| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Department of Medical Biochemistry,*
Brain
Inflammation and Immunity Group,
and
Neuropathology Laboratory,
Department of
Pathology, University of Wales College of Medicine, Heath Park,
Cardiff, United Kingdom
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Transudation of complement proteins through a damaged blood-brain barrier can contribute to the deposition of potentially cytolytic components of the complement pathway on the surface of neurons and glial cells. In support of this, a number of reports exist implicating complement-mediated damage in the etiology of neurodegenerative disease, demyelinating disease, and ischemic stroke.9-18 Mechanisms involved in the activation of complement in neurodegeneration are complex, but in Alzheimer’s disease there is evidence for the activation of the classical pathway of complement by ß/A42 fibrils present within the amyloid plaques.19,20 Additionally, local biosynthesis of complement components by activated glial cells such as astrocytes and microglia has been reported and may also contribute to neuronal loss if complement activation is uncontrolled.21-24
One important factor influencing the vulnerability of cells to spontaneous complement activation and cell lysis is the expression of membrane-bound complement regulators such as CR1, DAF, MCP, and CD59. Others have addressed the expression of complement regulatory proteins on primary cultures of human brain cells in vitro but have concentrated on astrocytes25,26 and oligodendrocytes.27,28 It is reported that astrocytes express MCP, CD59, and low levels of DAF whereas human oligodendrocytes express only DAF.28 The capacity of rat oligodendrocytes to directly activate the complement system in vitro has long been reported29-31 and their vulnerability to complement-mediated lysis was attributed to the lack of CD59 on their membranes.32 Rat type II astrocytes were also noted to spontaneously activate the complement system but were shown to express CD59 and hence were resistant to complement-mediated lysis in vitro.32
Complement activation and expression of complement regulatory proteins on neurons has received little attention. Human neuroblastoma cell lines (IMR32, SKN-SH, differentiated NT2, and SH-SY5Y) have been reported to spontaneously activate the classical pathway of complement.33-35 The majority of these cell lines expressed low levels of CD59, lacked DAF, and were consequently lysed when cultured in the presence of human serum. The SH-SY5Y line expressed CD59 and was lysed by serum only after enzymatic removal of CD59.35 Primary cultures of human neurons have not been investigated for their ability to spontaneously activate the complement system and to control complement activation by expressing complement regulators. We have performed a systematic investigation to test whether human fetal neurons spontaneously activate the complement system. We also assessed their capacity to inhibit the complement cascade at the C3/C5 convertase stage and at the stage of MAC formation by expressing membrane-bound complement regulators. We extended our study to characterize the expression of complement regulatory proteins at the mRNA level using both reverse transcriptase-polymerase chain reaction (RT-PCR) and in situ hybridization (ISH) on human fetal brain cells.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Fresh human fetal brain tissue from 10 samples (10- to 12-week-old fetus) was received in Hanks’ buffer from the Medical Research Council Tissue Bank (Dr. Wong, Hammersmith Hospital, London, UK) and used for cell cultures following local ethical guidance (BRO TAF Health Authority, Ref 98/2773). The brain tissue was chopped into 1-cm3 pieces, washed twice in fresh Hanks’ buffer (Sigma, Poole, Dorset, UK), and pelleted by centrifugation at 1,000 rpm. The tissue was digested in 0.05% trypsin (Sigma) in Hanks’ buffer at 37°C for 15 minutes with constant agitation and the mixture was treated with DNase I (0.2 µg/ml final; Sigma) for 1 minute. Cells were thoroughly dissociated using a 3-ml plastic Pasteur pipette and finally resuspended in complete medium that consisted of Dulbecco’s modified Eagle’s medium (Gibco Life Technologies, Paisley, UK) supplemented with heat inactivated 10% fetal calf serum, 4 mmol/L glutamine, 2.5 µg/ml fungizone, 2 mmol/L sodium pyruvate, 100 IU/ml penicillin, and 100 IU/ml streptomycin. The cells were filtered through a 70-µm nylon cell strainer (Becton-Dickinson, Cowley, Oxford, UK) and pelleted by centrifugation at 1,500 rpm for 20 minutes. The cell pellet was resuspended in fresh complete medium further supplemented with 2.5 mmol/L KCl to encourage neuronal cell growth.36 Cells were seeded at 107cells/10 ml in 25-cm2 culture flasks coated with 10 µg/ml poly-L-lysine (Sigma). Primary mixed cell cultures were also seeded on coverslips. Coverslips were first coated with a 2% solution of 3-aminopropyltriethoxysilane (Sigma) in acetone for 5 minutes followed by poly-L-lysine as for flasks. Coverslips were individually placed into 12-well plates. Cells in complete medium (200 µl, 106cells/ml) were transferred onto each coverslip and incubated in 95% air/5% CO2 in a humidified incubator at 37°C.
Source of Antibodies
The sources of polyclonal antibodies were: rabbit anti-C1q
(OTNT05) from Behring Diagnostics (Hamburg, Germany); rabbit anti-C4
from Sigma; rabbit anti-C3c obtained as a gift from Dr. M. Fontaine
(INSERM U519, Rouen, France); and rabbit anti-factor B from Serotec
(Oxford, UK). The mouse monoclonal antibodies (mAb) against complement
were: anti-iC3b neoepitope from Quidel (San Diego, CA); clone C3/30
anti-C3b, a gift from Dr. P. W. Taylor (Ciba-Geigy Ltd., Horsham,
UK); and mAb clone B7, anti-C9 neoepitope (raised in-house). The mouse
anti-C1q (clone 12A5B7) hybridoma was purchased from the American Type
Culture Collection (Rockville, MD). Rabbit anti-glial fibrillary
acidic protein (GFAP, code B5) and mouse mAb anti-GFAP (clone
MCAB5.2E4) were from Dr. J. Newcombe (Mutiple Sclerosis Society
Laboratory, London, UK). Rabbit antisera against CR1, DAF, and MCP were
all raised in-house using highly purified or recombinant proteins as
immunogens. The specificity of all antibodies against complement
components and complement regulators was further tested by Western blot
analysis using either human serum or cell lines such as HeLa, THP1,
K562, CB193, and IMR32.37
Mouse mAb anti-MCP (clone GB24)
was from Professor J. P. Atkinson (Washington University School of
Medicine, St. Louis, MO). Mouse mAb OX23 anti-human complement factor H
was from Dr. R. B. Sim (Medical Research Council Unit, Oxford,
UK). Mouse mAb anti-neuron-specific enolase (NSE) clone BBS/NC/VI-H14
was from DAKO Ltd., (Milton Keynes, UK). Mouse mAb anti-NCAM (CD56)
clone MY31 was from Becton-Dickinson. Mouse mAbs anti-CD44 (clone BRIC
222), anti-DAF (CD55) (BRIC 216), and anti-CD59 (BRIC 229) were all
purchased from the International Blood Group Reference Laboratory
(Oxford, UK). Rabbit anti-kappa (
) and rabbit anti-lambda (
)
antisera were purchased from ICN Pharmaceuticals Ltd. (Oxford, UK).
Identification of Cells in Primary Human Fetal Brain Culture
Measurement of Complement-Mediated Lysis of Neurons in Human Fetal Brain Primary Cell Cultures using Calcein and Propidium Iodide (PI)
Mixed human fetal brain cells were cultured on glass coverslips in a 12-well plate. Neurons were easily identified as small rounded cells co-culturing in the presence of astrocytes (large flat cells) and their identity was confirmed by immunocytochemistry using specific cell markers (anti-NSE and anti-GFAP) as described previously.38,39 Cells were loaded for 1 hour at 37°C with the green fluorescent dye calcein.AM (Molecular Probes, Eugene, OR) diluted in complete medium to 2 µg/ml final concentration. Inside the cell, calcein.AM is de-esterified to a polar fluorescent product which is retained within intact cells and released only after membrane damage (cell killing). Cells were washed three times in 0.9% sterile saline (tissue culture grade) and incubated in veronal buffer (VBS; Oxoid Ltd., Basingstoke, UK) containing 1% bovine serum albumin (BSA) and PI at 10 µg/ml final concentration for 30 minutes or 1 hour at 37°C containing the following: 1) normal human serum (NHS) diluted (1/4 or 1/8); 2) heat-inactivated NHS (inactivation at 56°C for 30 minutes) at the same dilutions; 3) NHS diluted 1/8 in VBS/BSA to which was added the noncomplement-fixing but neutralizing antibody against CD59 (mouse IgG2b isotype, clone BRIC229) at 13 µg/ml; 4) VBS/BSA containing mouse anti-CD59 antibody (clone BRIC229) at 13 µg/ml; and 5) NHS diluted 1/8 in VBS/BSA containing mouse anti-CD59 antibody (clone BRIC229) at 13 µg/ml and soluble complement receptor 1 (sCR1; T cell Sciences, Needham, UK) at 10 µg/ml final concentration.
The coverslips were inverted onto prelabeled glass microscope slides
and the cells examined under a fluorescent microscope (Leica UK Ltd.,
Milton Keynes, UK) using the fluorescein isothiocyanate filter for the
calcein signal and the rhodamine filter for the PI signal. Lysed cells
were PI-positive (depicted as white spherical cells) and
calcein-negative (because of leakage of the green fluorochrome). Viable
cells were green fluorescent (visualized as gray cells) because of
calcein retention and PI-negative and are illustrated in Figure 2A
.
|
Mixed human fetal brain cells cultured on coverslips were
incubated for 30 minutes at 37°C with NHS diluted 1/16 in VBS/1%BSA
or with NHS deficient in IgA, IgM, and IgG (Sigma) diluted 1/8.
Controls included heat-inactivated NHS and NHS containing 10 mmol/L
ethylenediaminetetraacetic acid (EDTA). The cells were thoroughly
washed five times in phosphate-buffered saline (PBS), pH 7.3, and fixed
in acetone for 5 minutes at room temperature followed by further washes
(5 times) in PBS. All coverslips were immersed for 30 minutes in
PBS/BSA to block the nonspecific-antibody binding. The coverslips were
incubated in 100 µl of the appropriate dilution of primary antibody
(anti- and anti- light chains, anti-complement, or
anti-complement regulatory protein) at 4°C overnight in a humidity
chamber. The cells on coverslips were thoroughly washed (10 times) in
PBS and incubated for 1 hour at room temperature in the specific
secondary peroxidase conjugate (Bio-Rad, Hemel Hempstead, UK) diluted
1/100 in PBS/BSA. Cells were washed 10 times in PBS after which they
were developed for 5 minutes in a freshly-made solution of 0.05%
diaminobenzidine (DAB) and 0.005% (v/v) hydrogen peroxide
diluted in PBS. After a brief wash in PBS, the cells were washed
thoroughly in water before and after counterstaining in hematoxylin.
After either a full dehydration in ethanol or air-drying (37°C oven),
the cells were cleared in xylene and the coverslips were mounted on
glass slides.
The level of immunostaining on fetal brain cells using anti-complement antibodies was assessed by semiquantitative image analysis (Openlab/Improvision, Coventry, UK). The salient instrumentation of the system included a color digital camera mounted on a light microscope and connected to a computer based image analysis system. Briefly, the method involved recording a series of images of the areas of interest (neurons and astrocytes) in the sample and measuring the amount of DAB (brown) staining of gated cells from 10 random but representative fields in each sample. The data were sorted and expressed as a mean ±SEM of the measurements (staining index).
For double-immunocytochemistry, antibodies to GFAP and anti-complement regulatory protein derived from different species were simultaneously applied to cells on coverslips. The secondary conjugates specific for each of the primary antibodies were peroxidase-conjugated goat anti-mouse/rabbit immunoglobulins diluted 1/100 (Bio-Rad) and alkaline phosphatase conjugated goat anti-mouse/rabbit immunoglobulins diluted 1/500 (Sigma). The substrates were: 0.05% DAB/0.005% hydrogen peroxide diluted in PBS and nitro blue tetrazolium (NBT)/5-bromo-4-chloro-3-indolyl phosphate (BCIP). NBT stock solution was at 75 mg/ml dissolved in 70% N-N-dimethyl formamide and BCIP stock solution was at 50 mg/ml dissolved in N-N-dimethyl formamide. A fresh solution of alkaline phosphatase substrate was prepared by adding 4.5 µl of stock NBT and 3.5 µl BCIP per 1 ml of detection buffer (0.1 mol/L Tris-HCl, 0.1 mol/L NaCl, 50 mmol/L MgCl2, pH 9.5) to which 0.3% levamisole (Sigma) was added. The co-localization of the brown (DAB) and blue (NBT/BCIP) product was identified on the cells. Representative bright-field images were photographed using a Leica DMLB microscope (Leica UK Ltd.).
Flow Cytometric Analysis of Human Fetal Brain Primary Cell Cultures
The detection of membrane-bound complement regulators (CR1, DAF, MCP, CD59) and cell markers (CD44, CD56) on mixed human fetal brain cells was assessed by flow cytometry. All steps were performed on ice. Cultured adherent fetal brain cells were washed three times in sterile NaCl (0.9%) and harvested using 10 mmol/L EDTA in PBS/BSA. The cells (105 cells/tube) were incubated in primary antibody at the appropriate dilution in PBS/BSA for 1 hour, washed three times in PBS/BSA by centrifugation (1,000 rpm for 3 minutes) before incubation for 1 hour with the secondary red phycoerythrin-conjugated antibody (DAKO, High Wycombe, Bucks, UK) diluted in PBS/BSA. The cells were washed three times in PBS/BSA as before and analyzed on a flow cytometer (Becton-Dickinson). Two distinct populations present in the mixed human fetal brain were identified from the cell scatter (FSC/SSC plot). The small cells (38 to 40% of the total cell population) were CD56high, CD44dim, and GFAPnegative and were identified as human fetal neurons. The large cells were CD56high, CD44high, and GFAPhigh and represented the fetal astrocyte population as already described.40,41
RT-PCR to Detect the mRNA for Complement Regulators
Total RNA was isolated from four different samples of human fetal brain primary cell cultures using the Ultraspec RNA isolating reagent according to the manufacturer’s instructions (Biotecx Labs., Houston, TX). Reverse transcription (RT) was performed at 37°C for 2 hours using 3 µg of total RNA in the presence of 50 mmol/L Tris-HCl, 75 mmol/L KCl, 3 mmol/L MgCl2, 5 µmol/L dithiothreitol, 60 U rRNasin, and 2 mmol/L dNTPs and MMLV in a total volume of 30 µl. A 3-µl aliquot of RT reaction was used for polymerase chain reaction (PCR) using specific oligonucleotide pairs (see below) for each of the complement regulators. Their gene target, primer sequence, and the predicted size of each cDNA product are: MCP (GCTACCTGTCTCAGATGACG) (ACCACTTTACACTCTGGAGC) 419 bp; CR1 (TGGCATGGTGCATGTGATCA) (TCAGGGCCTGGCACTTCACA) 514 bp; DAF (GCAACACGGAGTACACCTGT) (GCTAAGAATGTGATTCCAGG) 360 bp; clusterin (GTCTCAGACAATGAGCTCCA) (TGCGGTCACCATTCATCCAG) 419 bp; CD59 (ATTTCAACGACGTCACAACC) (GACTGGTCTTCAAAGTCTCC) 369 bp; glyceraldehyde phosphate dehydrogenase (GAPDH) (GAACGGGAAGCTTGTCATCA) (TGACCTTGCCCACAGCCTTG) 473 bp.
PCR amplifications were performed in an Omnigene thermocycler (Hybaid, Teddington, UK) using the following conditions: denaturation at 94°C for 4 minutes, five cycles (94°C for 30 seconds, annealing 60°C for 1 minute, 72°C extension for 2 minutes), 20 cycles (94°C for 30 seconds, annealing 60°C for 30 seconds, 72°C extension for 45 seconds), and a final extension at 72°C for 15 minutes. All samples were subjected to RT-PCR for housekeeping gene GAPDH as a positive control and as an internal standard.
RT-PCR products were resolved on 1.2% agarose gels in 1x Tris-borate-EDTA (TBE) buffer. Comparative DNA ladder markers (123 bp and 1 kb from Life Technologies Ltd.) were loaded to identify the correct size of the different cDNA fragments. Gels were visualized by ethidium bromide and photographed (using a gel 1,000 UV documentation system, Bio-Rad). The identity of each of the cDNA fragments was confirmed by sequencing using the Big DYE sequencing kit (Perkin Elmer, Buckinghamshire, UK) and analysis on the ABI 377 automated sequencer (Perkin Elmer).
ISH to Identify the Differential Expression of Complement Regulators by Human Fetal Brain Cells
Plasmid containing the full-length human MCP cDNA clone was used with appropriate primer pairs (see above) to generate a specific riboprobe of 419 bp for use in ISH on mixed fetal brain cultures. The PCR product corresponded to bases +301 to +720 in the MCP coding region39,42 (accession number Y00651) and was cloned into pGEM-T (Promega, Southampton, UK) with flanking SP6/T7 RNA polymerase sites. The human CD59 riboprobe was a 518-bp PCR product containing the region -37 to +481 (accession number M95708) cloned into pGEM-3Z (Promega).43 A 473-bp PCR fragment of GAPDH cDNA coding region +249 to +702 (accession number M33197) was also cloned into pGEM-T. In all cases, the identity and orientation of the cloned fragments were confirmed by sequencing with T7 and SP6 primers.
The digoxigenin-UTP labeling kit was purchased from Boehringer Mannheim (SP6/T7; Lewes, East Sussex, UK). Both sense and antisense riboprobes were generated by in vitro transcription of the linearized plasmid (1 µg) using either SP6 or T7 RNA polymerase. The level of digoxigenin incorporation was assessed according to the manufacturer’s instructions.
Primary mixed human fetal brain cultures growing on glass coverslips were washed gently in PBS and permeabilized with 5 µg/ml proteinase K in Tris/EDTA buffer (100 mmol/L Tris/50 mmol/L EDTA, pH 8.0) for 40 minutes at 37°C. Enzymatic digestion was terminated by immersing the coverslips in freshly prepared 4% paraformaldehyde, pH 7.5, for 10 minutes. Two further washes (10 minutes each) were performed in DEPC-treated PBS. The cells were allowed to dry at 37°C for 1 hour.
Coverslips were coated in the hybridization solution (100 µl per coverslip) which consisted of the digoxigenin-UTP labeled riboprobe (20 ng/ µl) in 50% formamide, 4x standard saline citrate, 1x Denhardt’s solution, 10% dextran sulfate, 0.05 mg/ml denatured salmon sperm DNA, 1% N-lauroylsarcosine, 0.02 mol/L Na2PO4 (pH 7.0), and 50 mmol/L dithiothreitol. The incubation was performed overnight at 50°C. Coverslips were washed (10 x 1 minute) at 37°C using prewarmed 1x standard saline citrate. Further washes 2 x 10 minutes in buffer C (100 mmol/L Tris, pH 7.5, 150 mmol/L NaCl, 0.2% Tween 20) were performed before incubation overnight at 4°C in buffer C containing 1.5% BSA.
The coverslips were incubated at 4°C with sheep anti-digoxigenin Fab fragments conjugated to alkaline phosphatase (Boehringer Mannheim) diluted 1/5,000 in antibody diluting buffer (100 mmol/L Tris, pH 7.5, 850 mmol/L NaCl, 0.2% Tween 20). The coverslips were washed 10 x 1 minute each in fresh buffer C followed by a brief wash in detection buffer. The alkaline phosphatase substrate diluted in detection buffer (NBT/BCIP; see immunocytochemistry above) containing 0.3% of levamisole was applied to coverslips at room temperature. The color development was allowed to take place in the dark for 6 to 10 hours. The reaction was monitored periodically by light microscopy. Development was stopped by thoroughly washing cells in distilled water. The cells were allowed to dry at 37°C for 1 hour, then cleared in xylene, and mounted in a neutral mounting medium before detailed examination under the light microscope.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Primary fetal brain cultures contained predominantly two types of
cells. The numerous small cells were neurons immunopositive with
anti-NSE. These cells were closely associated with large, flat cells
which unequivocally stained for GFAP indicating that they were
astrocytes.38,39
Complement components and activation
products of the classical pathway (C1q, C4, C3b, iC3b, C3c) were
detected specifically on fetal brain cells after incubation for 30
minutes at 37°C in NHS. The distribution of the complement
immunostaining on neurons and astrocytes is illustrated in Figure 1A
; the level of staining
was quantified on gated cells and is presented in Figure 1B
. Anti-C1q
staining was detected on neurons (Figure 1A
; b, short arrow) but not on
astrocytes (Figure 1A
; b, long arrow). Anti-C4 stained neurons
intensely (Figure 1A
; d, short arrows) with either little or no
staining of astrocytes (Figure 1A
; b, long arrows). Monoclonal
antibodies to C3 activation products, iC3b (Figure 1A
; f, short arrow)
and C3b (Figure 1A
; h, short arrow) bound strongly to neuronal
membranes. The presence of the MAC on neurons (Figure 1A
; j, short
arrow) was detected with a C9 neoepitope-specific monoclonal
antibody (clone B7). Astrocytes were free of immunostaining for MAC
using the same antibody (Figure 1A
; j, long arrow). After complement
activation, image analysis using the Openlab/Improvision software
allowed the semiquantitation of the intensity of immunostaining both on
neurons and astrocytes using the same samples as those shown in Figure 1A
. The level of staining with each antibody was high on neurons and
weak or absent on astrocytes (Figure 1B)
.
|
: a, c, e, g, and i) or
with NHS containing 10 mmol/L EDTA (data not shown). Rabbit anti-human
light-chain immunoglobulins weakly stained human fetal neurons
whereas astrocytes were negative (data not shown). To test whether
neurons activate spontaneously the complement system in an
antibody-independent manner, cultured cells were incubated with NHS
deficient in IgA, IgM, and IgG and then stained for complement
opsonization. No binding of immunoglobulins ( and ) was detected
on neurons and astrocytes (data not shown). However, a strong staining
for C1q, C4, C3, and C9 was detected on neurons but not on astrocytes
(data not shown). Human Fetal Neurons but Not Astrocytes Are Lysed after Spontaneous Complement Activation
Mixed human fetal brain cells loaded with calcein were
incubated for 30 minutes at 37°C with VBS/BSA/PI alone or with NHS
(Figure 2A)
. The level of
complement-mediated lysis was examined by identifying and counting the
number of calcein-negative cells represented as white spherical cells
from eight randomly selected microscope fields of view (Figure 2A)
.
Lysed calcein-negative neurons were infrequent (Figure 2A
; a) in
control cultures (treated with heat-inactivated serum diluted 1/8 or
with VBS/BSA) and astrocytes were not lysed (Figure 2A
; a, long arrow).
Few neurons were lysed (white spherical cells) in the first 30 minutes
after treatment with NHS diluted 1/8 whereas almost all neurons were
lysed after 1 hour to 2 hours after incubation with NHS diluted 1/8.
Moreover, almost all neurons were lysed after complement activation
using NHS (diluted 1/8, 30 minutes after incubation) to which a
noncomplement-fixing, but neutralizing, mouse anti-CD59 (BRIC229) was
added (Figure 2A
; b). Astrocytes (large gray cells) remained viable
after the same treatment. Lysis of neurons (number of white
spherical cells) was significantly reduced (Figure 2A, c
; and B) on the
addition of sCR1 (10 µg/ml) to the cultures incubated with NHS (1/8)
containing the anti-CD59 antibody.
Semiquantitative estimation of complement-mediated lysis of human fetal
neurons was also performed. The numbers of PI-positive cells (white
spherical cells) were counted from eight random microscope fields of
view (on photographs) and the mean and SD for lysis was calculated for
each treatment (Figure 2B)
. The control containing VBS/BSA and
anti-CD59 showed minimal lysis. Marked increase in neuronal cell lysis
was observed on exposing the mixed central nervous system (CNS) cells
for 30 minutes to NHS (diluted 1/8) containing the anti-CD59
neutralizing antibody. The cells treated with NHS diluted 1/8
containing anti-CD59 antibody and sCR1 showed a significant reduction
in the overall numbers of lysed neurons.
Double-Immunostaining to Analyze the Expression of Complement Regulatory Proteins by Human Fetal Neurons and Astrocytes in Culture
DAB immunoperoxidase staining (anti-GFAP, brown
staining) together with BCIP/NBT immunoalkaline phosphatase staining
(anti-CD56 or anti-complement regulatory proteins, blue staining) were
performed to analyze the expression of complement regulators by human
fetal brain cells. The results are shown in Figure 3
. Human fetal neurons and astrocytes
were negative for OX23 (an irrelevant mAb to factor H) (Figure 3a
,
short arrowhead). Neurons were positive for CD56 as
indicated by the blue staining of the plasma membrane (Figure 3b
, short
arrowhead). Neurons were negative for CR1 (Figure 3c
, arrowhead) and
DAF (Figure 3d
, arrowhead) as indicated by the absence of blue
staining, and MCP immunostaining was very weak (Figure 3e
, arrowhead).
Faint blue immunostaining with mouse anti-CD59 was consistently
observed on neurons (Figure 3f
, short arrow).
|
. No blue
staining of astrocytes was detected with OX23 (Figure 3a
, long arrow).
Blue staining of astrocytes with a mAb to CD56 was consistently
observed (Figure 3b
, long arrow). No staining was detected on
astrocytes using the rabbit anti-CR1 (Figure 3c
, long arrow). Strong
staining was observed with the rabbit anti-DAF (Figure 3d
, long arrow).
The co-localization of the brown (DAB) staining from anti-GFAP and the
blue (NBT/BCIP) product from anti-DAF resulted in a dark brown staining
of the astrocytes (Figure 3d
, long arrow). Strong immunostaining with
anti-MCP was detected on astrocytes (Figure 3e
, long arrow) whereas a
more delicate membrane staining of astrocytes with anti-CD59 was
observed (Figure 3f
, long arrow). Flow Cytometric Analysis to Confirm the Differential Expression of Complement Regulatory Proteins on Mixed Human Fetal Brain Cultures
Mixed fetal brain cultures were stained for complement regulators
by indirect immunofluorescence and the level of staining was assessed
by flow cytometry (Figure 4)
. The mean
level of fluorescence (FL2 channel) of the small-size population
(neurons; confirmed by NSE staining) and the large-size cell population
(astrocytes; confirmed by GFAP staining) depicted from the cell scatter
plot (forward scatter versus side scatter) was used to
assess the relative abundance of each complement regulator on the cell
membranes of each cell type. The results are presented in Figure 4
and
the mean level of the fluorescence intensity (FL2) for each immunostain
is given in brackets. CD56 and CD44 immunostaining were included as
positive controls. Neurons expressed higher levels of CD56 (FL2: 393)
and low levels of CD44 (FL2: 59) (Figure 4, 1a)
. Astrocytes expressed
high levels of CD56 (FL2: 1723) and CD44 (FL2: 3102) (Figure 4, 1b)
.
CR1 was not detected either on neurons (Figure 4, 2a)
or on astrocytes
(Figure 4, 2b)
, whereas DAF was absent on neurons but expressed by
astrocytes (FL2: 38), albeit at a low level (Figure 4
; 3, a and b). MCP
was weakly expressed by neurons (FL2: 22) and astrocytes (FL2: 120)
(Figure 4
; 4, a and b). All cells expressed CD59; the staining was weak
on neurons (FL2: 420) and strong on astrocytes (FL2: 3534) (Figure 4
;
5, a and b).
|
RT-PCR results from human fetal brain mixed cultures demonstrated
an abundant expression of MCP and CD59 mRNAs, whereas DAF mRNA was
weakly expressed (Figure 5)
. In contrast,
we consistently found no CR1 mRNA expression in any of four samples of
human fetal brain cultures (Figure 5)
. RT-PCR of GAPDH mRNA and
clusterin, a fluid phase complement regulator known to be expressed in
brain,44-46
were used as internal positive controls
(Figure 5)
.
|
ISH for MCP and CD59 was performed using digoxigenin-UTP-labeled
riboprobes on human mixed fetal brain primary cultures. The MCP and
CD59 sense riboprobes were consistently negative (Figure 6, a and c)
but the antisense riboprobes
for MCP and CD59 were positive. The ISH signal from the antisense MCP
probe was weak in neurons (Figure 6b
, short arrow) and stronger in
astrocytes (Figure 6b
, long arrows). In contrast, CD59 antisense
riboprobe localized strongly to neurons (Figure 6d
, short arrows) and
to astrocytes (Figure 6, d and e
, long arrows). The GAPDH antisense
probe was positive for neurons and astrocytes with the same intensity
of staining on both cell types (not shown).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Nucleated cells such as endothelial cells, epithelial cells, and even hepatocytes (the major cellular source of complement) are consistently exposed to complement which can be spontaneously activated on their membrane by the tick-over mechanism.53-55 Although activation of complement on the cells could lead to lysis, it is now well known that the majority of nucleated cells control complement activation and complement-mediated lysis by expressing specific complement regulators. Published studies have documented complement activation and regulator expression by diverse cell lines of apparent neuronal origin, the majority of which are susceptible to complement killing.33-35 In one neuronal cell line, a crucial role for CD59 in protecting from complement killing has been described.35,56 Despite these data, little is known about the capacity of human primary neurons in vitro to control complement activation by expressing complement regulators.
We undertook a systematic investigation in vitro to test whether human neurons cultured from fetal brain could spontaneously activate the complement system, and to assess the capacity of neurons to express the complement regulators CR1, MCP, DAF, and CD59. We found that fetal neurons but not astrocytes were opsonized and lysed by complement via activation of the classical pathway when cultured in the presence of NHS. Importantly, serum devoid of immunoglobulins opsonized the cells to a similar degree, effectively eliminating an important role of antibody in the observed activation. No complement opsonization was detected when the cells were incubated with heat inactivated NHS or NHS containing EDTA. No factor B staining was detected on the neurons treated with NHS or immunoglobulin-deficient NHS, indicating that the alternative pathway was not involved in the activation process. The data suggest that neurons express a molecule that can specifically bind C1q and initiate classical pathway activation. The identity of the neuronal C1q receptor remains to be characterized. It has been hypothesized that in disease conditions, C1q could bind to molecules such as DNA, mitochondrial membranes, myelin, and amyloid released in the vicinity of the neurons.19,20,57,58 However, it is unlikely that these molecules released from damaged cells are the factors involved in the spontaneous activation of complement on cultured fetal neurons. Of note, adjacent astrocytes were not opsonized to a significant degree, indicating that the activation was occurring specifically on the membranes of fetal neurons.
It is clear that human fetal neurons were not able to control complement activation because we observed that human fetal neurons were lysed in the presence of NHS on neutralization of CD59 activity. Astrocytes were not lysed by complement when exposed to the same conditions. Human fetal neurons were unable to prevent complement activation because they expressed low levels of MCP and lacked DAF and CR1; this has been confirmed by a number of techniques in this investigation. Characterization of the expression of membrane-bound complement regulators by human fetal brain primary cultures at the mRNA level using RT-PCR showed a complete absence of CR1, confirming the negative staining of cells at the protein level both by immunocytochemistry and fluorescence-activated cell sorting analysis. MCP is reported to be predominantly a regulator of the alternative pathway.59-61 Absence of DAF and poor classical pathway regulation by MCP on neurons would facilitate effective C3b and C5b-9 deposition. Astrocytes were found to express MCP, DAF, and CD59 at higher levels than neurons and hence were not lysed even though they lacked CR1. Soluble CR1 inhibited lysis of human fetal neurons confirming that complement was responsible for lysis. As CR1 is a regulator of the C3/C5 convertases and has been shown to be a potent inhibitor of complement-mediated lysis in CNS disorders,62,63 it represents a potentially valuable neuroprotective agent.
This in vitro study demonstrates that neurons are extremely susceptible to complement activation and complement-mediated lysis, although the mechanism responsible for neuronal complement activation is not clear. It will be important in future studies to identify the receptor expressed specifically by neurons and not by astrocytes that is able to bind C1q and trigger complement activation. This could be addressed by performing crosslinking experiments using I125-labeled C1q. We have previously shown that two human neuroblastoma cell lines (IMR32 and SKNSH) expressing low levels of MCP and CD59 and lacking DAF and CR1 activated the classical pathway and were lysed in the presence of NHS.33 The results obtained using the primary neuron cultures corroborate the data from these neuroblastoma cell lines, suggesting that they could be used to identify the putative neuronal C1q receptor involved in the complement activation process. It has been reported that oligodendrocytes are also susceptible to complement-mediated lysis because they not only activate spontaneously the classical pathway of complement but also express low levels of regulators.28,32 Adult human oligodendrocytes in culture were found to express low levels of DAF and CD59 and were lacking CR1 and MCP.28 Together, these data suggest that there is a deficit in regulation of the classical pathway of complement activation at the C3/C5 convertase stage by both neurons and oligodendrocytes. A recent in vitro study64 has demonstrated that a human neural crest-derived cell line (Paju) expressed increased levels of DAF after PMA (phorbol ester) treatment. It remains important to assess in future studies whether neurons exposed to proinflammatory stimuli (cytokines) or even after sublethal complement attack can be induced to express increased levels of complement regulators to protect themselves from further complement attack.
We have recently shown that neurons in vivo also lack DAF and CR1,65 providing a direct correlation of the expression of complement regulators between our in vitro culture model and adult neurons in vivo. Manipulation of the endogenous levels of regulatory proteins on these cells would be of potential importance in the development of therapy to block the resulting pathology after local complement activation. It has been shown that sCR1 is a potential therapeutic agent in experimental animal models to prevent demyelination and in stroke.62,63 It will be informative to expand this study to use sCR1 and other complement regulators such as DAF in animal models of neurodegeneration.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Supported by the Medical Research Council (P. G. and S. K. S.), the Wellcome Trust (B. P. M.), and the Wales Office of Research and Development for Health and Social Care (S. K. S., N. K. R., P. G., and J. W. N.).
Accepted for publication June 6, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  M. R. Griffiths, J. W. Neal, M. Fontaine, T. Das, and P. Gasque Complement Factor H, a Marker of Self Protects against Experimental Autoimmune Encephalomyelitis J. Immunol., April 1, 2009; 182(7): 4368 - 4377. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. D. Galvan, S. Luchetti, A. M. Burgos, H. X. Nguyen, M. J. Hooshmand, F. P. T. Hamers, and A. J. Anderson Deficiency in Complement C1q Improves Histological and Functional Locomotor Outcome after Spinal Cord Injury J. Neurosci., December 17, 2008; 28(51): 13876 - 13888. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J Mocco, W. J. Mack, A. F. Ducruet, S. A. Sosunov, M. E. Sughrue, B. G. Hassid, M. N. Nair, I. Laufer, R. J. Komotar, M. Claire, et al. Complement Component C3 Mediates Inflammatory Injury Following Focal Cerebral Ischemia Circ. Res., July 21, 2006; 99(2): 209 - 217. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. S. Ten, S. A. Sosunov, S. P. Mazer, R. I. Stark, C. Caspersen, M. E. Sughrue, M. Botto, E. S. Connolly Jr, and D. J. Pinsky C1q-Deficiency Is Neuroprotective Against Hypoxic-Ischemic Brain Injury in Neonatal Mice Stroke, October 1, 2005; 36(10): 2244 - 2250. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. van Beek, M. van Meurs, B. A. 't Hart, H. P. M. Brok, J. W. Neal, A. Chatagner, C. L. Harris, N. Omidvar, B. P. Morgan, J. D. Laman, et al. Decay-Accelerating Factor (CD55) Is Expressed by Neurons in Response to Chronic but Not Acute Autoimmune Central Nervous System Inflammation Associated with Complement Activation J. Immunol., February 15, 2005; 174(4): 2353 - 2365. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K A Gelderman, H J M A A Zijlmans, M J Vonk, and A Gorter CD55 expression patterns on intestinal neuronal tissue are divergent from the brain Gut, April 1, 2004; 53(4): 507 - 513. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. J. Mead, S. K. Singhrao, J. W. Neal, H. Lassmann, and B. P. Morgan The Membrane Attack Complex of Complement Causes Severe Demyelination Associated with Acute Axonal Injury J. Immunol., January 1, 2002; 168(1): 458 - 465. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
