| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Division of Neurosurgery,*
Arthur and Sonia
Labatt Brain Tumor Research Laboratory, Toronto; the Divisions of
Clinical Genetics
and
Pathology,
The Hospital for Sick Children,
Toronto; and the Department of Laboratory Medicine and
Pathobiology,§
The University of Toronto,
Toronto, Ontario, Canada
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
75% of cells were positive at 1 week
after induction. Induction of p57 in U373 astrocytoma cells generated a
small population of cells (15%) that were nonviable,
contained discrete nuclear fragments on Hoechst 33258 staining,
and demonstrated ultrastructural features characteristic of apoptosis.
Examination of bax and poly-(ADP ribose) polymerase levels showed no
change in bax, but decreased expression of poly-(ADP ribose)
polymerase after p57 induction in all astrocytoma cell lines. These
data demonstrate that the proliferative block imposed by p57 on human
astrocytoma cells results in changes in the expression of a number of
cell cycle regulatory factors, cell morphology, and a
strong stimulus to cell senescence.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
65% of all primary brain tumors. The
malignant astrocytoma has a very poor prognosis primarily because of
its highly proliferative and invasive nature. As with other neoplasms
with increased proliferative potential, malignant astrocytomas
demonstrate dysregulation of various components of the cell cycle
machinery. Altered expression of positive growth regulators such as
growth factors, cyclins, and cyclin-dependent kinases (CDKs), or the
loss of negative regulators, including cyclin-dependent kinase
inhibitors (CKIs) and the retinoblastoma protein (pRB) have all been
demonstrated in malignant astrocytomas.1,2
The CDKs
phosphorylate pRB to release cells from cell-cycle arrest. In contrast
with CDKs, the CKIs inhibit cyclin-CDK complexes and transduce internal
or external growth suppressive signals. Accordingly, all CKIs may be
construed as candidate tumor suppressor genes. The CKIs are divided into two families, the INK4 and the CIP/KIP, which are defined on the basis of their structural homology and mechanism of action. The CIP/KIP family includes three structurally related members, p21CIP1/WAF1,3,4 p27KIP1, 5,6 and a recently isolated and cloned third member, p57KIP2 (p57).7-10 These three CKIs share a common N-terminal domain for binding to and inhibiting the kinase activity of CDK-cyclin complexes. Mouse p57 consists of four structurally distinct domains, a CDK inhibitory domain, a proline-rich domain, an acidic-repeat domain, and a carboxy-terminal domain. Human p57 differs from that of mouse by virtue of sequences containing proline-alanine repeats in its internal domain. The human p57 gene is located in 11p15.5, which frequently undergoes maternal allele loss of heterozygosity in several cancers, including Wilms’ tumor, and tumors associated with Beckwith-Wiedemann syndrome.10-16
p57 has been shown to be a potent inhibitor of several G1 cyclin/CDK complexes, and its overexpression leads to cell-cycle arrest in G1 phase.10 Recently, Watanabe et al17 showed that human p57 protein, like p21, contains proliferating cell nuclear antigen-binding domain within its C terminus that, when separated from its N-terminal CDK-cyclin binding domain, can prevent DNA replication. Hashimoto et al18 showed that the 310 helix region of p57, but not of p21 or p27, was indispensable for the inhibition of cyclin A/CDK2 and cyclin E/CDK2 complexes. Thus, the 310 helix motif may confer a specific regulatory mechanism by which p57 differentially regulates CDK2 and CDK4 activities. p57 mRNA is expressed at high levels in embryonic tissues such as skeletal muscle, heart, lung, and brain. Interestingly, cells expressing p57 have been shown to be terminally differentiated.10 Using multiple mutant mice, Zhang et al19,20 showed that the CKIs p57 and p21 function redundantly to control cell-cycle exit and differentiation of lens fiber cells, placental trophoblasts, and myoblasts. As such, p57 is now thought of as a critical terminal effector of signal transduction pathways that control cell differentiation.8,10,19 Recently, expression of p57 was shown to inhibit the conversion of conditionally immortal human mammary epithelial cells to the fully immortal state, suggesting that p57 may provide an additional barrier against indefinite proliferation.21
The human brain is a unique organ from a cell kinetic standpoint. Neurons become incapable of cell division in the early postnatal period. On the other hand, astrocytes retain their proliferative potential as is demonstrated in the process of reactive gliosis. Interestingly, astrocytes have the highest propensity to undergo malignant transformation of any cell type in the brain. Because p57 is expressed in cells with a high proliferative potential within embryonic brain tissue, in the present study we sought to determine the role of p57 in well-characterized, permanent human astrocytoma cell lines.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Three well-characterized malignant astrocytoma cell lines were
used in this study: U 343 MG-A (U343), U87 MG (U87), and U373 MG (U373)
(generous gifts of Bengt Westermark, Uppsala,
Sweden).22,23
U343 is a subclone of the original malignant
astrocytoma that expresses the astrocyte differentiation marker, glial
fibrillary acidic protein; it grows anchorage dependently, and is
nontumorigenic in athymic mice.24
U87 is derived from a
patient with a glioblastoma multiforme, and is tumorigenic in athymic
mice.25
U373 is derived from an anaplastic astrocytoma and
is also tumorigenic in athymic mice.23
The p53 status of
these three cell lines has previously and recently been determined: U87
and U343 are wild type and U373 is mutant for p5326-28
(David Malkin, The Hospital for Sick Children, Toronto, personal
communication). All astrocytoma cell lines were grown in monolayer
culture in 
-MEM supplemented with 10% fetal bovine serum and
penicillin/streptomycin/fungizone (Life Technologies, Inc.,
Gaithersburg, MD) at 37°C in 5% CO2.
Astrocytoma tumor specimens were taken at the time of craniotomy and tumor excision. A specimen of nonneoplastic human brain from a 14-year-old female was taken after craniotomy for epilepsy surgery. Human fetal brain was obtained after elective second-trimester abortion after informed consent from the parents.29 Permission to use this material was granted by the Research Ethics Board, The Hospital for Sick Children.
Polymerase Chain Reaction (PCR)/Heteroduplex Analysis and DNA Sequencing
Five overlapping PCR fragments spanning the entire coding region of the human p57 gene were generated using published primer pairs:7,30 fragment I, primers 2 + 6 (TCTTCTCGCTGTCCTCTCCT + CGCCCCACCTGCACCGTCT); fragment II, primer set 3 (CTTCCAGCAGGACATGCCGCTG + TGGAGCCAGGACCGGGACT); fragment III, primer set 4 (ACTGCCTAGTGTCCCGGTC + GTCAGCGAGAGGCTCCTGG); fragment IV, primers 7 + 9 (TCAAGAGAGCGCCGAGCAG + GCGGGCCCTTTAATGCCAC); fragment V, primers 10 + 12 (TCTCCCGGCCCCCTCTCGG + CAAAACCGAACGCTGCTCTG).
Fragments were amplified from 500 ng of genomic DNA in PCR reactions containing 10% DMSO, 0.6 µmol/L primers, 0.25 mmol/L dNTP, and 2 units Taq polymerase (Life Technologies, Inc.) in the supplied buffer (2 mmol/L MgCl2). Reactions were amplified by touch-down PCR with 35 sequentially linked cycles of 94°C denaturation for 30 seconds, annealing temperature for 30 seconds, and extension at 72°C for 30 seconds. Annealing was initiated at 68°C with a 1°C per 2 cycle step-down to 15 cycles at 58°C, followed by a 7-minute extension. Heteroduplex formation was achieved by denaturation at 94°C for 5 minutes and annealing at 65°C for 5 minutes. PCR products were purified using Qiaquick PCR purification columns (Qiagen Inc., Mississauga, Ontario, Canada), followed by electrophoresis in 0.4-mm thick hydrolink mutation detection enhancement gels (BioWhittaker Molecular Applications, Rockland, Maine) gels containing 15% urea and 6.25% formamide (J. T. Baker, Phillipsburg, NJ). Electrophoresis was performed in 0.6x Tris borate-ethylenediaminetetraacetic acid and run at 500 V for 17 hours before transfer to Hybond-N+ membranes (Amersham, Oakville, Ontario, Canada) and hybridization with internal primers for each PCR fragment: primer 13 (CCTTCCCAGTACTAGTGCGC), primer 6, primer 7, primer 8, and primer 11 (TCAGCAAAGCCGGCGGGGA) for fragments I, II, III, IV, and V, respectively. Samples containing heteroduplex species were directly sequenced in both orientations using the fragment specific-PCR primer pairs by Thermo Sequenase terminator cycle sequencing (Amersham) of gel-purified PCR products.
Plasmids and Transfection
The tetracycline-repressor gene expression system was used to
induce expression of p57.31
The pUHD15–1neo
plasmid (generous gift of S. Reed, The Scripps Research Institute, La
Jolla, CA) contains the Escherichia coli tetracycline
repressor element fused to the VP16 transactivation domain of
herpesvirus. This fusion protein is driven by a cytomegalovirus
promoter and the vector has the neomycin resistance gene for selection.
pUHD15–1neo (25 µg) was transfected into U 343 MG-A cells
using calcium phosphate. Neomycin-resistant clones were selected in 900
µg/ml geneticin (G418; Life Technologies, Inc.) in -MEM and stable
expression of the fusion protein was determined by Western blot
analysis of total cell lysates using a polyclonal antisera to VP16
(kindly provided by C. J. Ingles, Toronto, Canada). Several clones
were analyzed for VP16 expression for each cell line, and the majority
expressed VP16. Clones that demonstrated high-level expression of VP16
were selected for transfection with pUHD10-3 (generously provided by H.
Bujard, Heidelberg, Germany). pUHD10-3 contains a multiple cloning site
downstream from tandem tetracycline operator sequences and a CMV
promoter. A full-length human p57 cDNA (kind gift of S. J.
Elledge, Houston, TX) was inserted into the multiple cloning site of
pUHD10-3, and this plasmid (25 µg) was co-transfected with
pgk-puro (1 µg) for selection of stable lines. These
clones were also maintained in 4 µg/ml tetracycline (Sigma, St.
Louis, MO). Puromycin (Sigma) was used for selection at 1 µg/ml and
G418 concentration was maintained at 500 µg/ml.
To induce expression of p57, astrocytoma cells were washed three times in phosphate-buffered saline (PBS) before identical medium without tetracycline was added. To screen for p57 expression, total cell lysates were extracted and Western blot analysis was performed. To determine the effect of induction of p57 expression on the growth and morphology of the astrocytoma cell clones, 2 to 5 x 105 cells were plated in 10-cm2 dishes. The following day, fresh medium was added. Cell proliferation assays and flow cytometric analysis was performed as described below.
Cell Proliferation Assay
Cell growth was assayed by counting cells at defined intervals. Briefly, cells were trypsinized and resuspended in media, and an aliquot of cells was counted using a hemocytometer. Each count represented an average of three counts on three separate determinations. Cell proliferation assays were repeated in duplicate. Cell viability was determined on the basis of trypan blue exclusion as described previously.32,33
Flow Cytometric Analysis
To determine the proportion of cells present in a particular cell cycle phase, flow-assisted cell sorting (FACS) analysis of DNA content was performed. Briefly, 2 to 8 x 105 cells were trypsinized, washed in PBS, and resuspended in ice-cold 80% ethanol. Cells were kept at 4°C until propidium iodide (Sigma) DNA staining was performed. For different samples, the concentration of cells was kept equivalent. For staining, fixed cells were resuspended in propidium iodide and DNase-inactivated RNase A (Sigma) (final concentration 1 mg/ml) and were incubated for 30 minutes at room temperature in the dark. Stained cells were filtered through mesh-capped tubes and DNA content was analyzed on a Becton-Dickinson FACScan (San Jose, CA). Percent cell-cycle phase was determined using Cell Fit software (Becton-Dickinson) on three separate runs for each cell clone.
Antibodies
Antibodies to bax (N-20), p107 (SC-318), p130 (SC-317), E2F-1 (SC-193), and E2F-4 (SC-866x) were obtained from Santa Cruz Biotech Inc. (Santa Cruz, CA); antibodies to pRB (14001A), poly(ADP ribose) polymerase (PARP) (C2-10) and p57 (65021A) were obtained from Pharmingen (Richmond, CA).
Western Blot
Total cell lysates (20 µg) prepared in 120 mmol/L NaCl, 0.5% Nonidet P-40, 50 mmol/L TrisCl, pH 8.0, were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Proteins were transferred to polyvinylidene fluoride membranes (Immobilon-P; Millipore, Bedford, MA) by semidry electrotransfer. Blots were rehydrated before immunodetection, and then were blocked in 5% skim milk dissolved in PBS with 0.1% Tween 20 (PBS-T) at room temperature for 1 hour. Primary and secondary antibody incubations were performed in PBS-T at room temperature for 1 hour. Goat anti-rabbit or anti-mouse horseradish peroxidase-conjugated secondary antibodies were used at 1:5,000 concentrations. Blots were immersed in enhanced chemiluminescence detection reagent (Amersham) for 1 minute; chemiluminescence was detected on Kodak X-OMAT AR film (Eastman Kodak, Rochester, NY).
Western blots for p57, p107, p130, E2F1, E2F2, and pRB were obtained at multiple time points during p57 induction for the different astrocytoma cell clones. Western blots for PARP and Bax levels were obtained 8 days after p57 induction.
Immunocytochemistry
Astrocytoma cells were seeded onto glass coverslips and maintained in medium with or without tetracycline for 1 to 10 days. For senescence-associated ß-galactosidase (SA-ß-gal) staining, coverslips were harvested, washed in PBS, and fixed with 2% formaldehyde/0.2% glutaraldehyde in PBS for 5 minutes at room temperature. SA-ß-gal (pH 6.0) was detected as reported.34 Coverslips were rinsed in PBS, counterstained with neutral fast red, rinsed with distilled water, and mounted onto microscope slides using mounting media (DAKO, Carpinteria, CA). In some experiments, tetracycline was added back to the medium on day 5 after p57 induction, and the cells were then harvested for SA-ß-gal staining on days 5, 7, and 10.
Morphological Analysis
The morphology of control and p57-induced U 343 MG-A astrocytoma cells was observed using a Leitz (Fluovert FS; Leica Microsystems, Heerbrugg, Switzerland) light and immunofluorescence microscope. Induced morphological changes were observed for variable periods of time. In some experiment, p57 expression was repressed after induction at various time points by adding tetracycline to the medium. Cell morphology and culture conditions were then assessed by phase microscopy.
Fluorescence Microscopy
To identify cells undergoing apoptosis, astrocytoma cells were stained with Hoechst 33258 (Sigma) and quantified by fluorescent microscopic analysis.35 Briefly, uninduced and p57-induced astrocytoma cells were trypsinized, centrifuged, washed with PBS, and resuspended with 1% glutaraldehyde for 30 minutes for fixation. The cells were rinsed again and stained with 1 µmol/L Hoechst 33258 for 10 minutes previous to viewing under the fluorescence microscope.
Electron Microscopy
Uninduced and p57-induced human astrocytoma cells were harvested and lightly pelleted before fixation in 2.5% paraformaldehyde in phosphate buffer for 2 to 4 hours. Pellets were rinsed thoroughly with phosphate buffer before being postfixed with phosphate-buffered osmium tetroxide for 1 hour. The cells were then dehydrated in an ascending series of ethanols and embedded in epon-araldite via propylene oxide. After polymerization, ultrathin sections were cut on a diamond knife using an ultramicrotome and mounted on grids. The grids were then stained with ethanolic uranyl acetate and lead citrate. All specimens were viewed and photographed in a transmission electron microscope (JEOL 1200EXII; JEOL Peabody, MA).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
p57 was expressed under the control of the tetracycline operator
(tetO) in U343, U87, and U373 astrocytoma cell lines
constitutively expressing high levels of the tetracycline repressor
protein (tetR)-VP16 fusion protein. Of the many
clones screened for induction of p57 expression for each cell line,
three clones (clone 9, U343C9; clone 2
U87C2; and clone 3, U373C3)
showed tightly regulated, tetracycline-dependent expression of p57
(Figure 1)
. Induction of p57 occurred
within 24 hours for U343C9 and
U373C3 astrocytoma cells, and by the third day
for U87C2 cells (Figure 2)
. High expression levels of p57 for all
cell lines could be maintained for periods longer than 9 days after
induction. The specimen of human fetal brain showed expression of p57,
whereas the parental astrocytoma cell lines and specimen of
nonneoplastic brain from a 14-year-old patient with epilepsy did not.
No mutations in the p57 gene were observed from the
heteroduplex DNA detection analysis in the three astrocytoma cell lines
examined and in a panel of human astrocytoma specimens (data not shown)
|
|
. FACS
analysis revealed that p57-induced astrocytoma cells rapidly
accumulate in G1 phase of the cell cycle
(Figure 3B)
. The differences in growth rates between the induced
and uninduced astrocytoma cell clones were statistically significant,
and indicate that the overproduction of p57 can functionally arrest the
growth of astrocytoma cell lines in G1.
|
. These morphological
changes are apparent by day 3, coincident with the
G1 cell cycle arrest, and are very pronounced by
day 5. Uninduced U87C2 cells are generally
bipolar in configuration, much like the parental cell line from which
they are derived. After p57 induction, U87C2
cells became large and triangular with markedly expanded cytoplasms
(Figure 4)
. U373C3 astrocytoma cells were round
and flat with a ruffled peripheral plasma membrane before p57
induction. After p57 induction, these cells similarly developed an
expanded cytoplasm, but maintained their overall round, flat shape
(Figure 4)
.
|
To determine whether the induction of p57 was associated with
alterations in the expression of downstream cell-cycle regulatory
proteins, we next performed Western blot analyses of the pRB and E2F
family proteins (Figure 5)
. The
expression levels of pRB and p107 were sharply reduced by day 3 after
p57 induction, whereas p130 expression levels were unchanged.
Expression of the E2F family proteins was also determined in
p57-induced U343C9 cells. E2F-1 expression levels
were repressed whereas no change in the levels of E2F-4 was observed.
|
Induction of p57 in U343C9,
U87C2, and U373C3
astrocytoma cells led to the identification of SA-ß-gal-positive
cells (Figure 6)
. The generation of
SA-ß-gal-positive astrocytoma cells began for each cell clone by day
1 after induction and peaked between 5 to 7 days at which time all cell
clones had 75% SA-ß-gal-positive cells (Figure 7)
. The induction of SA-ß-gal-positive
cells through forced p57 expression was partially reversible as
replenishment of the medium with tetracycline on day 5 led to fewer
SA-ß-gal-positive cells on days 7 and 10 (Table 1)
.
|
|
|
After p57 induction, we detected a statistically significant
decline in viable cells in U343C9 and
U373C3 astrocytoma cells as determined by trypan
blue dye exclusion from days 3 to 7 (Figure 8)
. p57 induction had a greater effect on
reducing the number of viable cells among U373C3
astrocytoma cells than among U343C9. No such
decline in cell viability was apparent for U87C2
astrocytoma cells.
|
. Approximately 15% of
U373C3 nuclei were abnormal after Hoechst 33258
staining of p57-induced cells (Figure 10)
. Electron microscopy of p57-induced
and uninduced astrocytoma cells confirmed the findings of the Hoechst
33258 staining analysis. Unlike p57-induced U87C2
and U343C9 astrocytoma cells which showed a
preponderance of cells with normal ultrastructural features, many
p57-induced U373C3 cells were characterized
by convolution of nuclear and cytoplasmic outlines, apoptotic
bodies, and compaction and margination of nuclear chromatin (Figure 11)
.
|
|
|
revealed no change in
expression levels. However, induction of p57 among astrocytoma cell
clones led to diminished PARP expression (Figure 12)
. The reduction in
PARP expression was particularly marked for
U373C3 cells.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
75% of all cells in culture were positive.
Although equivalent numbers of cells expressed this marker of cell
senescence in each astrocytoma cell line, interestingly a population of
U373C3 astrocytoma cells responded to p57
induction by following an apoptotic pathway as determined by Hoescht
33258 staining and electron microscopy. Previous studies have shown that p57 is a gene which undergoes genomic imprinting. Genomic imprinting is a process that results in the expression of only one allele of a gene depending on its parental origin. As such, it is thought to play an important role in embryonal development. Genomic imprinting may also play a role in certain pediatric tumors such as Wilms’ tumor as a highly selective loss of maternal alleles for the Wilm’s tumor gene is found not uncommonly in this tumor type.36 In fact, a potential role for p57 in tumorigenicity was postulated on the basis of its chromosomal mapping to 11p15, a region which frequently demonstrates loss of heterozygosity in a number of common cancers in adults such as lung, breast, and bladder carcinoma, as well as Wilms’ tumor in children.10-16,37 Not all attempts to manipulate p57 expression levels have resulted in tumor suppression or formation. For example, p57-/- transgenic mice have delayed differentiation without tumor formation.38,39 Although a previous report suggested that germline deletions in the proline-alanine-rich (PAPA-repeat) region of p57 are associated with increased risk of a variety of cancers, including breast cancer, a recent report by Li et al40 failed to substantiate this observation in the context of breast cancer patients. In our study, p57 expression was documented within human fetal brain. However, none of the astrocytoma cell lines expressed p57, and none contained mutations in the p57 gene. Absence of p57 mutations in the human astrocytomas examined here and within a variety of other cancer types30,40,41 suggest that other mechanisms of transcriptional or posttranslational silencing must be involved in the loss of p57 protein expression in astrocytic tumors and other cancers. Two possible mechanisms of gene inactivation include methylation in the promoter region of the p57 gene and histone deacetylation. Recently, Shin et al41 demonstrated that formation of inactive chromatin through histone deacetylation is a general mechanism for inactivation of both p21 and p57 genes in gastric cancer cells, and that methylation of the promoter region of the p57 gene occurred in five of eight gastric cancer cell lines as an alternative pathway for inactivation of p57.
It is becoming clear that a common feature of cancer cells is the abrogation of cell-cycle checkpoints, either by aberrant expression of positive regulators such as cyclins and CDKs, or the loss of negative regulators, including CKIs and pRB. It has previously been suggested that transformation of glial cells into malignant astrocytic tumors also involves significant dysfunction of this cell cycle-control machinery.1,2 Pedram et al42 have shown that fetal rat diencephalic astrocytes can be stimulated to progress through G1/S phase by the endogenous neuropeptide, endothelin-3. Atrial natriuretic peptide was inhibitory for cell proliferation, and induced the expression of p57 among other CKIs. In fact, multiple CKIs were shown to be necessary to restrain cell-cycle progression in astrocytes, an observation that may have relevance for inhibition of human astrocytoma cells.
In human astrocytic tumors, many reports have demonstrated alterations in the expression and activity of cell-cycle regulatory proteins, especially the loss of p16 expression.43-48 We have previously shown that induction of p16 leads to a cell-cycle block in the U343 human astrocytoma cell line.49,50 To our knowledge, however, alterations in the p57-cyclin/CDK complexes-pRB/E2F pathway have not been described previously in malignant astrocytomas. Our data demonstrate for the first time that induction of p57 in p57-negative human astrocytoma cell lines can potently block the proliferation and alter the morphology of three different human astrocytoma cell lines. This p57-induced cell-cycle arrest is accompanied by alterations in the expression and activity of a number of cell-cycle regulatory proteins.
As examples, our data demonstrate the presence of a potential autoregulatory mechanism which may control the levels of expression of members of the pRB/E2F family proteins. It has been shown that both pRB and p107 have E2F binding sites in their promoter regions, and E2F-1 also contains E2F binding sites in its promoter region. pRB phosphorylation is critical for control of cell-cycle progression in G1.51,52 After pRB phosphorylation, E2F, freed from the repressive effects of pRB family proteins, are then able to activate transcription of genes required for S phase progression.52-54 It seems reasonable that pRB-E2F-1 complexes repress activated transcription from the pRB and p107 promoters. The repression of these factors suggests a model where initially, pRB and E2F family proteins form complexes that aggressively block transcription of factors required for cell-cycle progression. These same complexes are also responsible for inhibiting expression of the pRB and E2F family proteins, loss of the latter ensuring that E2F-dependent cell-cycle progression is not possible. Other investigators have previously demonstrated that different pRB family proteins show distinct binding specificities for different E2F family proteins.50,55-61 pRB seems to associate specifically with E2F-1, E2F-2, and E2F-3,59 whereas p107 binds E2F-456,61 and p130 binds E2F-4 and E2F-5.58,61 In p57-induced, growth-arrested U343 cells, the expression of pRB and E2F-1 is repressed, and pRB becomes quantitatively hypophosphorylated.
We also demonstrate here that p57-induced astrocytoma cells undergo a
change in morphology—cells becoming large and flat and having abundant
cytoplasm. This morphological change is reminiscent of the phenotype
exhibited by human osteosarcoma cell line, SAOS-2, after exogenous
expression of pRB.16,30,62-64
In the presence of pRB,
SAOS-2 cells become flat and round with a greatly expanded cytoplasm in
their growth-arrested state. These flat cells resemble senescent
primary fibroblasts after extended in vitro passage. In a
report by Uhrbom et al,34
40% of U1242 MG astrocytoma
cells induced to express p16 developed a senescent cell phenotype at 7
days as determined by SA-ß-gal staining. In our study, 75% of
astrocytoma cells were SA-ß-gal-positive 7 days after p57 induction.
Cellular or replicative senescence is a state of permanent growth arrest and altered cell function after a finite number of cell divisions. Cellular senescence is thought to be a tumor suppressive mechanism, and a contributing factor in aging.65,66 Three features distinguish senescent from presenescent cells: a block-to-cell proliferation, increased resistance to apoptotic death, and changes in differentiated functions.65 Although our data suggest that inducible p57 expression causes a cell senescent phenotype among astrocytoma cells, the effect of p57 on the generation of SA-ß-gal cells was at least partially reversible. Of the several growth regulatory transcriptional modulators known to be repressed in senescent cells, the repression of E2F-1 after p57 induction holds particular significance in our study on human astrocytoma cells.
Although senescent cells are thought to be resistant to apoptotic cell death, one of the astrocytoma cell lines induced to express p57, U373C3, exhibited a population of cells which underwent apoptosis as determined by Hoechst 33258 staining for micronuclear fragmentation and electron microscopy. Why this particular cell line responded in a different manner to p57 induction is an interesting yet unanswered question. Apoptosis is a genetically encoded cell death program defined by typical morphological and biochemical changes.67 Although ultrastructural characterization of nuclear and plasma membrane alterations remains one of the most important determinants of apoptosis, Hoechst 33258 staining for fragmented nuclei has also been used in a number of studies.68-74 Apoptosis has been shown to be induced in human astrocytomas after ionizing radiation and treatment with DNA-damaging agents.75-79 Several apoptosis-related molecules are involved in astrocytoma cell death including bcl-2, interleukin-1-ß-converting enzyme, and p53.80-85
Interestingly, of the three astrocytoma cell lines examined in this study, U87 and U343 express wild-type p53 whereas U373 is mutant for p53.26,27,80-86 As there have been several cancer cell systems in which apoptosis has been demonstrated in p53-inactivated cells,87-96 it is conceivable that the apoptosis observed in U373C3 cells after p57 induction occurs in a p53-independent manner. We showed that Bax levels were unchanged but PARP levels were decreased without cleavage formation after p57 induction in all cell clones. In response to DNA damage, PARP activity increases, resulting in poly-(ADP) ribosylation of many nuclear proteins, including PARP itself. In cells which have become activated to undergo apoptosis, the 116-kd PARP protein becomes cleaved by caspase-3 producing 85-kd and 25-kd fragments and resulting in loss of normal PARP function.97,98 Although we did not observe cleaved fragments of PARP in any of the astrocytoma cell clones examined here, down-regulation of PARP without cleavage product formation was observed for U343C9, U87C2, and U373C3 astrocytoma cells. This phenomenon has been described previously in replicatively senescent fibroblasts.99 Our inability to detect cleaved PARP fragments in U373C3 in particular may relate to the small number of cells that are undergoing apoptosis compared to the large number of cells that continue to express the senescent cell phenotype.
In summary, we have shown that inducible expression of p57 in three different astrocytoma cell lines is a strong stimulus against cell proliferation and for cell senescence. Ongoing studies in the laboratory are attempting to determine precisely what role p57, in conjunction with other CKIs, may have in inhibiting the growth of human astrocytic tumors in vivo.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Supported by a grant from the National Cancer Institute of Canada (to J. T. R. and P. A. H.), and Brainchild. P. B. D. was a fellow of the Medical Research Council of Canada. J. T. R. is recipient of a Scientist Award from the Medical Research Council of Canada.
Accepted for publication May 25, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  M.-D. Perng, S.-F. Wen, T. Gibbon, J. Middeldorp, J. Sluijs, E. M. Hol, and R. A. Quinlan Glial Fibrillary Acidic Protein Filaments Can Tolerate the Incorporation of Assembly-compromised GFAP-{delta}, but with Consequences for Filament Organization and {alpha}B-Crystallin Association Mol. Biol. Cell, October 1, 2008; 19(10): 4521 - 4533. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. J. Jin, Y. Lho, Y. Wang, M. Ao, M. P. Revelo, S. W. Hayward, M. L. Wills, S. K. Logan, P. Zhang, and R. J. Matusik Down-regulation of p57Kip2 Induces Prostate Cancer in the Mouse Cancer Res., May 15, 2008; 68(10): 3601 - 3608. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Rothschild, X. Zhao, A. Iavarone, and A. Lasorella E Proteins and Id2 Converge on p57Kip2 To Regulate Cell Cycle in Neural Cells. Mol. Cell. Biol., June 1, 2006; 26(11): 4351 - 4361. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Sato, H. Matsubayashi, T. Abe, N. Fukushima, and M. Goggins Epigenetic Down-Regulation of CDKN1C/p57KIP2 in Pancreatic Ductal Neoplasms Identified by Gene Expression Profiling Clin. Cancer Res., July 1, 2005; 11(13): 4681 - 4688. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Patel, A. D. Leal, and D. H. Gorski The Homeobox Gene Gax Inhibits Angiogenesis through Inhibition of Nuclear Factor-{kappa}B-Dependent Endothelial Cell Gene Expression Cancer Res., February 15, 2005; 65(4): 1414 - 1424. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Hernandez, S. Kozlov, G. Piras, and C. L. Stewart From The Cover: Paternal and maternal genomes confer opposite effects on proliferation, cell-cycle length, senescence, and tumor formation PNAS, November 11, 2003; 100(23): 13344 - 13349. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. B. Roninson Tumor Cell Senescence in Cancer Treatment Cancer Res., June 1, 2003; 63(11): 2705 - 2715. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Kanayama, K. Takahashi, T. Matsuura, M. Sugimura, T. Kobayashi, N. Moniwa, M. Tomita, and K. Nakayama Deficiency in p57Kip2 expression induces preeclampsia-like symptoms in mice Mol. Hum. Reprod., December 1, 2002; 8(12): 1129 - 1135. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Noris, C. Zannetti, A. Demurtas, J. Sinclair, M. De Andrea, M. Gariglio, and S. Landolfo Cell Cycle Arrest by Human Cytomegalovirus 86-kDa IE2 Protein Resembles Premature Senescence J. Virol., October 25, 2002; 76(23): 12135 - 12148. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. M. Fathallah-Shaykh Darts in the Dark Cure Animal, but Not Human, Brain Tumors Arch Neurol, May 1, 2002; 59(5): 721 - 724. [Full Text] [PDF]
|
|
|
|
|
|
L. J. Poole, Y. Yu, P. S. Kim, Q.-Z. Zheng, J. Pevsner, and G. S. Hayward Altered Patterns of Cellular Gene Expression in Dermal Microvascular Endothelial Cells Infected with Kaposi's Sarcoma-Associated Herpesvirus J. Virol., March 7, 2002; 76(7): 3395 - 3420. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
