| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |

From the Departments of Pharmacology*
and
Pathology,
Cardiovascular Research Institute
Maastricht, Universiteit Maastricht, Maastricht, The Netherlands
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
ß-catenin has recently received considerable attention in cancer research.8,9 Elevated levels of ß-catenin and a translocation of this protein to the cytoplasm have been associated with the development of colon carcinoma as well as a rapidly increasing number of other neoplastic diseases.4,6,10 These elevated levels of ß-catenin can be caused by mutations in the protein itself, but are more frequently the result of mutations in the adenomatous polyposis coli (APC) protein which regulates the degradation of ß-catenin.11 Mice lacking the ß-catenin gene show lethal organizational defects early during development,12 underscoring the crucial role for this protein in embryogenesis. This is further supported by studies which report a role for ß-catenin during normal development.13-15
Taken together, the above-mentioned studies clearly define a role for ß-catenin in the proliferative and migratory responses of cells during embryogenesis and in neoplastic disease. In contrast, little is known about a potential role for ß-catenin in normal, controlled cell proliferation and migration during repair processes after injury, eg, of vascular endothelial cells during neovascularization of the infarct area after myocardial infarction (MI) in adult animals.16,17 In vitro studies, however, have identified the cadherin-catenin complex as a crucial component of endothelial cell-cell junctions, which has to be dissociated and reorganized during angiogenesis.18 In several reports, a decrease of membrane-bound and a concomitant increase in cytoplasmic ß-catenin during the migration of human umbilical vein endothelial cells19,20 and epithelial cells21 has been described, underscoring the importance of the dissociation of the cadherin-catenin complex during angiogenesis.
The aim of the present study was to investigate the potential role of ß-catenin in the neovascularization which occurs in vivo during infarct healing after MI. To this end, infarcted rat hearts were obtained at different time points (2 to 21 days) after MI and the ß-catenin contents of the vascular endothelial cells around the infarct area and in the uninjured myocardium were compared. Because ß-catenin-APC interactions have been shown to be critical for epithelial tubule formation in vitro,22 we have performed immunohistochemical staining for APC as well. Moreover, ß-catenin recently has been identified as a second messenger molecule in the Wnt polarity signal transduction pathway.15,23 In this pathway, genes from the dishevelled family are known to regulate the degradation of ß-catenin by controlling its phosphorylation by glycogen synthase kinase-3ß.5 Therefore we have studied the expression of the three murine dishevelled genes24-26 in the infarcted rat heart by in situ hybridization.
| Materials and Methods |
|---|
|
|
|---|
Adult male Wistar rats (250 to 300 g; Winkelmann, Borchen, Germany) were used in this study. They were housed in groups of 3 to 4 rats with free access to food and tap water. MI was induced as described previously.27
In Situ Hybridization for Dishevelled-Homologues
The expression of the three dishevelled genes was studied by in situ hybridization. These experiments were performed on paraffin sections (4 µm) from formalin-fixed infarcted rat hearts. The in situ hybridizations were performed as described previously.28 Briefly, radiolabeled riboprobes were transcribed from polymerase chain reaction products of dvl-1, dvl-2, and dvl-3, obtained by amplification of reverse-transcribed RNA isolated from rat heart as previously described29 (primer sets: dvl-1: upper CAGGGCACTGACAGCCAC, lower CAGTAGATGCACTGTCTGGAGG; dvl-2: upper AAGAGCGTTTTGCAGCGG, lower GACACAAGCCAGGAGACAAC; dvl-3: upper CCCCTTTCTGTGCTGACAAC, lower GCTCAATCCGGGAGACCTT), and cloned into a pGEM-T cloning vector (Promega, Madison, WI). The identity and orientation of the polymerase chain reaction products were verified by sequencing. RNA transcription was performed using an RNA labeling kit (Amersham, Little Chalfond, UK) in the presence of [35S]-UTP. The sections were hybridized overnight at 55°C with the radiolabeled probes. After washing the sections, unbound probe was digested with RNase (20 µg/ml; Promega), the sections were dehydrated, dried, dipped in photographic emulsion (Kodak NTB2; Technorama, Zürich, Switzerland) and exposed for 1 to 2 weeks in the dark at 4°C. After development, the sections were briefly stained with hematoxylin.
Immunohistochemistry
Immunohistochemistry was performed according to routine
procedures. Paraffin sections were mounted on
aminopropyltriethoxysilane-coated slides. A monoclonal antibody for
ß-catenin was obtained from Transduction Labs (Lexington, KY). After
blocking the endogenous peroxidase, sections were boiled twice for 5
minutes in 10 mmol/L citrate buffer (pH 6.0) and incubated with the
primary antibody in a 1:500 dilution overnight at room temperature.
Immunohistochemistry for APC was performed using the N-15 monoclonal
antibody obtained from Santa Cruz Biotechnology (Santa Cruz, CA) in a
1:2,000 dilution and incubating for 1 hour at room temperature.
Sections were pretreated with 1 mg/ml of pepsin (Boehringer, Mannheim,
Germany). Biotinylated multilink swine-anti-goat, -mouse, and -rabbit
secondary antibody (dilution 1:100; DAKO, Glostrup, Denmark) and the
Vectastain ABC kit (Vector, Burlingame CA) were used according to the
manufacturers instructions to visualize the binding of both primary
antibodies. Sections were briefly counterstained with hematoxylin and
mounted with Entellan (Merck, Darmstad, Germany). The identity of
vascular smooth muscle cells and myofibroblasts was determined using an
antibody against
-smooth muscle actin (dilution 1:500; DAKO).
Confocal Microscopy
Confocal microscopy was performed using a Bio-Rad MRC600 confocal scanning laser microscope (Bio-Rad, Hempel Hemstead, UK) as previously described.30 Immunohistochemistry for ß-catenin was performed as described above with fluorescein isothiocyanate-labeled rat-anti-mouse (dilution 1:100; DAKO) as secondary antibody. The nuclei were counterstained using propidium iodide.
BrdU Incorporation
BrdU (Serva, Heidelberg, Germany) was continuously infused using osmotic minipumps (Alzet model 2002; Alza Corp., Palo Alto, CA) implanted subcutaneously between the shoulder blades. BrdU was dissolved in 0.9% NaCl (10 mg/ml) and infused at a rate of 240 ng/kg/min. The pumps were implanted at the time of MI induction and animals were sacrificed 4 and 7 days after MI. The cumulative labeling of BrdU in the infarct area was determined using a monoclonal antibody directed against BrdU according to previously published methods.31
| Results |
|---|
|
|
|---|
The expression of ß-catenin in the infarcted part of the left
ventricle of the rat at different time points after MI is shown in
Figure 1
. Two days after infarction, no
staining for ß-catenin was observed around the area of infarction
(Figure 1A)
. In this phase of the wound healing no neovascularization
or formation of granulation tissue has yet occurred in the infarct
area. At 4 days after MI, however, many small blood vessels have
emerged in the border zone around the area of infarction.
Interestingly, the cytoplasm of the vascular endothelial cells stained
positively for ß-catenin (Figure 1B)
. This staining was not observed
in vascular endothelial cells in the noninjured myocardium (Figure 1E)
and in vascular endothelial cells of sham-operated animals (not shown).
ß-catenin staining of vascular endothelial cells was also observed 7
days after infarction (Figure 1C)
. In contrast, the myofibroblasts
present in the granulation tissue around the area of infarction did not
show any ß-catenin staining, and vascular endothelial cells in
noninfarcted parts did not show cytoplasmic ß-catenin staining
(Figure 1F)
. At 14 (not shown), 21 (Figure 1D)
, and 90 days (not shown)
after MI, most of the vascular endothelial cells in the areas of newly
formed blood vessels around the infarct did not show ß-catenin
staining. Again, the myofibroblasts did not show any staining for
ß-catenin. The intercalated disks between the uninjured
cardiomyocytes were positive for ß-catenin (Figure 1, DF)
at all
time points as previously reported.32
|
Cytoplasmic ß-catenin staining of the vascular endothelium was
not confined to the newly formed small vessels around the infarct area,
but could also be observed in larger arteries in the injured parts of
the heart (Figure 2A)
. These arteries
most likely were already present in the area before the infarction,
because a fully developed media containing vascular smooth muscle cells
(Figure 2B)
and a layer of surviving cardiomyocytes around these
arteries was observed around them. In contrast, arteries of similar
diameter in the uninjured parts of the heart (Figure 2, D and E)
or in
sham-operated animals (not shown) did not show endothelial ß-catenin
staining.
|
Confocal Microscopy of ß-Catenin
To determine the intracellular localization of ß-catenin in more
detail, confocal microscopy was performed on sections of infarcted rat
heart 4 and 7 days after MI. As shown in Figure 3
, immunofluorescence was observed in the
cytoplasm of the vascular endothelial cells around the infarct area but
not in the nuclei, as observed with immunohistochemistry.
|
The expression of the APC protein, involved in the degradation of
ß-catenin, was studied in infarcted rat tissue after MI. Seven days
after MI, some staining for APC protein was observed in the endothelial
cells of the newly formed vessels around the infarct area (Figure 4A)
. A similar pattern of staining,
although of considerably higher intensity, was observed 21 days after
MI (Figure 4B)
, and positive vascular endothelial cells could still be
detected at 90 days after MI (not shown). Surviving cardiomyocytes
close to the area of infarction showed a diffuse staining for APC
protein (Figure 4A)
, which was not observed in cardiomyocytes in the
uninjured parts of the heart. APC staining was also observed in
vascular smooth muscle cells at all time points studied.
|
Because cytosolic ß-catenin accumulation has been associated
with cell proliferation in a number of neoplastic diseases, we
performed immunohistochemical double-staining for ß-catenin and BrdU,
a nucleotide analogue which is incorporated in the DNA during cell
proliferation. As shown in Figure 5
,
positive nuclei were observed in some, but not all of the vascular
endothelial cells that stained positive for ß-catenin. Because BrdU
incorporation was not a generalized phenomenon in ß-catenin-positive
vascular endothelial cells, this suggests that the cytoplasmic
ß-catenin in these cells is not a direct inducer of cell
proliferation.
|
| Discussion |
|---|
|
|
|---|
ß-catenin was observed in the cytoplasm of the endothelial cells of newly formed vessels around the area of infarction 4 and 7 days after MI. In contrast, vascular endothelial cells in the noninfarcted part of the heart showed no detectable ß-catenin levels in their cytoplasm. Because remodeling of existing capillaries as well as de novo generation of capillaries take place in the first week after MI,17,33,34 the time frame of the appearance of cytoplasmic ß-catenin matches with that of the neovascularization. Based on in vitro data in which the appearance of ß-catenin in the cytoplasm was observed during human umbilical vein endothelial cell migration,19,20 our observations suggest a similar translocation phenomenon in endothelial cell proliferation and migration in vivo. These observations are also in accordance with in vitro studies in which the vascular endothelium (VE)-cadherin-catenin complex was found to be essential for de novo capillary formation35 and in which vascular endothelial growth factor-induced phosphorylation of the cadherin-catenin complex was found to be essential for the loosening of endothelial cell-cell contacts, a first step in angiogenesis.36 Moreover, in a recent study by Carmeliet et al37 it was shown that the VE-cadherin/ß-catenin complex is essential for endothelial cell remodeling and maturation during gestation in mice, and that targeted disruption of the intracellular part of the VE-cadherin gene leads to abnormal vascular development, underscoring the importance of these molecules in the formation and remodeling of blood vessels. Moreover, ß-catenin translocation to the cytoplasm was observed in endothelial cells in culture during their remodeling in response to shear stress, suggesting that this is likely to be a normal phenomenon during rearrangement of endothelial cells.
An abundant presence of APC protein was observed in vascular endothelium and myocytes around the infarct area as well as in vascular smooth muscle cells. In a recent study by Pollack et al,22 a functional interaction between ß-catenin and APC has been shown to be necessary for tubule formation of Madin Darby canine kidney cells in vitro. Moreover, there is increasing evidence that APC itself is involved in the formation of stable membrane extrusions during active cell migration.38 It is tempting to speculate that the co-expression of ß-catenin and APC in the area of neovascularization around the infarct area promotes vascular endothelial cell proliferation and migration in both angiogenesis and remodeling of pre-existing vessels. On the other hand, the rise in APC protein content which coincides with the decrease in ß-catenin content of the vascular endothelial cells may suggest that the APC protein contributes to the ß-catenin degradation in these cells. The role for APC in vascular smooth muscle cells and cardiomyocytes, however, is unclear.
Recently, ß-catenin has been identified as a second messenger in the signal transduction cascade of Wnt proteins, which are involved in control of tissue polarity.15,23 In the original description of this signal transduction system in Drosophila, the dishevelled protein was shown to act directly downstream of frizzled, now recognized as the receptor for proteins from the Wnt family.39 In the mean time, three mammalian dishevelled homologues have been identified in the mouse.24-26 Using these mouse sequences, we have designed primer sets which allowed polymerase chain reaction-amplification of three fragments from rat DNA. Partial sequencing of these fragments revealed homologies of >90% with the published mouse sequences, confirming the identity of these fragments as rat homologues of mouse dishevelled 13. The three polymerase chain reaction fragments were subsequently used for in situ hybridization. In sections of infarcted rat hearts, 7 days after MI, expression of dvl-1 was detected in vascular endothelial cells of the larger vessels around the infarct area, but not in uninfarcted areas of the heart. Areas rich in newly formed capillaries around the infarct area also showed signal for dvl-1 above background levels, but because the resolution of the radioactive in situ technique is not high enough to allow precise cellular localization, the interpretation of these data is difficult. This problem is further aggravated by the high levels of dvl-1 expression in the myofibroblasts, which are abundant around the area of infarction.28,33 However, from the data obtained with the larger arteries we can conclude that a key upstream component of the Wnt-frizzled-dishevelled tissue polarity cascade is present in the vascular endothelial cells during neovascularization of the infarct area, which may suggest a role for this pathway in the control of proliferation and/or migration of these cells. This concept is supported by a recent study of Duplàa et al40 in which a relation between the level of expression of FrzA, a scavenger for Wnt proteins which is structurally related to frizzled receptors, and endothelial cell proliferation in vitro was demonstrated. Moreover, recently the presence of a Wnt/frizzled signal transduction system which, when activated, increases the cytoplasmic ß-catenin content has been described in vascular endothelial cells in primary culture,41 providing additional evidence that Wnt/frizzled activation may be involved in the ß-catenin translocation observed in the present study.
In conclusion, the present study shows the presence of cytoplasmic ß-catenin and APC protein in vascular endothelial cells during neovascularization after MI. Because ß-catenin is known to be a key regulator of both cell proliferation and migration, a role for this protein in angiogenesis and vascular remodeling can be anticipated. This is further substantiated by data from in vitro studies in which translocation of ß-catenin to the cytoplasm has been linked to angiogenesis. Moreover, the expression of dvl-1 in these cells suggests an involvement of the Wnt-dishevelled-ß-catenin polarity cascade in this process. These findings underscore that ß-catenin is not only a crucial factor during development and in neoplastic disease, but can also play a role in the vascular endothelial cell proliferation and migration during neovascularization after MI.
| Acknowledgements |
|---|
| Footnotes |
|---|
Supported by the Dutch Society for Scientific Research (NWO, Grant 902-18-287).
Accepted for publication June 13, 2000.
| References |
|---|
|
|
|---|
-catenin with vascular endothelial cadherin (VE-cadherin). J Cell Biol 1995, 129:203-217
, but not mature IL-1
, is able to regulate human endothelial cell migration in vitro. J Biol Chem 1997, 272:28202-28205This article has been cited by other articles:
![]() |
C. M.L. Beckers, J. J. Garcia-Vallejo, V. W.M. van Hinsbergh, and G. P. van Nieuw Amerongen Nuclear targeting of {beta}-catenin and p120ctn during thrombin-induced endothelial barrier dysfunction Cardiovasc Res, September 1, 2008; 79(4): 679 - 688. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Dufourcq, L. Leroux, J. Ezan, B. Descamps, J.-M. D. Lamaziere, P. Costet, C. Basoni, C. Moreau, U. Deutsch, T. Couffinhal, et al. Regulation of Endothelial Cell Cytoskeletal Reorganization by a Secreted Frizzled-Related Protein-1 and Frizzled 4- and Frizzled 7-Dependent Pathway: Role in Neovessel Formation Am. J. Pathol., January 1, 2008; 172(1): 37 - 49. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wang, J. B. Gilner, V. L. Bautch, D.-Z. Wang, B. J. Wainwright, S. L. Kirby, and C. Patterson Wnt2 Coordinates the Commitment of Mesoderm to Hematopoietic, Endothelial, and Cardiac Lineages in Embryoid Bodies J. Biol. Chem., January 5, 2007; 282(1): 782 - 791. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Couffinhal, P. Dufourcq, and C. Duplaa {beta}-Catenin Nuclear Activation: Common Pathway Between Wnt and Growth Factor Signaling in Vascular Smooth Muscle Cell Proliferation? Circ. Res., December 8, 2006; 99(12): 1287 - 1289. [Full Text] [PDF] |
||||
![]() |
T. N. H. Masckauchan and J. Kitajewski Wnt/Frizzled Signaling in the Vasculature: New Angiogenic Factors in Sight Physiology, June 1, 2006; 21(3): 181 - 188. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-i. Kim, H.-J. Cho, J.-Y. Hahn, T.-Y. Kim, K.-W. Park, B.-K. Koo, C. Soo Shin, C.-H. Kim, B.-H. Oh, M.-M. Lee, et al. {beta}-Catenin Overexpression Augments Angiogenesis and Skeletal Muscle Regeneration Through Dual Mechanism of Vascular Endothelial Growth Factor-Mediated Endothelial Cell Proliferation and Progenitor Cell Mobilization Arterioscler. Thromb. Vasc. Biol., January 1, 2006; 26(1): 91 - 98. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Mathur, S. Kaga, L. Zhan, D. K. Das, and N. Maulik Potential candidates for ischemic preconditioning-associated vascular growth pathways revealed by antibody array Am J Physiol Heart Circ Physiol, June 1, 2005; 288(6): H3006 - H3010. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Rahmani, J. T. Read, J. M. Carthy, P. C. McDonald, B. W. Wong, M. Esfandiarei, X. Si, Z. Luo, H. Luo, P. S. Rennie, et al. Regulation of the Versican Promoter by the {beta}-Catenin-T-cell Factor Complex in Vascular Smooth Muscle Cells J. Biol. Chem., April 1, 2005; 280(13): 13019 - 13028. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ezan, L. Leroux, L. Barandon, P. Dufourcq, B. Jaspard, C. Moreau, C. Allieres, D. Daret, T. Couffinhal, and C. Duplaa FrzA/sFRP-1, a secreted antagonist of the Wnt-Frizzled pathway, controls vascular cell proliferation in vitro and in vivo Cardiovasc Res, September 1, 2004; 63(4): 731 - 738. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Vincent, K. Xiao, K. M. Buckley, and A. P. Kowalczyk VE-cadherin: adhesion at arm's length Am J Physiol Cell Physiol, May 1, 2004; 286(5): C987 - C997. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Mor, F. J. Quintana, and I. R. Cohen Angiogenesis-Inflammation Cross-Talk: Vascular Endothelial Growth Factor Is Secreted by Activated T Cells and Induces Th1 Polarization J. Immunol., April 1, 2004; 172(7): 4618 - 4623. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Barandon, T. Couffinhal, J. Ezan, P. Dufourcq, P. Costet, P. Alzieu, L. Leroux, C. Moreau, D. Dare, and C. Duplaa Reduction of Infarct Size and Prevention of Cardiac Rupture in Transgenic Mice Overexpressing FrzA Circulation, November 4, 2003; 108(18): 2282 - 2289. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Dufourcq, T. Couffinhal, J. Ezan, L. Barandon, C. Moreau, D. Daret, and C. Duplaa FrzA, a Secreted Frizzled Related Protein, Induced Angiogenic Response Circulation, December 10, 2002; 106(24): 3097 - 3103. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Venkiteswaran, K. Xiao, S. Summers, C. C. Calkins, P. A. Vincent, K. Pumiglia, and A. P. Kowalczyk Regulation of endothelial barrier function and growth by VE-cadherin, plakoglobin, and beta -catenin Am J Physiol Cell Physiol, September 1, 2002; 283(3): C811 - C821. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. van Gijn, M. J.A.P. Daemen, J. F.M. Smits, and W.M. Blankesteijn The wnt-frizzled cascade in cardiovascular disease Cardiovasc Res, July 1, 2002; 55(1): 16 - 24. [Full Text] [PDF] |
||||
![]() |
J. Dixelius, M. Cross, T. Matsumoto, T. Sasaki, R. Timpl, and L. Claesson-Welsh Endostatin Regulates Endothelial Cell Adhesion and Cytoskeletal Organization Cancer Res., April 1, 2002; 62(7): 1944 - 1947. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wang, Y. Xiao, Y. Mou, Y. Zhao, W. M. Blankesteijn, and J. L. Hall A Role for the {beta}-Catenin/T-Cell Factor Signaling Cascade in Vascular Remodeling Circ. Res., February 22, 2002; 90(3): 340 - 347. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. D. Mao, P. Hoang, and P. E. DiCorleto Lithium Inhibits Cell Cycle Progression and Induces Stabilization of p53 in Bovine Aortic Endothelial Cells J. Biol. Chem., July 6, 2001; 276(28): 26180 - 26188. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wang, Y. Xiao, Y. Mou, Y. Zhao, W. M. Blankesteijn, and J. L. Hall A Role for the {beta}-Catenin/T-Cell Factor Signaling Cascade in Vascular Remodeling Circ. Res., February 22, 2002; 90(3): 340 - 347. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |