio-ß-D-galactosidase (IPTG) for 5 hours. Cells were harvested by centrifugation at 5,000 x g for 5 minutes, resuspended in 40 ml binding buffer (5 mmol/L imidazole, 500 mmol/L NaCl, 20 mmol/L Tris, pH 7.9), and lysed by three cycles of freezing/thawing (-80°C and 37°C), followed by sonication 8 x 20 seconds. Insoluble inclusion bodies were collected by centrifugation at 20,000 x g for 15 minutes, washed once in binding buffer, and finally resuspended in 5 ml of binding buffer containing 6 mol/L urea and incubated on ice for 1 hour. Insoluble material was removed by centrifugation at 39,000 x g for 20 minutes, and the supernatant was filtered through a 0.45-µm membrane before affinity chromatography. Rabbits were immunized with 20 µg of this protein with Freunds adjuvant for the first injection, whereas 10 µg were used for booster at 3 and 6 weeks. Specificity of the antibody for gelatinase B was confirmed using cytospins of peripheral blood leukocytes isolated from gelatinase B+/+ and gelatinase B-deficient mice. Neutrophils from gelatinase B+/+ mice showed diffuse cytoplasmic staining whereas neutrophils from gelatinase B-deficient mice showed no staining.
Gelatinase B Immunohistochemistry
Immunohistochemical staining for gelatinase B was performed on paraffin-embedded tissues that were deparaffinized and rehydrated. Endogenous peroxidase activity was blocked with 0.3% hydrogen peroxide in methanol for 30 minutes and microwaved for 10 minutes with 6% urea in distilled water to unmask antigenic sites. After treatment with normal goat serum for 10 minutes, lung sections were incubated with rabbit anti-murine gelatinase B antibody (1:1,500) overnight at 4°C, then incubated with biotinylated goat anti-rabbit IgG antibody (1:200), and exposed to a solution of streptavidin-biotin-peroxidase complex (DAKO, Carpinteria, CA). Peroxidase activity was localized using 3,3'-diaminobenzidine tetrahydrochloride as a chromogenic substrate. Tissue sections were counterstained with Mayers hematoxylin and mounted.
Assessment of Bronchiolization
Alveolar bronchiolization was identified as cells resembling
bronchiolar epithelium lining normal or thickened alveolar walls, often
in an acinar formation, as described by Nettesheim and
Szakal.15
The tissues were stained with elastica-Masson
Goldner, which facilitated detection of bronchiolized cells. Because of
the heterogeneity in amount and distribution of bronchiolization within
the lungs after intratracheal bleomycin, at least five saggital
sections of both lungs from each animal were analyzed at 200x for
bronchiolization. Each bronchiolization lesion in each section was
graded from I to IV using a modification of the grading system devised
by Jensen-Taubman et al (Table 2)
.16
|
Transmission electron microscopy was done after standard processing.17 Briefly, the lungs were inflated and fixed with 2.5% v/v glutaraldehyde in 0.1 mol/L phosphate buffer, pH 7.2, cut into pieces, rinsed in phosphate buffer, postfixed with 1% osmium tetroxide in phosphate buffer for 2 hours, dehydrated, and embedded in Epok 812. One-µm thick sections of the embedded tissues were stained with alkaline toluidine blue and observed with a light microscope. Appropriate areas were trimmed for ultrathin sections, which were stained with uranyl acetate and lead citrate and examined with a Hitachi H7100 transmission electron microscope (Hitachi Ltd., Tokyo, Japan).
Immunohistochemical Analysis for Proliferating Cells, Clara Cell-Specific Protein, Helix Transcription Factor 4 (HFH-4), and Surfactant Protein C (SP-C)
To assess cell proliferation after bleomycin, lung tissue was stained with a monoclonal antibody to the S phase-associated proliferating cell nuclear antigen (PCNA) (DAKO).18 To assist in determining the phenotype of bronchiolized cells in lung tissue 21 days after bleomycin, the tissue was stained with antibodies to Clara cell-specific protein to identify Clara cells,19 to forkhead/winged HFH-4 that is expressed by ciliated cells and cells of a ciliated lineage20-22 and to SP-C to identify alveolar type II cells.23 These antibodies were kindly provided by Francesco DeMayo (Baylor University, Waco, TX), Steven Brody (Washington University, St. Louis, MO), and Jeffrey Whitsett (University of Cincinnati, Cincinnati, OH), respectively.
Statistical Analysis
All data are expressed as means ± SEM. Statistical differences among groups were determined using one-factor analysis of variance and Students unpaired t-test between two groups when appropriate. Significance was defined at the P < 0.05 level unless otherwise stated.
| Results |
|---|
|
|
|---|
Bleomycin-treated animals showed a significant increase in the
numbers of macrophages, neutrophils, and lymphocytes in BAL fluid 21
days after bleomycin instillation compared with nontreated or
saline-treated controls (Figure 1)
. There
was no difference in the number or differential of inflammatory cells
between gelatinase B+/+ and gelatinase B-/- mice. Similar to earlier
findings that neutrophil emigration into tissues is preserved in
gelatinase B deficiency,13
these data suggest that
gelatinase B is not critical for lymphocyte or monocyte emigration into
lung.
|
Whole lung collagen and elastin, as determined by hydroxyproline
and desmosine content, respectively, were increased comparably in
gelatinase B+/+ and gelatinase B-/- mice 21 days after bleomycin
(Figure 2)
, ~50%, a change that is
consistent with the findings of others.24
Thus, gelatinase
B does not seem to influence the net accumulation of collagen or
elastin after intratracheal bleomycin.
|
In gelatinase B+/+ mice, the RT-PCR-derived signal for lung
gelatinase B mRNA, normalized for GAPDH mRNA, was present at low levels
in controls at day 0, was increased threefold 14 days postbleomycin and
returned to normal levels by 21 days (Figure 3, a and b)
. As anticipated, lung RNA
obtained from gelatinase B-/- mice did not show gelatinase B signal
at any time point after bleomycin (data not shown). To determine
whether TIMP-1 mRNA was altered during the development of
bleomycin-induced fibrosis and affected by the absence of gelatinase B
expression, we compared TIMP-1 mRNA levels between gelatinase B+/+ and
gelatinase B-/- mice by quantitative RT-PCR. TIMP-1 mRNA was
increased comparably at 7 days and 14 days after bleomycin instillation
in both gelatinase B+/+ and gelatinase B-/- mice, and returned to
near-baseline levels by 21 days after treatment in both types of mice
(Figure 4)
. Accordingly, the absence of
gelatinase B did not influence the expression of TIMP-1 elicited by
bleomycin.
|
|
Immunoreactivity for gelatinase B was present only in occasional
bronchiolar and alveolar epithelial cells of normal lungs (Figure 5a)
. In contrast, gelatinase B staining
was prominent in nonciliated airway epithelium and alveolar
bronchiolized epithelial cells 7 and 14 days after intratracheal
bleomycin (Figure 5, b and c)
in gelatinase B+/+ mice. As expected,
neutrophils and macrophages were positive in both untreated and
bleomycin-treated lungs in gelatinase B+/+ mice, and tissues were
uniformly negative in gelatinase B-/- mice (data not shown).
|
The lungs of saline-treated animals appeared normal, regardless of
their gelatinase B genotype. At 21 days after intratracheal bleomycin,
abnormal matrix deposition was associated with numerous interstitial
cells. The severity of fibrosis seemed similar in gelatinase B+/+ and
gelatinase B-/- mice. In gelatinase B+/+ mice there was prominence of
acinar structures lined by cuboidal epithelial cells, or conspicuously
thickened interalveolar septa lined by hypertrophied and hyperplastic
cuboidal epithelial cells either alongside the bronchioles or at their
termination (Figure 6a)
. The overall
extent of this so-called bronchiolization varied from animal to animal,
and a high degree of heterogeneity in the magnitude of bronchiolar
epithelial cell extension into alveolar ducts was noted within the
lungs of an individual animal. Bronchiolization changes have been
observed in human diseases and in animal models of pulmonary fibrosis,
including postbleomycin.17
In sharp contrast, lesions of
bronchiolization were hardly observed in the bleomycin-induced
pulmonary fibrosis in gelatinase B-/- mice (Figure 6b)
. To assess
whether other MMP deficiencies would affect postbleomycin
bronchiolization, bleomycin was administered to matrilysin-deficient
mice and littermate controls. Matrilysin was chosen because this MMP
has been implicated in airway epithelial repair.25
Unlike
in gelatinase B deficiency, bronchiolization was present in
matrilysin-deficient mice 21 days after intratracheal bleomycin to the
same extent as in littermate gelatinase B+/+ controls (Figure 6c)
.
|
To confirm the impression of decreased alveolar bronchiolization
in gelatinase B-/- mice, we compared the relative frequency of low-
and high-grade bronchiolization in bleomycin-treated gelatinase B+/+
and -/- mice by thoroughly examining five or more Elastica-Masson
Goldner-stained whole lung sections per animal in six gelatinase B+/+
and six gelatinase B-/- animals as well as one pair of matrilysin+/+
and -/- mice at 21 days after bleomycin. Bronchiolization was
uniformly grade II or lower in gelatinase B-/- animals whereas grades
greater than II were present in all of the gelatinase B+/+ animals
(Table 3)
. The composite bronchiolization
score for each animal, calculated as the incidence of bronchiolization
multipled by each grade and summed up in each animal, was strikingly
higher in the gelatinase B+/+ animals. The gradation of
bronchiolization in matrilysin-/- mice was comparable to that
observed in the matrilysin+/+ littermate control as well as that seen
in the gelatinase B+/+ controls. Accordingly, bronchiolization seemed
unaffected in matrilysin-deficient mice whereas both the incidence and
extent of bronchiolization was markedly reduced in gelatinase
B-deficient mice.
|
Because alveolar bronchiolization might be the result of migration
and proliferation of terminal airway epithelial cells, we examined the
terminal airways of gelatinase B-deficient and gelatinase B+/+ mice
after bleomycin. Under normal conditions, in both gelatinase B+/+ and
gelatinase B-/- animals the epithelial cells lining the terminal
bronchioles in areas near the alveolar duct junction were mainly Clara
cells. Three days after intratracheal bleomycin, most of these
single-layered cells were swollen. The histology pattern and the
Clara cell ultrastructure did not vary between the two groups. (Figure 7, a and b)
. Apparently, gelatinase B
deficiency did not confer obvious protection against the acute effects
of bleomycin on terminal airway epithelium. At 21 days, however, there
was prominent bronchiolization in gelatinase B +/+ mice comprised of
Clara-like cells (Figure 7c)
, but bronchiolization was not seen in
gelatinase B-/- animals (Figure 7d)
.
|
Because reduced bronchiolization in gelatinase B-/- mice after
bleomycin might be the result of reduced proliferation of airway and/or
alveolar epithelium, cell proliferation was evaluated by PCNA staining
at 3 and 21 days. Three days after bleomycin some of the terminal
bronchiolar epithelial cells were PCNA-positive in both gelatinase B+/+
and -/- mice (data not shown). Subsequently, in gelatinase B+/+ mice,
PCNA immunoreactivity was found in cells located in the distal parts of
high-grade bronchiolization lesions, and was not seen in cells in
bronchiolization immediately adjacent to terminal bronchioles or in
epithelium lining the bronchioles themselves (Figure 8a)
. At this time point, proliferation
seemed to be occurring mainly in bronchiolized cells within alveolar
tissue. In gelatinase B-/- mice, PCNA-positive cells were seen in
low-grade bronchiolization and in some terminal airway epithelial cells
(Figure 8b)
. The presence of active cell proliferation in gelatinase
B-/- mice suggests that the minimal bronchiolization in these animals
is not because of a gross decrease in epithelial cell proliferative
activity. Further analysis would be necessary to exclude differences in
proliferation at earlier time points. Most of the bronchiolized cells
were positive for Clara cell-specific protein. They were uniformly
negative for SP-C, although alveolar epithelial cells in normal
appearing alveoli on the same sections did stain (not shown). Thus, by
this marker bronchiolized cells did not seem to be alveolar type II
cells.
|
| Discussion |
|---|
|
|
|---|
29
or
plasminogen activator inhibitor-1,30
by intravenous
administration of antibodies against transforming growth
factor-ß,31
and by intrapulmonary instillation of
keratinocyte growth factor.24
Although bleomycin may
damage structural cells of the lungs directly32,33
its
principal mode of action in leading to IPF-like pathology seems to be
via endogenous mediators of inflammation, fibrinolysis, and
proliferation. Recent observations have demonstrated gelatinase B in human IPF lesions,5 increased gelatinase B expression by alveolar macrophages from lungs affected by IPF,7 and gelatinolytic activity in BAL fluid in experimental bleomycin-induced lung injury.9 Consistent with these findings, we have detected gelatinase B by immunohistochemistry in terminal airway epithelial cells and bronchiolized epithelial cells at 7 and 14 days after bleomycin administration, but not in lung tissue of saline-treated animals. Moreover, we detected twofold to threefold increases in gelatinase B mRNA by RT-PCR in the lungs at 7 and 14 days with a return to baseline by 21 days. These data are important because neutrophils do not contain gelatinase B mRNA although they do contain gelatinase B protein.34,35 Thus, the increased gelatinase B associated with bleomycin-induced lung injury is not simply release of gelatinase B from neutrophils in the lungs.
In contrast to our findings, others have not detected induction of gelatinase B mRNA in whole lung as determined by Northern analysis after receiving serial injections of bleomycin intraperitoneally.10 Because we found that gelatinase B mRNA increased only transiently and the increase was modest, peaking around day 14 with a threefold increase over the baseline, we would suggest that the increase might not be obvious by Northern analysis. In addition to increased gelatinase B mRNA levels, we also observed gelatinase B in terminal airway epithelial cells and bronchiolized epithelial cells by immunohistochemistry whereas in control lung tissues there was no staining of epithelial cells. Therefore, we are confident that gelatinase B was induced in epithelial cells in bleomycin-treated gelatinase B+/+ mice. We did not examine lung tissue for expression of other MMPs. In the same study in which gelatinase B induction was not observed,10 inductions of interstitial collagenase (MMP-13) and stromelysin-1 (MMP-3) expression were also not found, but macrophage metalloelastase (MMP-12) mRNA increased 10-fold at 21 days, and macrophages demonstrated macrophage metalloelastase prominently by immunohistochemistry. The significance of increased macrophage metalloelastase in this context remains to be determined.
Despite their inability to express gelatinase B mRNA, gelatinase B-deficient mice showed increased TIMP-1 mRNA levels after intratracheal bleomycin equivalent to the levels seen in gelatinase B+/+ mice, and similar to results of others.10 Clearly, the induction of TIMP-1 after bleomycin is not triggered by gelatinase B expression. It is well recognized that the regulation of expression of MMPs and TIMPs is not necessarily parallel.36
By two criteria, gelatinase B deficiency did not seem to affect the fibro-inflammatory response to intratracheal bleomycin. First, the lungs of deficient animals showed alveolar inflammation comparable to that seen in gelatinase B+/+ animals. Second, the lungs of deficient animals had increased collagen and elastin content at 21 days that matched the increases observed in the gelatinase B+/+ controls. Thus, gelatinase B does not play an essential role in the initiation or evolution of the inflammatory and fibrotic changes that develop after intratracheal bleomycin, and gelatinase B deficiency does not ameliorate these characteristic lesions of bleomycin-induced lung injury.
An intriguing histopathological finding in bleomycin-treated mice,9,37,38 rats,19 and baboons39 is clusters of cuboidal epithelial cells, commonly in acinar or papillary formations, in regions of alveolar injury. This pathological pattern, called alveolar bronchiolization,15 is not restricted to bleomycin-induced lung injury, as it is also seen in human IPF5 and lung cancer16,40 and in various types of experimental lung injury, including viral infection,41 and exposure to ozone,42 chromate,15 or paraquat.43 Alveolar bronchiolization in IPF is thought to be permanent as it is observed in honeycomb lesions, but it is considered a temporary phenomenon after alveolar damage in experimental fibrosing alveolitis.17,43
The histogenesis of the cells comprising alveolar bronchiolization is uncertain despite many years of study. One speculation is that these cells arise from colonization and proliferation of differentiated epithelial cells that have migrated from the distal conducting airways15,44 or by migration and then differentiation of progenitor cells located in terminal airways. An alternative concept is that the cells arise from alveolar epithelial cells or their progenitors. Findings in rats of prominent terminal bronchiolar epithelial cell proliferation by bromodeoxyuridine labeling at 3 days after intratracheal bleomycin when alveolar type II cell labeling is minimal would favor the hypothesis that the bronchiolized cells arise from the terminal airways.17
Recent studies of bleomycin-induced lung injury in C57BL/6 mice suggest that bronchiolized cells and the adjacent distal airway epithelial cells have a complex phenotype, showing co-expression of markers of both alveolar type II cells and of Clara cells37,38 and in some instances even having cilia. These data would support the concept that there is a population of progenitor cells that are important in alveolar epithelial repair which are capable of differentiating into either Clara cells or alveolar type II cells, as well as into cells with features of both types of cells.45 Our data confirm the presence of Clara cell-specific protein-positive cells within areas of alveolar bronchiolization, agreeing with earlier work pointing to a bronchiolar origin of bronchiolized alveolar cells. We have not observed SP-C-positive cells in sites of alveolar bronchiolization, but recognize that a stem cell for both Clara cells and alveolar type II cells might originate in distal airways and be the source of alveolar bronchiolized cells.46,47
Alveolar bronchiolization was markedly reduced in gelatinase B-deficient mice compared to gelatinase B+/+ controls, pointing strongly to a role for gelatinase B in alveolar bronchiolization (Figure 9). Although alveolar bronchiolization has been considered beneficial by helping to cover denuded alveolar walls in alveolar injury, there was no evidence that lack of bronchiolization in gelatinase B-/- mice resulted in worse fibrosing alveolitis. It is intriguing to speculate that gelatinase B facilitates distal airway epithelial cells, including epithelial stem cells, to migrate into sites of alveolar injury. Because gelatinase B has proteolytic activity against a number of extracellular matrix components,3 release of gelatinase B from epithelial cells could disrupt cell-cell and cell-matrix attachment and enable bronchiolar epithelial cells to migrate into zones of alveolar injury.
Recent evidence shows that the extracellular matrix is not only a structural support, but also a storage site for many secreted and bound growth factors.48,49 Gelatinase activity may provide a stimulus to tissue repair by releasing cytokines and/or growth factors from extracellular matrix, and the expression of gelatinase B has been reported to correlate with epithelial cell proliferation in bleomycin-induced lung injury.9 Considering the degradative capacity of gelatinase B for some components of basement membrane, the presence of gelatinase B in terminal airway and bronchiolized epithelial cells suggests that basement membrane damage is involved in the process of alveolar bronchiolization.
Alveolar and airway epithelial cells can synthesize gelatinase B in vitro.50,51 Wound repair of human respiratory epithelium in vitro requires gelatinase B which seems to operate by facilitating epithelial cell migration.52,53 The possibility that gelatinase B might function to promote cell migration has support from studies with other MMPs. For example, collagenase-1 (MMP-1) acting on type I collagen is required for keratinocyte migration during cutaneous wound repair.54 Matrilysin (MMP-7) is primarily expressed in ciliated airway epithelial cells and facilitates re-epithelialization of tracheal wounds.25 Interestingly, we found that matrilysin deficiency does not impair alveolar bronchiolization in bleomycin-induced lung injury suggesting that different MMPs may function in repair at different levels of the airways.
In conclusion, bleomycin induced-lung injury is associated with transient up-regulation of gelatinase B in terminal airway epithelium and cells comprising alveolar bronchiolization. Although typical pulmonary inflammation and fibrosis occur in gelatinase B deficiency, alveolar bronchiolization is essentially absent whereas it is a prominent feature of bleomycin-induced lung injury in gelatinase B+/+ mice. Because bronchiolized cells in alveoli have morphological features of Clara cells and ciliated cells and display markers for these cell types but not for alveolar type II cells, it seems that they arise from bronchiolar cells or progenitors of bronchiolar cells. The molecular mechanisms linking gelatinase B expression to alveolar bronchiolization in bleomycin-induced lung injury are not yet established, but facilitating cell migration and proliferation by disrupting cell attachments seems likely.
| Acknowledgements |
|---|
| Footnotes |
|---|
Supported by grants HL47328 and HL29594 from the National Heart, Lung, and Blood Institute of the National Institutes of Health, the Alan A. and Edith L. Wolff Charitable Trust (to R. M. S.), and a Research Fellowship from the Japan Society for the Promotion of Science for Young Scientists (to T. B.).
Accepted for publication April 27, 2000.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S. E. Gill, I. Huizar, E. M. Bench, S. W. Sussman, Y. Wang, R. Khokha, and W. C. Parks Tissue Inhibitor of Metalloproteinases 3 Regulates Resolution of Inflammation following Acute Lung Injury Am. J. Pathol., January 1, 2010; 176(1): 64 - 73. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-Y. Wang, A. Demelash, H. Kim, S. Jensen-Taubman, E. H. Dakir, L. Ozbun, M. J. Birrer, and R. I. Linnoila Matrilysin-1 Mediates Bronchiolization of Alveoli, a Potential Premalignant Change in Lung Cancer Am. J. Pathol., August 1, 2009; 175(2): 592 - 604. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. F. McAuley and M. A. Matthay Clara Cell Protein CC16: A New Lung Epithelial Biomarker for Acute Lung Injury Chest, June 1, 2009; 135(6): 1408 - 1410. [Full Text] [PDF] |
||||
![]() |
R. Foronjy, T. Nkyimbeng, A. Wallace, J. Thankachen, Y. Okada, V. Lemaitre, and J. D'Armiento Transgenic expression of matrix metalloproteinase-9 causes adult-onset emphysema in mice associated with the loss of alveolar elastin Am J Physiol Lung Cell Mol Physiol, June 1, 2008; 294(6): L1149 - L1157. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Chen, J. K. McGuire, R. C. Hackman, K.-H. Kim, R. A. Black, K. Poindexter, W. Yan, P. Liu, A. J. Chen, W. C. Parks, et al. Tissue Inhibitor of Metalloproteinase-1 Moderates Airway Re-Epithelialization by Regulating Matrilysin Activity Am. J. Pathol., May 1, 2008; 172(5): 1256 - 1270. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. M. Wilczynski, F. A. Konopacki, E. Wilczek, Z. Lasiecka, A. Gorlewicz, P. Michaluk, M. Wawrzyniak, M. Malinowska, P. Okulski, L. R. Kolodziej, et al. Important role of matrix metalloproteinase 9 in epileptogenesis J. Cell Biol., March 5, 2008; 180(5): 1021 - 1035. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Odajima, T. Betsuyaku, Y. Nasuhara, and M. Nishimura Loss of Caveolin-1 in Bronchiolization in Lung Fibrosis J. Histochem. Cytochem., September 1, 2007; 55(9): 899 - 909. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Greenlee, Z. Werb, and F. Kheradmand Matrix Metalloproteinases in Lung: Multiple, Multifarious, and Multifaceted Physiol Rev, January 1, 2007; 87(1): 69 - 98. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Greenlee, D. B. Corry, D. A. Engler, R. K. Matsunami, P. Tessier, R. G. Cook, Z. Werb, and F. Kheradmand Proteomic Identification of In Vivo Substrates for Matrix Metalloproteinases 2 and 9 Reveals a Mechanism for Resolution of Inflammation J. Immunol., November 15, 2006; 177(10): 7312 - 7321. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-C. LAI Chinese herbal medicine yin-chen-extract as an adjunct to anthelmintic albendazole used against angiostrongylus cantonensis-induced eosinophilic meningitis or meningoencephalitis. Am J Trop Med Hyg, September 1, 2006; 75(3): 556 - 562. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Tan, C. L. Fattman, L. M. Niehouse, J. M. Tobolewski, L. E. Hanford, Q. Li, F. A. Monzon, W. C. Parks, and T. D. Oury Matrix Metalloproteinases Promote Inflammation and Fibrosis in Asbestos-Induced Lung Injury in Mice Am. J. Respir. Cell Mol. Biol., September 1, 2006; 35(3): 289 - 297. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Yan, X. Hu, H. Song, K. Yin, R. J. Bateman, J. R. Cirrito, Q. Xiao, F. F. Hsu, J. W. Turk, J. Xu, et al. Matrix Metalloproteinase-9 Degrades Amyloid-beta Fibrils in Vitro and Compact Plaques in Situ J. Biol. Chem., August 25, 2006; 281(34): 24566 - 24574. [Abstract] [Full Text] [PDF] |
||||
![]() |
P T G Elkington and J S Friedland Matrix metalloproteinases in destructive pulmonary pathology Thorax, March 1, 2006; 61(3): 259 - 266. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Pardo and M. Selman Matrix metalloproteases in aberrant fibrotic tissue remodeling. Proceedings of the ATS, January 1, 2006; 3(4): 383 - 388. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Owen Proteinases and Oxidants as Targets in the Treatment of Chronic Obstructive Pulmonary Disease Proceedings of the ATS, November 1, 2005; 2(4): 373 - 385. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Y. Lee, C. Schroedl, J. K. Brunelle, L. J. Buccellato, O. I. Akinci, H. Kaneto, C. Snyder, J. Eisenbart, G. R. S. Budinger, and N. S. Chandel Bleomycin induces alveolar epithelial cell death through JNK-dependent activation of the mitochondrial death pathway Am J Physiol Lung Cell Mol Physiol, October 1, 2005; 289(4): L521 - L528. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Addis-Lieser, J. Kohl, and M. G. Chiaramonte Opposing Regulatory Roles of Complement Factor 5 in the Development of Bleomycin-Induced Pulmonary Fibrosis J. Immunol., August 1, 2005; 175(3): 1894 - 1902. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Chunn, J. G. Molina, T. Mi, Y. Xia, R. E. Kellems, and M. R. Blackburn Adenosine-Dependent Pulmonary Fibrosis in Adenosine Deaminase-Deficient Mice J. Immunol., August 1, 2005; 175(3): 1937 - 1946. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Chua, J. Gauldie, and G. J. Laurent Pulmonary Fibrosis: Searching for Model Answers Am. J. Respir. Cell Mol. Biol., July 1, 2005; 33(1): 9 - 13. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Lian, Y. Qin, S. A. Hossain, L. Yang, A. White, H. Xu, J. M. Shipley, T. Li, R. M. Senior, H. Du, et al. Overexpression of Stat3C in Pulmonary Epithelium Protects against Hyperoxic Lung Injury J. Immunol., June 1, 2005; 174(11): 7250 - 7256. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. L. Adair-Kirk, J. J. Atkinson, D. G. Kelley, R. H. Arch, J. H. Miner, and R. M. Senior A Chemotactic Peptide from Laminin {alpha}5 Functions as a Regulator of Inflammatory Immune Responses via TNF{alpha}-mediated Signaling J. Immunol., February 1, 2005; 174(3): 1621 - 1629. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Odaka, M. Tanioka, and T. Itoh Matrix Metalloproteinase-9 in Macrophages Induces Thymic Neovascularization following Thymocyte Apoptosis J. Immunol., January 15, 2005; 174(2): 846 - 853. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Berman, D. Serlin, X. Li, G. Whitley, J. Hayes, D. C. Rishikof, D. A. Ricupero, L. Liaw, M. Goetschkes, and A. W. O'Regan Altered bleomycin-induced lung fibrosis in osteopontin-deficient mice Am J Physiol Lung Cell Mol Physiol, June 1, 2004; 286(6): L1311 - L1318. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Sivak, J. A. West-Mays, A. Yee, T. Williams, and M. E. Fini Transcription Factors Pax6 and AP-2{alpha} Interact To Coordinate Corneal Epithelial Repair by Controlling Expression of Matrix Metalloproteinase Gelatinase B Mol. Cell. Biol., January 1, 2004; 24(1): 245 - 257. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. G. Sandler, M. M. Mentink-Kane, A. W. Cheever, and T. A. Wynn Global Gene Expression Profiles During Acute Pathogen-Induced Pulmonary Inflammation Reveal Divergent Roles for Th1 and Th2 Responses in Tissue Repair J. Immunol., October 1, 2003; 171(7): 3655 - 3667. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Cisneros-Lira, M. Gaxiola, C. Ramos, M. Selman, and A. Pardo Cigarette smoke exposure potentiates bleomycin-induced lung fibrosis in guinea pigs Am J Physiol Lung Cell Mol Physiol, October 1, 2003; 285(4): L949 - L956. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Owen, Z. Hu, B. Barrick, and S. D. Shapiro Inducible Expression of Tissue Inhibitor of Metalloproteinases-Resistant Matrix Metalloproteinase-9 on the Cell Surface of Neutrophils Am. J. Respir. Cell Mol. Biol., September 1, 2003; 29(3): 283 - 294. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Betsuyaku, M. Tanino, K. Nagai, Y. Nasuhara, M. Nishimura, and R. M. Senior Extracellular Matrix Metalloproteinase Inducer Is Increased in Smokers' Bronchoalveolar Lavage Fluid Am. J. Respir. Crit. Care Med., July 15, 2003; 168(2): 222 - 227. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. L. Adair-Kirk, J. J. Atkinson, T. J. Broekelmann, M. Doi, K. Tryggvason, J. H. Miner, R. P. Mecham, and R. M. Senior A Site on Laminin {alpha}5, AQARSAASKVKVSMKF, Induces Inflammatory Cell Production of Matrix Metalloproteinase-9 and Chemotaxis J. Immunol., July 1, 2003; 171(1): 398 - 406. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. McGuire, Q. Li, and W. C. Parks Matrilysin (Matrix Metalloproteinase-7) Mediates E-Cadherin Ectodomain Shedding in Injured Lung Epithelium Am. J. Pathol., June 1, 2003; 162(6): 1831 - 1843. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Betsuyaku, K. Kadomatsu, G. L. Griffin, T. Muramatsu, and R. M. Senior Increased Basigin in Bleomycin-Induced Lung Injury Am. J. Respir. Cell Mol. Biol., May 1, 2003; 28(5): 600 - 606. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. K. Winkler, J. K. Foldes, R. C. Bunn, and J. L. Fowlkes Implications for matrix metalloproteinases as modulators of pediatric lung disease Am J Physiol Lung Cell Mol Physiol, April 1, 2003; 284(4): L557 - L565. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Pardo, V. Ruiz, J. L. Arreola, R. Ramirez, J. Cisneros-Lira, M. Gaxiola, R. Barrios, S. V. Kala, M. W. Lieberman, and M. Selman Bleomycin-induced Pulmonary Fibrosis Is Attenuated in {gamma}-Glutamyl Transpeptidase-Deficient Mice Am. J. Respir. Crit. Care Med., March 15, 2003; 167(6): 925 - 932. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Atkinson and R. M. Senior Matrix Metalloproteinase-9 in Lung Remodeling Am. J. Respir. Cell Mol. Biol., January 1, 2003; 28(1): 12 - 24. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Okamoto, G. Valacchi, K. Gohil, T. Akaike, and A. van der Vliet S-Nitrosothiols Inhibit Cytokine-Mediated Induction of Matrix Metalloproteinase-9 in Airway Epithelial Cells Am. J. Respir. Cell Mol. Biol., October 1, 2002; 27(4): 463 - 473. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. K. Winkler and J. L. Fowlkes Metalloproteinase and growth factor interactions: do they play a role in pulmonary fibrosis? Am J Physiol Lung Cell Mol Physiol, July 1, 2002; 283(1): L1 - L11. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Tanino, H. Makita, K. Miyamoto, T. Betsuyaku, Y. Ohtsuka, J. Nishihira, and M. Nishimura Role of macrophage migration inhibitory factor in bleomycin-induced lung injury and fibrosis in mice Am J Physiol Lung Cell Mol Physiol, July 1, 2002; 283(1): L156 - L162. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. P. Cosgrove, M. I. Schwarz, M. W. Geraci, K. K. Brown, and G. S. Worthen Overexpression of Matrix Metalloproteinase-7 in Pulmonary Fibrosis Chest, March 1, 2002; 121 (2009): 25S - 26S. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. W. Lawson, L. S. Van Winkle, E. Toskala, R. M. Senior, W. C. Parks, and C. G. Plopper Mouse Strain Modulates the Role of the Ciliated Cell in Acute Tracheobronchial Airway Injury-Distal Airways Am. J. Pathol., January 1, 2002; 160(1): 315 - 327. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Vaillant, M. G. Chiaramonte, A. W. Cheever, P. D. Soloway, and T. A. Wynn Regulation of Hepatic Fibrosis and Extracellular Matrix Genes by the Th Response: New Insight into the Role of Tissue Inhibitors of Matrix Metalloproteinases J. Immunol., December 15, 2001; 167(12): 7017 - 7026. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Asahi, X. Wang, T. Mori, T. Sumii, J.-C. Jung, M. A. Moskowitz, M. E. Fini, and E. H. Lo Effects of Matrix Metalloproteinase-9 Gene Knock-Out on the Proteolysis of Blood-Brain Barrier and White Matter Components after Cerebral Ischemia J. Neurosci., October 1, 2001; 21(19): 7724 - 7732. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Betsuyaku, G. L. Griffin, M. A. Watson, and R. M. Senior Laser Capture Microdissection and Real-Time Reverse Transcriptase/ Polymerase Chain Reaction of Bronchiolar Epithelium after Bleomycin Am. J. Respir. Cell Mol. Biol., September 1, 2001; 25(3): 278 - 284. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Opdenakker, P. E. Van den Steen, B. Dubois, I. Nelissen, E. Van Coillie, S. Masure, P. Proost, and J. Van Damme Gelatinase B functions as regulator and effector in leukocyte biology J. Leukoc. Biol., June 1, 2001; 69(6): 851 - 859. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Mohan, S. K. Chintala, J. C. Jung, W. V. L. Villar, F. McCabe, L. A. Russo, Y. Lee, B. E. McCarthy, K. R. Wollenberg, J. V. Jester, et al. Matrix Metalloproteinase Gelatinase B (MMP-9) Coordinates and Effects Epithelial Regeneration J. Biol. Chem., January 11, 2002; 277(3): 2065 - 2072. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |