| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |




From the Department of Histopathology,*
Royal Free and
University College Medical School, London, United Kingdom; the Academic
Department of Haematology and Cytogenetics,
Institute of Cancer Research, Sutton, Surrey, United Kingdom; and The
Center for Human Genetics and Flanders Institute of
Biotechnology,
University of Leuven, Leuven,
Belgium
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Molecular cloning of the breakpoint of t(1;14)(p22;q32) has
allowed the identification of the involved gene.3,4
BCL10
encodes a protein of 233 amino acids with residues 13 to 101 forming a
caspase recruitment domain (CARD), found in a number of apoptotic
regulatory molecules.5
Wild-type BCL10 weakly promoted
apoptosis in in vitro assays and activated nuclear factor
B (NF-
B),3,4,6-10
a transcription factor for
several cell survival molecules.11
In the rat embryonic
fibroblast transformation assay, the wild-type molecule inhibited
transformation induced by synergistic oncogenes.3
Truncated BCL10 isolated from cDNA clones of a gastric MALT lymphoma
with t(1;14)(p22;q32) lost the pro-apoptotic activity but
retained the ability of NF-
B activation and moreover gained
functional enhancement of malignant transformation.3
Thus,
wild-type BCL10 may act as a tumor suppressor whereas mutation may
result in BCL10 gaining oncogenic functions. Truncating BCL10 mutations
have been found in
5% of MALT and follicular
lymphomas.12,13
BCL10 mRNA is commonly expressed in normal tissues but most highly expressed in lymphoid tissues.3,4,6-9 In the B-cell follicle, BCL10 mRNA was expressed highly in the germinal center, moderately in the marginal zone, and weakly in the mantle zone B cells.3 BCL10 mRNA was also highly expressed in MALT lymphomas with and without t(1;14)(p22;q32).3 However, expression of the protein and its cellular localization are unknown. We generated mouse BCL10 monoclonal antibodies and studied the protein expression in various normal tissues and different subtypes of B-cell lymphomas.
| Materials and Methods |
|---|
|
|
|---|
Formalin-fixed and paraffin-embedded tissue specimens from 31 normal and reactive lymphoid tissues including eight fetal thymus from 16 to 40 weeks of gestation, four appendices, eight tonsils, six lymph nodes, and five spleens, 116 lymphomas comprising 40 MALT, 20 mucosal diffuse large B-cell lymphomas (DLBCL) (14 with low-grade MALT lymphoma component), 21 follicular, 17 mantle cell, and 18 nodal diffuse large B-cell lymphomas, as well as 74 normal nonlymphoid tissues of 21 different types were retrieved from the surgical files of Department of Histopathology, Royal Free and University College Medical School. Of the MALT lymphomas, four cases previously showed t(1;14)(p22;q32) by cytogenetics and 34 of the 40 cases originated from the stomach. The histology of all lymphoma cases was reviewed by AD.
Expression and Purification of Recombinant BCL10 Protein
The full length (amino acids 1 to 233) and amino terminus (amino acids 1 to 122) of BCL10 were polymerase chain reaction-amplified from a BCL10 cDNA clone using a forward primer containing NcoI site (5'ATCCATGGAGCCCACCGCACCGGTCC3') and a reverse primer containing NotI site (5'ATGCGGCCGCTTGTCGTGAAACAGTACGT-GA3' for the full length; 5'ATGCGGCCGCACAACTGC-TACATTTTAGTC3' for the amino terminus). The polymerase chain reaction products were cloned into the TA cloning vector pGEM-T, subcloned into PUC119/Myc-His at the NcoI and NotI sites and then transformed into Escherichia coli HB2151. Colonies were screened using polymerase chain reaction with vector primers (M13 forward and reverse) and positive clones were further sequenced to check for correct sequence and reading frame. Ten positive clones were induced to express BCL10 protein in a 5-ml culture with 1 mmol/L isopropyl-ß-thiogalactopyranoside (IPTG) at 28°C for 10 to 16 hours and their BCL10 expression was assessed by Western blotting with 9E10 antibody (Sigma, Poole, UK), which recognizes the c-myc tag. The clone expressing the highest level was subjected to induction in a 2-L culture under the same conditions. BCL10 was purified using Ni-NTA (QIAGEN, Crawley, UK) affinity chromatography under denaturing conditions with 8 mol/L of urea according to the manufacturers instructions. Purified BCL10 was dialyzed against 30 mmol/L Tris-HCl (pH 8.0) and concentrated using Centriplus concentrators (Amicon, Beverly, MA). The purity and yield were checked by sodium dodecyl sulfate-polyacrylamide gel electrophoresis.
Generation of Monoclonal Antibody
BALB-c strain mice (Harlan, London, UK) were primed with 50-µg full-length recombinant BCL10 protein in complete Freunds adjuvant followed by two boost injections with 50-µg BCL10 protein in incomplete Freunds adjuvant. Three days after the second boost injection, the splenic cells of the immunized mice were fused with the myeloma cell line NSO as described previously.14 A total of 941 clones were screened using an enzyme-linked immunosorbent assay with full-length recombinant BCL10 protein and 128 positive clones were obtained. To identify clones that might be suitable for immunohistochemistry of formalin-fixed paraffin-embedded tissue materials at an early stage of the cloning process, the enzyme-linked immunosorbent assay-positive clones were also screened by immunohistochemical staining of paraffin sections from MALT lymphoma with t(1;14)(p22;q32). The positive clones were expanded in 24-well culture plates for 4 to 8 days. Eleven positive clones were sustained as shown by enzyme-linked immunosorbent assay and were subjected to single-cell cloning. A total of eight enzyme-linked immunosorbent assay-positive single clones were finally obtained.
Generation of BCL10 Stable Expression Cell Lines
HEK 293 cells were separately transfected with pcDNA3.1/myc-His (Invitrogen, Carlsbad, CA) containing either a full-length BCL10, mutant 106 (amino acids 1 to 168), carboxyl terminus (amino acids 101 to 233), or no insert using the calcium-phosphate method.3 Colonies were selected with 1 mg/ml of G418, ring-cloned, and screened for exogenous BCL10 expression. The stable cell lines were maintained in high-glucose Dulbeccos modified Eagles medium containing 10% fetal calf serum, 100 g/ml of penicillin, and 100 µg/ml of streptomycin supplemented with 1 mg/ml of G418.
Western Blotting Analysis
Frozen tissue sections or cell pellets were homogenized in 50 mmol/L Tris-HCl (pH 8.0), 150 mmol/L NaCl, 0.02% sodium azide, 0.1% sodium dodecyl sulfate, 1% Nonidet P-40, 0.5% sodium deoxycholate, 100 mg/ml phenylmethylsulfonyl fluoride, and 1 mg/ml leupeptin. Protein extracts were mixed with sodium dodecyl sulfate gel loading buffer, denatured, separated on 12% polyacrylamide gels, and electrotransferred onto nitrocellulose membranes. The membranes were sequentially incubated with a BCL10 monoclonal antibody (1/2,000 dilution of culture supernatant from hybridoma clones), biotinylated rabbit anti-mouse Ig (DAKO, High Wycombe, UK), alkaline phosphatase-conjugated avidin and were finally visualized with 5-bromo-4-chloro-3-indolyl phosphate and nitro blue tetrazolium.
Immunohistochemistry
Culture supernatant from hybridoma clones was directly used for immunostaining. For formalin-fixed paraffin-embedded tissue, heat retrieval of antigen was performed on 4-µm sections before antibody staining. Serial dilutions of the hybridoma culture supernatant and various antigen retrieval methods were tried. A 1/60 dilution of the hybridoma culture supernatant and treatment of sections in target retrieval solution, pH 6.0 (DAKO, UK), in a microwave oven for 30 to 35 minutes gave the best results of immunostaining and was used for study of the protein expression in both normal and malignant lymphoid tissues. The protein expression was evaluated by three different observers (HY, AD, MQD). The proliferation antigen Ki67 was detected with monoclonal antibody MIB1 (1/70 dilution; DAKO) using the avidin-biotin method preceded by antigen heat retrieval. The Ki67 proliferation indices were determined by counting 10 randomly chosen fields. Only homogenous tumor areas were included for the quantification to ensure that the Ki67-positive cells counted maximally represented tumor cells.
Statistical Analysis
Statistical evaluation of quantitative data from two groups was performed using nonparametric Mann-Whitney UWilcoxon Rank Sum W test with SSPS software.
| Results |
|---|
|
|
|---|
The eight positive single clones were examined for their
specificity by Western blotting analysis with the full-length
recombinant BCL10 protein. Seven clones showed specific recognition of
the BCL10 protein. To map the amino acid residues recognized by these
monoclonal antibodies, Western blotting analysis of the HEK 293 cells
transfected with various BCL10 deletion constructs as well as the
recombinant amino-terminal BCL10 product was performed. Three clones
including clone 151 recognized the full-length (amino acids 1 to 233),
the truncated (amino acids 1 to 168), and the carboxyl-terminal (amino
acids 101 to 233) BCL10 products expressed in HEK 293 cells, but did
not react with the recombinant amino-terminal BCL10 product (amino
acids 1 to 122) (Figure 1)
, indicating
that these clones recognized amino acids between 122 to 168. The
remaining four clones recognized the full-length and the
carboxyl-terminal BCL10 product but only weakly reacted with or did not
recognize the truncated BCL10 product, suggesting that these antibodies
recognized amino acid residues further toward the carboxyl terminus
than those recognized by clone 151. No clones recognized epitopes
within the amino-terminal CARD. All seven monoclonal antibodies were
further tested by immunohistochemistry of formalin-fixed
paraffin-embedded tissue sections from MALT lymphomas with
t(1;14)(p22;q32). All seven clones showed characteristic
staining of MALT lymphoma with t(1;14)(p22;q32) (see below). The
staining was specific because no staining was seen if hybridoma culture
supernatant was omitted or immunoabsorbed with the recombinant BCL10
protein before immunohistochemistry. Of the seven monoclonal
antibodies, clone 151 gave the best immunostaining on paraffin-embedded
tissue sections and was used for all subsequent experiments.
Western blotting analysis of frozen tissues from tonsil, lymph node,
and spleen showed that BCL10 was present as a predominant 32-kd band
with a weaker 37-kd band (Figure 1)
.
|
BCL10 protein was expressed in normal spleen, reactive tonsil,
lymph node, and MALT of the appendix (Table 1)
. In B-cell follicles, the protein was
expressed abundantly in the germinal center B cells, moderately in the
marginal zone, but only weakly in 40 to 60% of the mantle zone B cells
(Figure 2, AD)
. Within the germinal
center, dark-zone centroblasts expressed more BCL10 than light-zone
centrocytes (Figure 2A)
. Both the germinal center and marginal zone B
cells expressed BCL10 protein in the cytoplasm (Figure 2, B and D)
. The
subcellular localization of BCL10 in the mantle zone B cells could not
be confidently determined because of their low expression level and
scanty cytoplasm.
|
|
Of 21 types of normal solid tissues examined, only breast showed BCL10
protein expression. BCL10 expression appeared to be restricted to the
cytoplasm of the luminal epithelial cells of breast (Table 1)
.
BCL10 Expression in Malignant Lymphoma
The results were summarized in Table 1
. Unlike marginal zone B
cells, each of the four MALT lymphomas with t(1;14)(p22;q32)
showed strong BCL10 expression in both the nucleus and cytoplasm in all
tumor cells (Figure 3, AD)
. Strong
BCL10 nuclear expression in these tumor cells distinguished them from
nonlymphomatous-reactive lymphocytes, which showed either weak or no
cytoplasmic BCL10 expression. The BCL10 expressing tumor cells invaded
gastric glands forming lymphoepithelial lesions (Figure 3C)
and
disseminated to other parts of the gastric mucosa intermingling with
reactive lymphocytic infiltrates (Figure 3E)
. Discrete tumor cells as
identified by strong BCL10 nuclear expression were also found in the
marginal zone of the spleen in one gastric MALT lymphoma where splenic
tissue was available. Strong nuclear BCL10 expression in tumor cells
was in sharp contrast to the weak cytoplasmic BCL10 expression in
normal marginal zone B cells (Figure 3F)
.
|
Similar to the BCL10 expression pattern in normal germinal center B cells, 19 of 21 follicular lymphomas expressed the protein in the cytoplasm and the remaining two expressed the protein in both the nucleus and cytoplasm in 30 and 80% of tumor cells, respectively. Mantle cell lymphomas showed either weak (14 of 17, 82%) or no (3 of 17, 18%) BCL10 expression. As the expression level is low, the subcellular localization of BCL10 protein in this lymphoma subtype could not be confidently determined. All diffuse large B-cell lymphomas of mucosal sites showed weak cytoplasmic BCL10 expression. Of nodal diffuse large B-cell lymphomas, 14 of the18 cases expressed BCL10 protein in the cytoplasm and the remaining four cases expressed the protein in both the nucleus and cytoplasm in 10 to 20% of tumor cells.
| Discussion |
|---|
|
|
|---|
The BCL10 protein was also differentially expressed at various stages of T-cell maturation in thymus. At an early stage, the T cells, which reside in the cortex and undergo T-cell receptor rearrangements and positive selection, lacked BCL10 expression; while at a late stage, T cells move to the medulla and undergo negative selection to delete those highly reactive to MHC and self peptides,19 expressed BCL10 in the cytoplasm. These data suggest that BCL10 may also play a role during T-cell maturation.
The level of BCL10 expression and its subcellular localization required
for its pro-apoptosis and NF-
B activation in vivo are
unknown and are likely to be different. The differential BCL10
expressions among various B-cell populations of the B-cell follicle may
reflect their individual requirements for different BCL10 functional
properties. In view of its overall pro-apoptotic activity as shown in
in vitro assays and high expression in germinal center
centroblasts, BCL10 may sensitize these cells to apoptotic signalings
and help to eliminate those producing low-affinity immunoglobulins. A
similar role of BCL10 may be expected in the medulla of the thymus,
deleting autoreactive T cells. These speculations are strongly
supported by findings in BCL10 transgenic mice. In these transgenic
mice, both the spleen and thymus were severely atrophic at postnatal
stages because of high levels of apoptosis of both B and T cells,
respectively.20
Among other normal tissues, BCL10 protein was found by immunohistochemistry only in breast but not in 22 other types of tissues examined. The lack of BCL10 protein expression in these normal tissues is intriguing. It is possible that BCL10 protein is expressed in these normal tissues but at a low level below the detection limit of the current immunohistochemical system. Alternatively, BCL10 protein expression may be tissue and cell type-specific.
One consequence of chromosomal translocations involving the immunoglobulin loci in lymphomagenesis is overexpression of the gene. High-level BCL10 expression was indeed observed in each of the four MALT lymphomas with t(1;14)(p22;q32). However, this observation is paradoxical, because under all conditions BCL10 has exhibited pro-apoptotic functions.3,4,6-10 The high-level expression of an apparently pro-apoptotic molecule in the context of an expected oncogenic translocation has been seen previously in the case of both BCL6 and c-myc, as both molecules can induce apoptosis under certain circumstances.21,22 In the case of c-myc, deregulated expression occurs in the presence of concurrent genetic abnormalities including either concurrent deregulation of BCL2 in follicular lymphoma or p53 mutation in the case of Burkitts lymphoma, which prevents c-myc-induced apoptosis and results in unchecked proliferation.23
The paradox of high-level BCL10 expression in MALT lymphoma may have a
number of explanations. First, the finding of pro-apoptotic and tumor
suppressor activities of BCL10 in in vitro experiments may
not truly reflect its biological behavior in vivo. As BCL10
only weakly promotes apoptosis in in vitro assays and also
activates NF-
B,3,4,6-10
BCL10 may well behave as an
antagonist to apoptosis in vivo in certain cellular
contexts. Secondly, mutation may convert the tumor suppresser gene into
an oncogene. In view of the contrasting biological activities between
the wild-type BCL10 and its truncated mutants, this model is
attractive. However, examination of the genomic DNA samples from three
MALT lymphomas with t(1;14)(p22;q32) showed only one case with
potentially pathogenic mutations.12
The consequences of
truncated BCL10 mutants from alternative RNA splicing and RNA editing
events in lymphomagenesis remain to be investigated.24
It
should be noted that the truncated forms of BCL10 predicted to arise
from alternative splicing would not be detected by any of the
monoclonal antibodies we have generated to date. Finally, the altered
subcellular localization of the BCL10 protein may explain the paradox.
Unlike their normal cell counterpart, the marginal zone B cell, which
expressed BCL10 only in the cytoplasm, each of the four MALT lymphomas
with t(1;14)(p22;q32) showed BCL10 expression in both the
nucleus and cytoplasm. It is possible that the nuclear BCL10 rather
than the cytoplasmic form confers the tumorigenic activity.
BCL10 nuclear expression was also seen in MALT lymphomas without t(1;14)(p22;q32) although at a much lower level. As these tumors were more often those with aggressive clinicopathological features, this prompted us to correlate nuclear BCL10 expression with proliferation markers. Tumors with nuclear BCL10 expression generally showed slightly higher Ki67 proliferative indices than those with only cytoplasmic BCL10, however, no statistical significance was found between the two groups. This may reflect that the number of cases examined was too small and that the effect of BCL10 deregulation on tumor cell proliferation is not strong enough to dramatically increase the tumor cell proliferative activity.
Unlike MALT lymphoma, both mantle cell and follicular lymphomas generally showed BCL10 expression patterns comparable to those seen in their normal cell counterparts, suggesting that deregulation of BCL10 expression is unlikely to be involved in the development of these tumors.
The mechanisms underlying the nuclear localization of BCL10 protein in malignant B cells are unclear. BCL10 nuclear expression was independent of both t(1;14)(p22;q32) and the level of protein expression. The findings that the frequency of nuclear BCL10 expression was 10 times as high as that of BCL10 gene mutation in MALT lymphoma suggest that events other than genomic mutations are responsible for the nuclear localization of the protein.12,13 BCL10 does not contain any known nuclear localization signals.25 The presence of nuclear BCL10 suggests that the protein may have functions other than apoptosis regulation. An isoform of ARC a CARD-containing protein has been shown to be involved in nucleolar RNA processing and the CARD of pro-caspase 2 has been shown to mediate nuclear transport indicating that at least some CARD-containing proteins may have unexpected functions.26,27
In summary, our results show differential expression of BCL10 among different B-cell populations of the B-cell follicle, indicating its importance in B-cell maturation. The subcellular localization of BCL10 was frequently altered in MALT lymphoma in comparison with its normal cell counterparts, suggesting that this may be important in lymphomagenesis. The strong BCL10 nuclear expression in a B-cell lymphoma is highly indicative of t(1;14)(p22;q32).
| Acknowledgements |
|---|
| Footnotes |
|---|
Supported by grants from the Cancer Research Campaign and the Leukaemia Research Fund.
Accepted for publication July 1, 2000.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
L. D. Sjo, S. Heegaard, J. U. Prause, B. L. Petersen, S. Pedersen, and E. Ralfkiaer Extranodal Marginal Zone Lymphoma in the Ocular Region: Clinical, Immunophenotypical, and Cytogenetical Characteristics Invest. Ophthalmol. Vis. Sci., February 1, 2009; 50(2): 516 - 522. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. Kuo, P.-Y. Yeh, L.-T. Chen, M.-S. Wu, C.-W. Lin, K.-H. Yeh, Y.-S. Tzeng, J.-Y. Chen, P.-N. Hsu, J.-T. Lin, et al. Overexpression of B cell-activating factor of TNF family (BAFF) is associated with Helicobacter pylori-independent growth of gastric diffuse large B-cell lymphoma with histologic evidence of MALT lymphoma Blood, October 1, 2008; 112(7): 2927 - 2934. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nakamura, H. Ye, C. M Bacon, A. Goatly, H. Liu, A. H Banham, R. Ventura, T. Matsumoto, M. Iida, Y. Ohji, et al. Clinical impact of genetic aberrations in gastric MALT lymphoma: a comprehensive analysis using interphase fluorescence in situ hybridisation Gut, October 1, 2007; 56(10): 1358 - 1363. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zeng, L. Di, G. Fu, Y. Chen, X. Gao, L. Xu, X. Lin, and R. Wen Phosphorylation of Bcl10 Negatively Regulates T-Cell Receptor-Mediated NF-{kappa}B Activation Mol. Cell. Biol., July 15, 2007; 27(14): 5235 - 5245. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-S. Chuang, H. Liu, H. Ye, J. I Martin-Subero, R. Siebert, and W.-T. Huang Pulmonary mucosa-associated lymphoid tissue lymphoma with strong nuclear B-cell CLL/lymphoma 10 (BCL10) expression and novel translocation t(1;2)(p22;p12)/immunoglobulin {kappa} chain-BCL10 J. Clin. Pathol., June 1, 2007; 60(6): 727 - 728. [Full Text] [PDF] |
||||
![]() |
C. M Bacon, M.-Q. Du, and A. Dogan Mucosa-associated lymphoid tissue (MALT) lymphoma: a practical guide for pathologists J. Clin. Pathol., April 1, 2007; 60(4): 361 - 372. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Lobry, T. Lopez, A. Israel, and R. Weil Negative feedback loop in T cell activation through I{kappa}B kinase-induced phosphorylation and degradation of Bcl10 PNAS, January 16, 2007; 104(3): 908 - 913. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Suh, J. M. Crutchley, A. Koochek, A. Ryscavage, K. Bhat, T. Tanaka, A. Oshima, P. Fitzgerald, and S. H. Yuspa Reciprocal Modifications of CLIC4 in Tumor Epithelium and Stroma Mark Malignant Progression of Multiple Human Cancers Clin. Cancer Res., January 1, 2007; 13(1): 121 - 131. [Abstract] [Full Text] [PDF] |
||||
![]() |
M-Q Du and J C Atherton Molecular subtyping of gastric MALT lymphomas: implications for prognosis and management. Gut, June 1, 2006; 55(6): 886 - 893. [Full Text] [PDF] |
||||
![]() |
M. Baens, S. Fevery, X. Sagaert, H. Noels, S. Hagens, V. Broeckx, A. D. Billiau, C. De Wolf-Peeters, and P. Marynen Selective Expansion of Marginal Zone B Cells in E{micro}-API2-MALT1 Mice Is Linked to Enhanced I{kappa}B Kinase {gamma} Polyubiquitination. Cancer Res., May 15, 2006; 66(10): 5270 - 5277. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nakagawa, Y. Hosokawa, M. Yonezumi, K. Izumiyama, R. Suzuki, S. Tsuzuki, M. Asaka, and M. Seto MALT1 contains nuclear export signals and regulates cytoplasmic localization of BCL10 Blood, December 15, 2005; 106(13): 4210 - 4216. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Salar, B. Bellosillo, S. Serrano, and C. Besses Persistent Residual Disease in t(11;18)(q21;q21) Positive Gastric Mucosa-Associated Lymphoid Tissue Lymphoma Treated With Chemotherapy or Rituximab J. Clin. Oncol., October 10, 2005; 23(29): 7361 - 7362. [Full Text] [PDF] |
||||
![]() |
M. T. Tian, G. Gonzalez, B. Scheer, and A. L. DeFranco Bcl10 can promote survival of antigen-stimulated B lymphocytes Blood, September 15, 2005; 106(6): 2105 - 2112. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Farinha and R. D. Gascoyne Molecular Pathogenesis of Mucosa-Associated Lymphoid Tissue Lymphoma J. Clin. Oncol., September 10, 2005; 23(26): 6370 - 6378. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Bertoni and E. Zucca State-of-the-Art Therapeutics: Marginal-Zone Lymphoma J. Clin. Oncol., September 10, 2005; 23(26): 6415 - 6420. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Zucca and F. Bertoni Another Piece of the MALT Lymphomas Jigsaw J. Clin. Oncol., August 1, 2005; 23(22): 4832 - 4834. [Full Text] [PDF] |
||||
![]() |
K.-H. Yeh, S.-H. Kuo, L.-T. Chen, T.-L. Mao, S.-L. Doong, M.-S. Wu, H.-C. Hsu, Y.-S. Tzeng, C.-L. Chen, J.-T. Lin, et al. Nuclear expression of BCL10 or nuclear factor kappa B helps predict Helicobacter pylori-independent status of low-grade gastric mucosa-associated lymphoid tissue lymphomas with or without t(11;18)(q21;q21) Blood, August 1, 2005; 106(3): 1037 - 1041. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. Kuo, L.-T. Chen, K.-H. Yeh, M.-S. Wu, H.-C. Hsu, P.-Y. Yeh, T.-L. Mao, C.-L. Chen, S.-L. Doong, J.-T. Lin, et al. Nuclear Expression of BCL10 or Nuclear Factor Kappa B Predicts Helicobacter pylori-Independent Status of Early-Stage, High-Grade Gastric Mucosa-Associated Lymphoid Tissue Lymphomas J. Clin. Oncol., September 1, 2004; 22(17): 3491 - 3497. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Holzmann, H. Kohlhammer, C. Schwaenen, S. Wessendorf, H. A. Kestler, A. Schwoerer, B. Rau, B. Radlwimmer, H. Dohner, P. Lichter, et al. Genomic DNA-Chip Hybridization Reveals a Higher Incidence of Genomic Amplifications in Pancreatic Cancer than Conventional Comparative Genomic Hybridization and Leads to the Identification of Novel Candidate Genes Cancer Res., July 1, 2004; 64(13): 4428 - 4433. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Pileri, P. L. Zinzani, P. Went, A. Pileri Jr, and M. Bendandi Indolent lymphoma: the pathologist's viewpoint Ann. Onc., January 1, 2004; 15(1): 12 - 18. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Shen, A. C. T. Liang, L. Lu, W. Y. Au, K.-Y. Wong, P.-C. Tin, K.-W. Chan, K.-H. Ko, Y.-W. Chen, S.-L. Beh, et al. Aberrant BCL10 nuclear expression in nasal NK/T-cell lymphoma Blood, August 15, 2003; 102(4): 1553 - 1554. [Full Text] [PDF] |
||||
![]() |
H. Ye, H. Liu, A. Attygalle, A. C. Wotherspoon, A. G. Nicholson, F. Charlotte, V. Leblond, P. Speight, J. Goodlad, A. Lavergne-Slove, et al. Variable frequencies of t(11;18)(q21;q21) in MALT lymphomas of different sites: significant association with CagA strains of H pylori in gastric MALT lymphoma Blood, August 1, 2003; 102(3): 1012 - 1018. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Sanchez-Izquierdo, G. Buchonnet, R. Siebert, R. D. Gascoyne, J. Climent, L. Karran, M. Marin, D. Blesa, D. Horsman, A. Rosenwald, et al. MALT1 is deregulated by both chromosomal translocation and amplification in B-cell non-Hodgkin lymphoma Blood, June 1, 2003; 101(11): 4539 - 4546. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y Kaneko, S Sakurai, M Hironaka, S Sato, S Oguni, Y Sakuma, K Sato, K Sugano, and K Saito Distinct methylated profiles in Helicobacter pylori dependent and independent gastric MALT lymphomas Gut, May 1, 2003; 52(5): 641 - 646. [Abstract] [Full Text] |
||||
![]() |
M. Okabe, H. Inagaki, K. Ohshima, T. Yoshino, C. Li, T. Eimoto, R. Ueda, and S. Nakamura API2-MALT1 Fusion Defines a Distinctive Clinicopathologic Subtype in Pulmonary Extranodal Marginal Zone B-Cell Lymphoma of Mucosa-Associated Lymphoid Tissue Am. J. Pathol., April 1, 2003; 162(4): 1113 - 1122. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ye, H. Liu, M. Raderer, A. Chott, A. Ruskone-Fourmestraux, A. Wotherspoon, M. J. S. Dyer, S.-S. Chuang, A. Dogan, P. G. Isaacson, et al. High incidence of t(11;18)(q21;q21) in Helicobacter pylori-negative gastric MALT lymphoma Blood, April 1, 2003; 101(7): 2547 - 2550. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sanchez-Beato, A. Sanchez-Aguilera, and M. A. Piris Cell cycle deregulation in B-cell lymphomas Blood, February 15, 2003; 101(4): 1220 - 1235. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Maes, A. Demunter, B. Peeters, and C. De Wolf-Peeters BCL10 mutation does not represent an important pathogenic mechanism in gastric MALT-type lymphoma, and the presence of the API2-MLT fusion is associated with aberrant nuclear BCL10 expression Blood, February 15, 2002; 99(4): 1398 - 1404. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Liu, H. Ye, A. Dogan, R. Ranaldi, R. A. Hamoudi, I. Bearzi, P. G. Isaacson, and M.-Q. Du T(11;18)(q21;q21) is associated with advanced mucosa-associated lymphoid tissue lymphoma that expresses nuclear BCL10 Blood, August 15, 2001; 98(4): 1182 - 1187. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. L. Harris, H. Stein, S. E. Coupland, M. Hummel, R. D. Favera, L. Pasqualucci, and W. C. Chan New Approaches to Lymphoma Diagnosis Hematology, January 1, 2001; 2001(1): 194 - 220. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Cavalli, P. G. Isaacson, R. D. Gascoyne, and E. Zucca MALT Lymphomas Hematology, January 1, 2001; 2001(1): 241 - 258. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Bertin, Y. Guo, L. Wang, S. M. Srinivasula, M. D. Jacobson, J.-L. Poyet, S. Merriam, M.-Q. Du, M. J. S. Dyer, K. E. Robison, et al. CARD9 Is a Novel Caspase Recruitment Domain-containing Protein That Interacts With BCL10/CLAP and Activates NF-kappa B J. Biol. Chem., December 22, 2000; 275(52): 41082 - 41086. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Bertin, L. Wang, Y. Guo, M. D. Jacobson, J.-L. Poyet, S. M. Srinivasula, S. Merriam, P. S. DiStefano, and E. S. Alnemri CARD11 and CARD14 Are Novel Caspase Recruitment Domain (CARD)/Membrane-associated Guanylate Kinase (MAGUK) Family Members that Interact with BCL10 and Activate NF-kappa B J. Biol. Chem., April 6, 2001; 276(15): 11877 - 11882. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wang, Y. Guo, W.-J. Huang, X. Ke, J.-L. Poyet, G. A. Manji, S. Merriam, M. A. Glucksmann, P. S. DiStefano, E. S. Alnemri, et al. CARD10 Is a Novel Caspase Recruitment Domain/Membrane-associated Guanylate Kinase Family Member That Interacts with BCL10 and Activates NF-kappa B J. Biol. Chem., June 8, 2001; 276(24): 21405 - 21409. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |