| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Short Communications |
From the Institute of Pathologic Anatomy and Histology,*
University of Padova, Padova; the Department of Experimental and
Diagnostic Medicine,
Section of Microbiology
and the Interdepartment Centre for
Biotechnology,
University of Ferrara,
Ferrara, Italy
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Although the incidence of HC is low, most animals show a liver cell dysplasia (LCD) of variable degree.15,16 It is likely that LCD in TT mice represents a preneoplastic lesion which can be assumed as a model to test the role of tat in predisposition to tumor formation in HIV-1-infected patients. Predisposition to chemical carcinogenesis has been demonstrated in mice transgenic for the hepatitis B virus genome17 and for a mutant p53 gene18 as well as in knock-out mice nullizygous for p53.19 We therefore treated BKV/TT mice with diethylnitrosamine (DENA), a hepatotropic carcinogen, to establish whether liver carcinogenesis is enhanced compared to normal control mice. DENA is a potent initiator of carcinogenesis and induces liver cancer slowly after a single oral, intraperitoneal, or intravenous dose.20 Twenty-four hours after DENA administration to rats, necrotic hepatocytes are readily visible, followed by proliferation of liver oval cells with restitution to the normal acinar architecture 14 days after carcinogen administration. However, occasional proliferation of hepatocytes with nuclear pleomorphism and basophilic cytoplasm occurs. Then, these small foci of rapidly growing altered basophilic hepatocytes expand, so that 6 weeks later many foci increase to 3 mm in diameter and HCs are detected several months after DENA administration.21
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The generation of transgenic BDF mice carrying BKV/tat sequences has been previously described.15,16 Seven founder mice were identified, each giving rise to a transgenic mouse line by crossing initially with normal BDF mice and then with heterozygous transgenic mice of the same lineage to obtain animals homozygous for the transgene.
Induction of Tumors
Eighty-nine TT mice and 200 BDF normal controls (CC) were injected intraperitoneally with DENA (Sigma, St. Louis, MO) dissolved in physiological saline according to the protocol of DENA carcinogenesis reported by Vesselinovich and Mihailovich.22 We performed two experiments to assess the effects of different doses of DENA. In experiment 1, 64 TT and 150 CC mice were treated with two injections of DENA, the first at day 7, the second at day 14 after birth. The total dose of DENA injected was 15 mg/kg body weight. To confirm the results of the first experiment, a second experiment was performed in which only one injection of DENA was given to 25 TT and 50 CC mice at day 10 after birth. The total dose of DENA injected was 7.5 mg/kg body weight.
Animal Examination
Animals were routinely examined twice a week for the appearance of symptoms. Groups of TT and CC animals were sacrificed at regular intervals, that is at 100, 200, 300, 400 and 600 days after injection of DENA. All mice, either dead by natural causes or sacrificed, were subjected to autopsy.
Histological and Histochemical Procedures
Tissue samples from all organs taken at autopsy were fixed in 10% phosphate-buffered formalin for 12 to 24 hours and embedded in paraffin for histological and histochemical examination. At least two representative fragments of each lobe of the liver were taken: one of these was cryopreserved at -80°C for molecular studies, whereas the other was subjected to histological and histochemical analysis. Three- to five-µm serial sections were stained with hematoxylin and eosin for the histological examination and with periodic acid-Schiff (Merck, Frankfurt, Germany), with and without Diastase (Sigma) pretreatment for the assessment of the glycogen content of liver cells. For the histochemical analysis of CD19, CD20, CD21, and CD45R B cell markers, after removal of paraffin and rehydration and after block of the endogenous peroxidases with 0.3% H2O2 in methanol, the samples were incubated with mouse antibodies for 10 to 12 hours at 4°C. Then anti-mouse immunoglobulins (DAKO, Glostrup, Denmark) were used as secondary antibodies followed by incubation with avidin-biotin-peroxidase conjugates and development in diaminobenzidine (Sigma).16
Electron Microscopy
For ultrastructural investigations, specimens of liver tumors and nodules were fixed with glutaraldehyde in phosphate-buffered saline (PBS) (0.2 mmol/L, pH 7.2) for 8 hours, postfixed in 1% OsO4 in PBS for 4 hours, dehydrated, and embedded in Araldite. Ultrathin sections were stained with uranyl acetate and lead citrate and were examined with a Hitachi H-7000 electron microscope.
Morphological Criteria Used for the Classification of Liver Lesions
The criteria of Koen et al23 and Becker,24 slightly modified, were used for the classification of liver lesions. Hepatocyte proliferative lesions >1 mm were defined as liver tumors24 and classified as adenomas or carcinomas based on cytological features and architectural patterns. The LCD and basophilic liver cell nodules (BLCN) were identified according to Solt et al21 Similar cytological modifications associated with other pathological conditions (inflammation, amyloidosis) of the liver were not considered as dysplastic-preneoplastic lesions and were not included in our analysis. All of the proliferative liver lesions were grouped as follows: LCD, BLCN, hepatocellular adenoma (HA), and HC.
Nucleic Acid Hybridization, Polymerase Chain Reaction (PCR), and Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR)
DNA and RNA extraction, and nucleic acid hybridization were performed according to standard techniques.25 tat cDNA labeled with 32P-dCTP by nick-translation or by primer extension was used as a probe. The specific activity of the probes was 1 to 6 x 109 cpm/µg. PCR and RT-PCR for tat cDNA and RNA were performed as previously described.15 DNA (0.2 µg) was amplified in a DNA thermal cycler (Perkin-Elmer, Forster City, CA) in a total volume of 50 µl containing 10 mmol/L Tris-HCl, pH 8.3, 50 mmol/L KCl, 1.5 mmol/L MgCl2, 100 µmol/L of each dNTP, 25 µmol/L of each primer, and 5 units of TaqI-DNA polymerase (Boehringer, Mannheim, Germany). A 21-mer oligonucleotide (5'GAAGCATCCAGGAAGTCAGCC3') and a 24-mer oligonucleotide (5'ACCTTCTTCTTCTATTCCTTCGGG3') were used as forward and reverse primers, respectively, to amplify a 239-bp sequence of tat cDNA. Conditions of amplification were: denaturation at 94°C for 1 minute, annealing at 55°C for 2 minutes, extension at 72°C for 2 minutes for 30 cycles with a final extension at 72°C for 10 minutes. PCR products were analyzed by electrophoresis onto a 2% agarose gel. For RT-PCR, 3 to 5 µg of total RNA were treated with 5 U of RNase-free DNase (Promega, Madison, WI) at 37°C for 20 minutes, followed by phenol-chloroform extraction and ethanol precipitation. Reverse transcription was performed with the cDNA Cycle Kit from Invitrogen (San Diego, CA) and the resulting cDNA was amplified by PCR as described above.
Statistical Analysis
Statistical differences between groups of animals were analyzed by the Fisher exact probability test. The significant level was defined at a P value < 0.05.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
By Southern blot hybridization analysis we confirmed previous
results,15,16
namely that all tissues and organs of BKV/TT
mice contain the transgene as tandem insertions in a variable number of
copies (5 to 20) per cell (data not shown). Then, by PCR and RT-PCR we
tested the presence of tat DNA and RNA in two dysplastic
lesions, one basophilic liver cell nodule, one hepatoma, and one HC.
The results of the analysis indicated that tat DNA is
present and tat RNA is expressed in these tissues (Figure 1, A and B)
.
|
All 89 (100%) TT animals (64 of the first experiment and 25 of
the second experiment) were affected with lesions when examined at
autopsy. Of the 200 CC mice, only 45 (30%) and 13 (26%) in the first
and second experiments, respectively, showed lesions (Table 1)
. No significant differences in the
number of lesions were found in TT and CC animals related to gender.
|
The total number of lesions documented in TT mice was 219, with a ratio lesion/animal of 2.46, indicating that more than one alteration could be present in the same animal. The lesions were very similar in the two experiments and distinguished in hepatic alterations and alterations of other organs, both including 1) lesions related to the carcinogenic action of DENA and 2) lesions unrelated to DENA activity but related to the transgenic status and determined by chronic infections or other causes. The following description of lesions observed during the course of these experiments in TT and CC mice is based on histological and histochemical analysis as well as on electron microscopic examination.
Hepatic Lesions
Architectural and cytological alterations observed in both experiments of the study were morphologically similar in TT and CC animals.
Liver Cell Dysplasia (LCD)
The liver presented a normal lobular architecture and the
alterations consisted exclusively in cytological changes evenly and
diffusely distributed. The dysplastic hepatocytes formed cell plates
separated by sinusoids and showed clear or basophilic cytoplasm,
central large nuclei (often twice or more than normal in size) with
nuclear/cytoplasmic ratio >1 (Figure 2
,
A and B). LCD was significantly more frequent in TT than in CC animals
in both experiments: 29.7% versus 12.7% in the first
experiment (P = 3.3 x
10-3), 56.0% versus 12.0% in the
second experiment (P = 9.7 x
10-5) (Table 2)
.
Furthermore, LCD showed a significantly higher incidence in TT mice in
the second experiment (56.0%) compared to the first (29.7%)
(P = 2 x 10-2).
This difference is likely because of the less severe effect of one dose
of DENA in the second experiment, inducing a prevalence of the milder
preneoplastic lesions.
|
|
Although BLCN were randomly distributed, they were more often
observed adjacent to centrolobular veins. Based on size or number of
forming cells and architecture, BLCN were differentiated as small or
large. The small BLCN consisted of 20 to 100 cells with a clear
delimitation from the normal tissue. The hepatocytes were smaller than
normal with more basophilic and sometimes foamy cytoplasm, large nuclei
with chromatin granules, and prominent nucleoli. Mitoses were rare. The
small BLCN did not contain newly formed vascular network and sinusoids
appeared compressed. The large BLCN consisted of >100 cells and showed
cytological characteristics similar to the small ones, but with no
marked outline from normal adjacent tissue and with a more prominent
variability of the nuclear size. The altered hepatocytes were
aggregated in plates with more than one element in thickness, separated
by sinusoids. In the largest BLCN, cell plates formed incomplete
trabeculations at the periphery (Figure 2
, C and D). Numerous BLCN
showed intermediate features between small and large types. The
frequency of BLCN was significantly greater in TT than in CC animals in
the first experiment: 57.9% versus 23.3%
(P = 1.5 x 10-6),
whereas it was not significant in the second experiment: 36.0%
versus 22.0% (P = 1.5 x
10-1) (Table 2)
. More than one type of BLCN was
observed in the same liver and often in the same lobe. BLCN were more
frequently associated with LCD and HA, and less frequently with HC.
Hepatocellular Adenomas
In this category we considered alterations that fulfilled the
criteria of type I and small type II lesions of Becker’s
classification.24
They appeared as nodular proliferations
varying in diameter from 1 mm to >1 cm, with sharp borders and with
some grade of compression of normal adjacent tissue. Small tumors were
composed almost entirely of basophilic cells, but in the large tumors
zones of trabeculation became more evident, extending variably from
<5% to 50% of the total section and usually located in the central
areas. Trabeculations in the small and large tumors were one to two
cells thick (rarely three cells) separated by slit-like sinusoids lined
by endothelium. They were irregularly branched and were composed of
cells with basophilic cytoplasm and central oval nucleus with small
nucleoli. In some instances periodic acid-Schiff-diastase-positive
hyaline globules were observed in the cytoplasm. Mitoses were absent or
very few (Figure 2
, E–G). HA were 40.6% in TT mice and 10.0% in CC
mice in the first experiment (P = 6.6 x
10-7). This greater incidence was confirmed in
the second experiment: 32.0% in TT mice and 8.0% in CC mice
(P = 1.1 x 10-2)
(Table 2)
.
Hepatocellular Carcinomas
In this histotype we grouped lesions similar to the large type II,
III, and IV tumors of Becker’s classification.24
Histologically HCs varied from a well-differentiated appearance to a
poorly differentiated solid pattern. The well-differentiated type HCs
showed trabecular structures (Figure 3A)
.
The cell plates had a thickness of more than two to three cells and
were more irregularly branched compared to HA. HCs were usually
characterized by severe cellular atypia with a nuclear/cytoplasmic
ratio >1, a variable nuclear size and structural abnormalities of
chromatin and nucleoli. Mitotic activity was variable but always
evident and greater than in HAs (Figure 3
, B and D). In the poorly
differentiated tumors, the trabeculae were composed of plates which
were five to 10 or more cells thick, sometimes forming blunt
pseudopapillary structures with cystic and necrotic areas (Figure 3C)
.
The HCs were aggressive and invasive, because they produced lung
metastases (Figure 3E)
. They were significantly more frequent in TT
than in CC animals both in the first and in the second experiment,
independently from the dose of DENA: 50.0% versus 12.7% in
the first experiment (P = 1.7 x
10-8), 32.0% versus 4.0% in the
second experiment (P = 1.7 x
10-3) (Table 2)
.
|
. The preneoplastic lesions (LCD
and BLCN) start to appear in TT mice 100 days after DENA inoculation
and reach a peak at 300 days. The neoplastic lesions (HA and HC) arise
in TT mice after 200 days from treatment with DENA and reach a peak at
400 days, following the peak of the preneoplastic lesions.
|
Dilatations of liver sinusoids and central veins, with the characteristics of vascular ectasis, were observed only in the first experiment, with no significant difference between TT and CC mice. This condition may be related to hemodynamic modifications as a consequence of liver cell necrosis induced by DENA. Two and four emangiomas were observed in TT and CC livers, respectively. They consisted of irregularly branching vessels, spaces, and lacunae lined by flat endothelial cells with fibrous septa, sometimes containing compressed and atrophic liver cells. Endothelial cells showed normal nuclei and no mitoses. Thrombosis and scarring were common.
Extra-Hepatic Lesions
Alterations outside the liver had a low frequency both in TT (36.1%) and in CC (26.7%) animals. Proliferative and neoplastic lesions of the lung are likely caused by the carcinogenic action of DENA and no significant differences were observed between TT and CC mice. Lymphomas were observed only in TT mice and may be directly related to the transgenic status, because TT mice spontaneously develop such tumors.15,16
Lung Lesions
Lung lesions were of two types with a low frequency in both experiments: 1) small nodular hyperplastic proliferations (10.1% in TT and 6.0% in CC mice) with a solid or papillary growth pattern and with ill defined outlines from the adjacent lung tissue; 2) adenocarcinomas (4.5% in TT and 1.6% in CC mice) of variable size with irregular and infiltrating margins. The first lesions were made up by trabeculae and cords containing epithelial cells larger than normal pneumocytes and epithelial bronchiolar cells, showing central round nucleus and small nucleoli, irregularly distributed. No mitoses were observed. The nodular tumors showed nests and cords of more atypical epithelial cells extending into the parenchyma with an altered nuclear/cytoplasmic ratio, vescicolous nuclei, and evident macronucleoli. Mitoses were frequent. The lung tissue adjacent to the proliferative lesions showed capillary congestion and numerous macrophages in the alveolar lumens. Bronchial tubes showed foci of epithelial hyperplasia with increase of eosinophilic bronchial cells.
Lymphomas, Adenocarcinomas, and Leiomyosarcomas
Lymphomas were 4.6% in DENA-treated TT mice and consisted of large blastic cells mixed to more mature and differentiated cells such as lymphocytes and plasma cells and other intermediate lymphoid cells. By histochemical analysis, large blastic cells expressed CD19, CD20, CD21, and CD45R (4KB5) B cell markers. These characteristics indicate that these tumors are B cell lymphomas which were observed to develop spontaneously at the frequency of 7% in TT mice.15,16 No lymphomas were detected in DENA-treated CC mice. Adenocarcinomas and leiomyosarcomas of the skin were found at the same frequency in DENA-treated TT mice as reported previously in TT mice.15,16 The same incidence of lymphomas, adenocarcinomas, and leiomyosarcomas in DENA-treated TT mice as in TT mice suggests that these tumors are not related to the carcinogenic activity of DENA.
Non-Neoplastic Lesions
The non-neoplastic lesions were skin ulcers; amyloid depositions in the liver, kidneys, and spleen; and chronic pyelonephritis with hydronephrosis, often associated with amyloid as reported previously.15,16 Skin lesions were very similar to those found in TT mice.15,16
Amyloidosis
Systemic amyloidosis represented the most frequent non-neoplastic and nonspecific alteration observed in TT as well as in CC animals. It was always associated with chronic inflammation of the skin, kidneys, and liver or of the pelvic organs in females. Amyloid substance depositions were commonly found in the liver, kidneys, and spleen, less frequently in the small intestine wall and in lymph nodes.
Chronic Inflammatory Lesions
Hydronephrosis was constantly associated with chronic pyelonephritis and interstitial fibrosis of the kidneys; the grade of parenchymal atrophy was variable but sometimes severe.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
DENA is a potent initiator carcinogen which induces hepatic necrosis early after administration. The ensuing regenerative process, involving proliferation of hepatocytes, is accompanied by chromosome alterations and mutations, leading to the appearance of preneoplastic cells that gradually evolve toward a malignant phenotype. The constitutive expression of Tat in liver of TT mice may therefore support the carcinogenic effect of DENA in two ways: 1) the presence of Tat-induced LCD enhances the genetic alterations accompanying liver regeneration after the necrotic activity of DENA, contributing to the initiation of the neoplastic phenotype; and 2) the effect of Tat-promoting cell proliferation stimulates the expansion of neoplastic clones, accompanied by acquisition of additional genetic alterations, thus favoring progression to malignancy of the early neoplastic lesions. This effect of Tat on hepatocyte proliferation and malignant progression is most likely because of its anti-apoptotic activity,11,12 angiogenic functions,9,10 and ability to induce expression of growth factors,8,12 cytokines,27,28 and transcription factors.29 In addition, LCD in TT mice is associated to aneuploidia which is a manifestation of genetic instability,30 one of the main factors of progression to malignancy in human tumors.31 Our results are in agreement with predisposition to chemical carcinogenesis in other models of genetically modified mice. In fact, Li et al18 demonstrated an enhanced carcinogenic effect of DMBA in mice transgenic for a mutant p53 gene and predisposition to urethan-induced carcinogenesis was shown in mice bearing a transgenic hepatitis B virus genome.17 In addition, Kemp et al19 reported that knock-out mice heterozygous or nullizygous for p53 show an accelerated progression of epidermal hyperplasia, induced by 9,10-dimethyl-1,2-benzanthracene and 12-O-tetradexanoyl phorbol-13-acetate, to adenoma and squamous cell carcinoma.
This study indicates that preneoplastic conditions established by Tat may contribute to initiation and progression of the tumorigenic process. These results may have an important implication for the neoplastic pathology observed in the course of AIDS. Indeed, extracellular Tat, taken up by normal cells of HIV-1-infected patients,4-7 may predispose these cells to the oncogenic effect of exogenous and endogenous carcinogens. These results also suggest that reasonable efforts should be developed to inhibit Tat oncogenic activity in HIV-1-infected patients with immunoprophylactic,32 immunotherapeutic, and gene therapy approaches.13
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Supported by funds from Ministero dell’Università e della Ricerca Scientifica e Tecnologica (MURST 60%, 1997 and 1998) (to G. A. and to A. C.), and from the AIDS Project of the Italian Ministry of Health (AIDS Projects 1997 and 1998, Istituto Superiore di Sanità, Rome) (to A. C.).
Accepted for publication July 12, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B by the Tat protein of human immunodeficiency virus type-1. J Virol 1996, 70:4427-4437This article has been cited by other articles:
 |
|
 |
|
  F. Di Benedetto, N. De Ruvo, M. Berretta, M. Masetti, R. Montalti, S. Di Sandro, C. Quintini, M. Codeluppi, U. Tirelli, and G. E. Gerunda Don't Deny Liver Transplantation to HIV Patients With Hepatocellular Carcinoma in the Highly Active Antiretroviral Therapy Era J. Clin. Oncol., May 10, 2006; 24(14): e26 - e27. [Full Text] [PDF]
|
|
|
|
 |
|
 J. E. Aldridge, J. A. Gibbons, M. M. Flaherty, M. L. Kreider, J. A. Romano, and E. D. Levin Heterogeneity of Toxicant Response: Sources of Human Variability Toxicol. Sci., November 1, 2003; 76(1): 3 - 20. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. B. Birrer, D. Birrer, and J. V. Klavins Hepatocellular Carcinoma and Hepatitis Virus Ann. Clin. Lab. Sci., January 1, 2003; 33(1): 39 - 54. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
