| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Division of Gastroenterology,*
and the
Department of Oncology,§
Johns Hopkins
University School of Medicine, Baltimore, Maryland; and the Institute
of General and Experimental Pathology,
and
Institute of Clinical Pathology,
the
University of Vienna, Vienna, Austria
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1C) is
elevated in colon cancer. The aim of these experiments was to verify
that the mRNA for 1C was significantly increased in
tumors of two separate populations of patients when compared to normal
adjacent mucosa. The second aim was to measure the distribution of
1C using immunocytochemistry in normal human colon and
in colon cancer and to determine what might regulate the channel
expression. Biopsies were taken from patients with various stages of
colon cancer and nearby normal mucosa were used as control. RNA was
prepared and mRNA level measured by semiquantitative reverse
transcriptase-polymerase chain reaction. The mRNA of the calcium
channel was compared with other markers including ß-actin. The mRNA
for 1C was increased significantly in colon cancers
compared to nearby adjacent mucosa. Using confocal microscopy
1C was localized mainly at the apical membrane in the
surface epithelium of normal human colon with less distribution on the
lateral and basal membranes. The channel was localized on the lateral
and basal membranes in crypt cells. Calcium channel localization
appeared to be nearer nuclei in colon cancer samples, in part
because of the smaller size of the cells. Likewise, cultured
Caco-2 and T84 cells showed a membrane distribution. Western blotting
indicated that 1C protein was increased in nonconfluent
cultures of colonic carcinoma cells compared to confluent cells and
immunocytochemistry confirms that there is more calcium channel protein
in cells that are nonconfluent. We conclude that the increase in mRNA
of 1 subunit of the cardiac isoform of the L-type
calcium channel may be a useful marker of colon cancer compared to
other markers because the increase is large and this increase can be
documented on small samples using a simple semiquantitative reverse
transcriptase-polymerase chain reaction. We found that
1C protein is increased when colonic cells are
nonconfluent or dividing which may account for the increase in
cancer.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1 subunit of the cardiac
isoform of the voltage-gated L-type calcium channel
(1C). L-type calcium channels mediate
depolarization-dependent entry of Ca2+ ions
across the plasma membrane into cells.2
Calcium channel
blockers such as nitrendipine, verapamil, and
d-cis-diltiazem block L-type calcium channels.3
The L-type calcium channel is composed of five subunits, including the
1 subunit which contains the ion conduction
pore and the drug-binding sites, and several other subunits,
2, ß, 
, and 
which primarily modify
channel gating or affinity.4
The
1 subunit of L-type calcium channels has three
major isoforms found in skeletal muscle (1S);
in cardiac muscle (1C); and in brain,
pancreas, and GH3 pituitary cells
(1D).5
This channel is also found
in nonexcitable cells6
where it participates in hormone
signaling pathways.7-9
The immunocytological distribution
of calcium channels in epithelial cells such as colonic mucosa has not
been studied, although there is physiological evidence that calcium
channels mediate calcium entry in colonic cell
lines.10-12
Although pharmacological evidence suggests
the presence of L-type calcium channels in colonic epithelial
cells,12
it is not clear what regulates expression of the
channel. The progression of colon cancer changes the expression of
numerous genes,13
and the increased growth in colon cancer
is often associated with enhanced mitogenic signals such as epidermal
growth factor and epidermal growth factor
receptor14,15
and their downstream signaling kinase
c-src.16
These signaling pathways may in turn affect the
activity or expression of L-type calcium channels that are modulated by
c-src.17
The aim of this study was to determine
whether the mRNA expression of 1C is elevated
in colon cancer when assayed by reverse transcriptase-polymerase chain
reaction (RT-PCR) on samples from two different patient populations.
Immunocytochemical localization was assessed in colon cancer compared
to normal human colonic mucosa and protein expression was measured in
human carcinoma cells. |
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
All cells were grown in T75 flasks following standard culture procedures or according to American Type Culture Collection (ATCC) methods if received from this source. HT29C, T84, HCT 116, and Caco-2 cells are human colonic carcinoma cell lines. HT29C cells were cultured in Dulbecco’s minimal essential medium, 10% fetal bovine serum, and 10 µg/ml of transferrin. T84 cells were cultured in a 50:50 mixture of Dulbecco’s minimal essential medium/Ham’s F12 and 10% fetal bovine serum. Caco-2 cells were grown in Dulbecco’s minimal essential medium with 10% fetal bovine serum and 1% nonessential amino acids. HCT 116 cells p53+/+ cells (ACT CCL247) were grown in McCoy’s medium with 10% fetal bovine serum. HCT 116 p53-/- that had the p53 gene removed by homologous recombination were a gift from B. Vogelstein (Johns Hopkins University, Baltimore, MD). WI-38 (CCL 75 from ATCC) a human fetal lung fibroblast cell line was grown in Eagle’s basal medium and 10% fetal bovine serum. The adult human breast fibroblast cell line 966-SK obtained from breast (CRL 1881 from ATCC) was grown in Eagle’s minimal essential medium with Earle’s balanced salt solution, 0.1 mmol/L of nonessential amino acids, and 10% fetal bovine serum. All culture media also contained 50 U/ml penicillin and 50 µg/ml of streptomycin. For immunohistochemistry or some Western blot experiments as indicated, cells were grown on high-pore density polyethylene terephtalate track-etched transwells (Beckton Dickinson Falcon, Franklin Lakes, NJ) coated with collagen type IV (Sigma Chemical Co., St. Louis, MO), Vitrogen (Cohesion Technologies Inc., Paulo Alto, CA), bovine serum albumin, and fibronectin.
Primers
The primers for amplifying each PCR product were taken from the
nucleotide sequence of the mRNA. All primers and sequences between them
were checked using a BLAST nucleotide search at the National Center for
Biotechnology Information for specificity only of the desired
transcript. For 1C the forward primer
TGAACAGCGACGGGACAGTCATG bp 4650 to 4673 and the reverse primer
GAACGTGGCGTAGAACTTGCCAA bp 4900 to 4923, were designed using sequence
from Accession No. Z74996, to give an expected PCR product of 217 bp.
The area chosen for the second primer was amino acids SQRNALSL, a
sequence that is not shared by 1D or
1S. The amino acid sequences for the same area
for 1D or 1S are
AKNTTIAL and PKKDIVQI, respectively. Primers for the vitamin D receptor
(VDR) were forward primer bp 1193 to 1215 TCCAACACACTGCCAGACGTACAT and
the reverse primer was bp 1723 to 1701 ATCAGTCAGCAGCCACTTAGGCA, were
designed from Accession No. J03258 to give an expected PCR product of
530 bp. For cytokeratin 20 (CK20), the forward primer was
GAGCAGTCCAACTCCAAACTTGA bp 19 to 41 and the reverse primer was
TTCTTCTGGGCCATGACTTCATA bp 503 to 481, designed from Accession No.
X73502 to give an expected PCR product size of 484 bp. For hepatocyte
growth factor (HGF), the forward primer was GCCTGAAAGATATCCCGACA bp 810
to 829 and the reverse primer was TTCCATGTTCTTGTCCCACA bp 1332 to 1313
designed from Accession No. M60718, to gave an expected PCR product
size of 551 bp. For ß-actin, the forward primer was
TACGCCAACACAGTGCTGTCTGG bp 890 to 912 and the reverse primer was
TACTCCGCTTGCTGATCCACAT bp 1095 to 1073, designed using Accession No.
AB004047, to give an expected PCR product size of 206 bp. This primer
was designed to cross a 112-bp intron that gave a 318-bp band if there
was genomic contamination of the sample. None of the samples showed the
318-bp band for actin.
RNA Samples, RNA and cDNA Preparation, and RT-PCR
RNA was made from biopsies of colon cancer tissue or rectal tissue
and the adjacent normal mucosal tissue: IRB 85-03-05-03 for patients of
Johns Hopkins University and for the Vienna patients consent from the
Ethics Commission of the University of Vienna Medical School was
obtained before experimentation. The grade of differentiation, the
stage by TNM system, and the percentage of cancer area in the total
tissue biopsy, was determined from sections made from the same tissue
samples (Table 1)
. Tumor samples were
removed immediately into TRIzol (Life Technologies, Inc., Gaithersburg,
MD) then total RNA was isolated following the TRIzol protocol. Total
RNA and oligo (dT) primer were preheated at 65°C for 5 minutes, and
then buffer, dNTP, RNase inhibitor, and M-MLV reverse
transcriptase (Life Technologies, Grand Island, NY) were added at
42°C for 2 hours. Each PCR reaction of 50 µl was composed of 1 µl
of cDNA made from 195 ng of total RNA (group A samples) or 47 ng (group
B samples), 1x PCR buffer, pH 8.5, with a 1.5 or 2.5 mmol/L
Mg2+ Hot Wax Bead (Invitrogen, San Diego, CA),
0.2 mmol/L dATP, dCTP, dGTP, dTTP, 2.5 units of Taq DNA
Polymerase (Life Technologies) and 0.5 µmol/L primers, except the
ß-actin primers which were used at 0.1 µmol/L. The DNA Thermal
Cycler 480 (Perkin-Elmer, Norwalk, CT) was programmed for 30 (VDR,
ß-actin), 34 (HGF), and 35 (1C, CK20)
cycles. The annealing temperatures were 55°C (HGF), 60°C (VDR), or
65°C (1C, CK20, ß-actin). The annealing
temperature was chosen from the Tm of the primers and the optimal
Mg2+ and pH were determined using an optimization
kit (Invitrogen). Only one band of the expected size for each PCR
product was found. Each PCR product was extracted from the gel and
sequenced by ABR PRISM 377 DNA sequencer (Perkin-Elmer). All sequences
matched with expected sequences. Water blank and non-RT samples were
used as negative control. Only RT-PCR with negative controls that did
not show contaminating bands were used for data analysis. For
simplicity these controls are not shown in the Figures.
|
1C, CK20, ß-actin, and VDR. We used the
human fibroblast cell line WI-38 for amplification of HGF. Amplified
RT-PCR products were separated by electrophoresis on 2% agarose gel
and were stained with ethidium bromide. The area and intensity of the
gel bands were determined from scans of photographs of gels done at the
same time and under same conditions using Scion Image (Scion
Corporation, Frederick, MD). Statistics
The data shown are means ± SD. A paired t-test was used to compare the mean values. A P value of <0.05 was considered statistically significant.
Immunocytochemistry
Specimens of human colon cancer obtained from eight cancer
patients and normal colonic mucosa obtained from three patients without
colon cancer were graded by pathological examination. Biopsy sections
were heated to melt the paraffin, then soaked in xylenes, followed by
ethanol descending, then rinsed in phosphate-buffered saline (PBS)
followed by 0.1% Tween 20 in PBS, and ending with a PBS wash. Sections
were heated in a 10 mmol/L sodium citrate buffer (adjusted to pH 6.0)
to unmask the antigen. Sections were washed with PBS, then blocked with
PBS containing 5% normal goat serum and 0.3% Triton X-100. T84 cells
or Caco-2 cells were grown on coated transwells, then washed with PBS,
and fixed with 4% paraformaldehyde in 0.1 mol/L phosphate buffer for
30 minutes on ice. The calcium channel 1C
subunit antibody used for immunohistochemistry was obtained from
Alomone Labs Ltd. (Jerusalem, Israel). This affinity-purified, rabbit
polyclonal antibody was raised against a peptide made from amino acids
818 to 835 (TTKINMDDLQPSENEDKS) of rat 1C
subunit and the corresponding amino acids in the human
1C subunit are ATKINMDDLQPNENEDKS. A BLAST
amino acid search at the National Center for Biotechnology Information
site revealed that this amino acid sequence was specific for
1C and a similar sequence was not found in any
other voltage-gated calcium channel including
1D, 1S, N, R, or P/Q
types. The primary antibody was diluted 1:20 or 1:50 with 0.1% bovine
serum albumin and 0.01% sodium azide in PBS. To determine specificity
of staining, 1 µgm of the antigenic peptide was added per
µgm of primary antibody according to the directions of the supplier.
After washing with PBS, the section was incubated with the secondary
antibody, Cy3-goat anti-rabbit IgG (Jackson ImmunoResearch, West Grove,
PA) diluted 1:100 or 1:200 with PBS. Sections were then washed with PBS
then incubated with the nuclear stain Hoechst 33324 (Molecular Probes,
Eugene, OR) diluted 1:1000 with PBS. Double-fluorescence sections were
analyzed with the laser-scanning confocal microscope (LSM 410; Carl
Zeiss, Oberkochen, Germany).
Western Blot
The affinity-purified, rabbit polyclonal antibody against the
1C subunit and the antigenic fusion protein
that were used for Western blotting were obtained from Alomone Labs
Ltd. This antibody was raised against the N terminal amino acids (1 to
46) MLRAL VQPAT PAYQP LPSHL SAETE STCKG TVVHE AQLNH FYIAP G of the
cardiac 1C subunit. Rat heart was used as a
positive control tissue. Whole rat heart was quickly homogenized at
4°C with a polytron PT10 (Kinematica AG, Switzerland) in RIPA buffer
(1% Nonidet P-40, 0.5% sodium deoxycholate, and 0.1% sodium dodecyl
sulfate in PBS) containing 5 mmol/L ethylenediaminetetraacetic acid, 1
mmol/L ß-glycerol phosphate, 1 mmol/L L-phenylalanine, 1
mmol/L sodium orthovanadate, 50 mmol/L sodium fluoride, and the
following protease inhibitors: pepstatin A, 2 µg/ml; leupeptin, 10
µg/ml; aprotinin, 10 µg/ml; elastinal, 2 µg/ml; benzamidine, 0.5
mg/ml; calpain inhibitor peptide, 10 µg/ml; and 1 mmol/L
phenylmethane-sulfonyl fluoride, 0.4 mmol/L iodoacetic acid, 2.5 mmol/L
phenanthroline, and 0.1 mmol/L
N-tosyl-L-phenylalanine chlormethyl
ketone (all from Sigma Chemical Co.). The homogenate was lysed on ice
for 1 hour and centrifuged at 15,000 x g for 20 minutes.
The protein in the supernatant was quantified with the bicinchoninic
acid protein assay kit (Pierce, Rockford, IL) and stored at -80°C.
The cultured cells were scraped into the RIPA lysis buffer and
homogenized by passing through a 26-gauge needle 15 times. The
homogenate was lysed on ice for 1 hour and centrifuged at 2,000 x
g for 20 minutes. The supernatant protein was quantified and
stored as described above. The cell lysates, 100 µg of heart, T84, or
HCT cells, were mixed with Laemmli sample buffer (Bio-Rad, Hercules,
CA) and incubated at room temperature for 60 minutes. After separating
by 5% sodium dodecyl sulfate-polyacrylamide gel electrophoresis,
proteins were transferred to polyvinylidene sulfonyl fluoride
membranes (Bio-Rad) or supported nitrocellulose membranes in
Tris/glycine transfer buffer (Bio-Rad) containing 5% methanol and
0.014% sodium dodecyl sulfate. Membranes were blocked with 5% nonfat
milk in Tris-buffered saline containing 0.05% Tween 20 for 1 hour at
room temperature and then were incubated with primary antibody at 3
µg/ml diluted with blocking buffer overnight. The membrane was washed
three times for 10 minutes each with Tris-buffered saline containing
0.05% Tween 20 and incubated with horseradish peroxidase-conjugated
donkey anti-rabbit antibody (Amersham Life Science, Arlington Heights,
IL) diluted 1:5,000 or 1:10,000 with blocking buffer for 1 hour at room
temperature. After washing, blots were visualized by the Supersignal
West Dura extended duration substrate (Pierce). The fusion protein used
to generate this antibody was pre-incubated with primary antibody at 15
µg/ml to determine the specificity of the labeling.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The correlation between intensity of PCR bands and PCR cycles
using 1C primer is demonstrated in Figure 1A
. This figure indicates that a linear
range of the RT-PCR is achieved between 33 cycles and 37 cycles,
therefore 33 cycles was chosen as the semiquantitative range. Figure 1B
indicates the correlation between the intensity of the RT-PCR bands and
amount of total RNA added to make the cDNA that was used in the
reactions. A plateau phase was reached at 400 ng of total RNA therefore
<200 ng of RNA was chosen for making the cDNA per PCR reaction. This
correlation was performed for all of the primer pairs and similar
results were obtained.
|
Biopsies of colonic tissue consist of several types of cells
including epithelial and fibroblast cells, nerve ganglia, as well as
endothelial and smooth muscle cells of blood vessels. The relative
abundance of markers was estimated in three colon cancer cell lines
(Caco-2, T84, HT29) and two fibroblast cell lines (WI-38, 966-SK) is
shown in Figure 2
. Cytokeratin 20 is a
marker of relatively differentiated intestinal epithelial
cells.18
The distribution along the villus tip axis has
been described.18,19
CK20 is found only in epithelia but
not in fibroblasts (Figure 2)
, therefore we used this as a marker of
differentiated epithelial cells. HGF is produced by intestinal stromal
cells causing increases in intestinal epithelial cell
proliferation.20
HGF may be a factor in the pathogenesis
of cancer21
and HGF increased in the serum of patients
with advanced colon cancer.22
HGF was verified as a
fibroblast marker using this RT-PCR as it was not expressed in colon
cells, but was abundantly expressed in the two fibroblast cell lines
(Figure 2)
. By estimating the fibroblast compartment we could determine
whether increases in calcium channel mRNA might correlate to changes in
fibroblasts or epithelial cells. Fibroblasts were previously reported
to have expression of 1C.23
mRNA
expression of 1C was
present in colon cells and in the fibroblast cells (Figure 2)
. The mRNA
of VDR is expressed in both fibroblasts and colonic epithelial cells
when measured by RT-PCR (Figure 2)
. VDR was previously reported to be
increased in colon polyps and mid-stage tumors where the protein was
found mainly to be expressed in epithelial cells.24
ß-actin was expressed in both epithelial and fibroblast cells in
equal abundance (Figure 2)
. ß-actin was used to standardize the
amount of RNA used in each RT-PCR reaction. Because the amount of
nerves and blood vessels were low, markers for these tissue types were
not used.
|
To compare the mRNA expression in the paired colon/rectum cancer
biopsies with the biopsies of adjacent tissue, we designed primers to
1C across exon 41, to contain the TAG sequence
used in the reported SAGE analysis.1
Figure 3
shows the results of mRNA expression
from Austrian patients (group A) and in United States patients (group
B) for the chosen markers 1C, VDR, CK20, HGF,
and ß-actin. Table 2
shows that
the mRNA expression of 1C alone or the
1C/ß-actin ratio was significantly higher in
colon cancer compared to normal tissue in group A alone, in group B
alone, or in groups A and B taken together (total). The
1C/CK20 ratio was also elevated in cancer
tissue from group B alone or groups A and B together (total), relative
to control tissues. The expression of CK20 was previously
reported1
to be lower in colon cancer and this was found
again in our analysis of group A, but in group B this marker was more
variable then in group A and did not show a statistical decrease. Only
the two most advanced tumors of group A, T3N2M0 and T4N2M0, showed
decreased CK20 suggesting that this is only a useful marker of colon
cancer progression if the samples are in later stages of tumor
progression. In this study, the expression of HGF mRNA was
statistically increased in five of six tumor samples from group A
compared to adjacent normal mucosa. Although there was also an increase
in HGF in five of seven of the tumor samples from group B, the increase
was not statistically different. HGF mRNA was increased in group A
samples that had a greater node index than the biopsies taken from
patients in group B suggesting that HGF may be an indicator of lymph
node invasion. We found that VDR mRNA was elevated in cancer from group
A when compared to the adjacent mucosa, but these changes were not
statistically significant because of the variability in the level of
VDR in the samples. However in five of six tumor samples VDR is
increased compared to the adjacent normal tissue. Likewise VDR mRNA in
group B United States patients was not statistically increased in tumor
samples compared to normal adjacent mucosal samples. However, VDR was
elevated in the two late-stage tumor samples compared to normal colon
samples from these patients. The mRNA for VDR had the greatest
variation of any marker measured. There was no significant difference
in the ß-actin marker between cancer and normal control in either
group.
|
|
The pattern of staining and localization in normal human colon,
and rat or mouse colon (not shown) were the same. Because the staining
was completely displaced by the antigen peptide in all three species,
we concluded that the staining was specific to
1C. There was no staining of the secondary
antibody alone (not shown). Figure 4
shows the immunolocalization of 1C in normal
human colonic tissues. The most intense staining of
1C was localized to the colonic epithelial
cells as shown by the intense red staining in this layer compared to
the stromal layer which is mainly green as a result of the nuclear
stain (Figure 4A)
. The red florescent staining of the secondary
antibody was negligible, when the primary antibody to the calcium
channel was displaced by peptide (Figure 4B)
. The epithelial layer can
clearly be distinguished by the single row of regular nuclei (green)
lining the crypts (Figure 4B)
. Both the absorptive, surface epithelial
cells (Figure 4C)
and crypt mucus-secreting cells (Figure 4D)
showed
strong staining at the cell membranes, but staining at the apical
aspect of the surface cells (Figure 4C)
was much stronger and reached
deeper into the cytoplasm 
10 µm, than the staining of mucus
secreting cells (Figure 4D)
. There was no staining around the nuclei or
above the nuclei in surface epithelial cells. The mucus secreting cells
in the mid-crypt region, which have nuclei at the basal aspect of the
cell, had moderate diffuse stain for the calcium channel over the
nuclei. The staining of deep crypt cells was stronger than that of the
mucus secreting cells with more staining at the apical membrane and a
greater proportion of the staining over the nuclei than in the
mid-crypt cells (Figure 4E)
. The parasympathetic ganglionic nerves were
moderately stained (Figure 4F)
. Strong staining of endothelial cells of
blood vessels was also evident (Figure 4G)
. There was also staining in
the smooth muscle (Figure 4H)
and stromal fibroblast cells (Figure 4, C and D)
. These findings were the same in all of the normal colonic
sections from three patients.
|
1C in colon cancer biopsies from eight
patients shown in Table 3
, three of which are shown in Figure 5
. Figure 5, A and B
, shows strong
staining for 1C in a well-differentiated
adenocarcinoma (T2N0M0). Figure 5, C and D
, shows an example of
moderate staining for calcium channels in a moderately-differentiated
adenocarcinoma (T2N0M0). Figure 5, E and F
, shows weak staining in an
area of a poorly differentiated adenocarcinoma which had poor gland
formation (T3N2M0). Staining in other tumors (not shown) staged as
T2N0M0, T3N1M0, T3N2M0, T4N2M0, and T4N2M0 was moderate-strong to
strong. All of the cancer cells showed a major distribution of
1C in the cell membrane but some was also
located near the nucleus. There did not seem to be any difference in
the expression of the 1C protein when the
stage of the tumor was compared by the TNM system except the lower
expression in one cancer (Figure 5, C and D)
. Fibroblast cells and
smooth muscle cells were stained as in control cells (not shown).
|
|
Immunohistochemical staining of Caco-2 and T84 cells grown as
polarized monolayers on coated transwells 2 to 3 weeks postconfluent
were compared to the same cells grown under nonconfluent conditions on
coated transwells (15 to 20% confluent). As seen in Figure 6, A, B, D, and E
, the cellular
distribution of 1C staining (red) in confluent
T84 and Caco-2 cells is in both the basolateral and apical membranes.
Caco-2 cells seem to have a more apical distribution than T84 cells
(Figure 6E
compared to Figure 6B
). Figure 7
compares the intensity of staining in
nonconfluent T84 cells compared to 2-week postconfluent T84 cells. The
staining in the nonconfluent cells is very intense (Figure 7D)
and
appears to be in part in the cytoplasm (Figure 7E)
, however this is
difficult to determine because the cells are very flat compared to the
confluent cells shown in (Figure 7C)
. Of particular interest is the
dividing cell in the confluent cultures (Figure 7, B and C)
. The cell
clearly has two nuclei and the staining of 1C
is much more intense than that of nearby cells.
|
|
Western blotting of the human colon carcinoma T84 and HCT 116 cell
lines revealed a band near 220 kd (Figure 8A
, lanes 3, 5, and 6) that has a
slightly higher molecular weight than the major band for rat heart
(Figure 8A
, lane 1). The protein to which this antibody was raised
displaced the band in both heart and T84 cells (Figure 8A
, lanes 2, and
4) confirming that this was indeed the 1C
subunit of the L-type calcium channel. The level of
1C subunit was not a function of p53
expression (Figure 8A
, lane 5 versus lane 6), nor was it
increased by cAMP or decreased by indomethacin (not shown). When cells
were grown as 30 to 50% nonconfluent cultures before making a
whole-cell homogenate, the amount of 1C
subunit per total cell protein run on the gel or normalized to
glyceraldehyde-3-phosphate dehydrogenase (Figure 8
, bottom), was
increased (Figure 8B
, lanes 4 to 6) compared to cells that had been
confluent for >1 week (Figure 8B
, lanes 1 to 3). When the amount of
1C was compared to cells grown 2-weeks
postconfluent on transwells (Figure 8C
, lane 1), compared to cells
grown in flasks for 2-weeks postconfluent (Figure 8C
, lane 2) or 50%
confluent flask (Figure 8C
, lane 3), the latter condition showed the
greatest increase in channel protein.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1C subunit of
the calcium channel was statistically increased in colon cancer
compared to adjacent mucosa in biopsies obtained from two different
countries. This increase in calcium channel mRNA was present in all
stages of cancer from T2N0M0 to T4N2M0, although the increases appeared
larger in more advanced tumors. This increase in mRNA
1C subunit may be used as a marker of
transformation or proliferation in biopsy samples. Colon cancer cells
that have an increase in mRNA of the calcium channel may have increased
proliferation that is enhanced by epidermal growth factor as reported
for other cell types.9
Because epidermal growth factor and
epidermal growth factor receptors are increased in colon cancer, and
epidermal growth factor results in signaling via src
kinase,16
this pathway may enhance calcium influx because
calcium channels show increased signaling via src
kinase.17
Staining on the apical membrane of columnar absorptive cells on the
surface of human colon mucosa was stronger for
1C than mucus-secreting cells in the crypt.
Furthermore, the staining on the apical aspect of surface cells was
stronger than basolateral staining. The staining at the apical aspect
of the surface cells indicates that calcium channels are distributed in
the plasma membrane where they could mediate calcium entry, but the
channels are also found below the surface of cell extending
approximately 10 µm below the apical surface extending below
the terminal web. This distribution below the surface of the plasma
membrane suggests that these channels may be recirculated from the
plasma membrane in a subapical pool. Staining in the human colonic
crypt cells is mainly at the basal and lateral membranes. The
expression of 1C protein in colon cancer
appears to be increased per mass of tissue in part because of the
reduced size of the cells, which increases the surface to volume ratio.
Cancer biopsies show that the calcium channel is distributed more over
the nuclei than over the apical or basolateral parts of the cell, a
distribution similar to that found in the cells of the crypt
proliferation zone. Immunocytochemistry of T84 cells that are rapidly
growing shows less membrane association and more intracellular
distribution, whereas confluent cells show the calcium channel is
distributed primarily in the plasma membranes. Dividing T84 cells have
an increased intensity of staining that may be reflected in the colon
cancer cells.
Increases in intracellular calcium in most cell types are mediated by
the release of calcium from the endoplasmic reticulum via inositol
1,4,5-trisphosphate (IP3) and influx via voltage-dependent calcium
channels, receptor-operated calcium channels, and/or store-operated
calcium channels. L-type calcium channels have been identified
previously in HT29 colon cancer cells10
and neuroendocrine
cell lines25
using the patch-clamp technique. In colonic
cells, acetylcholine or ATP mediate both calcium influx and release of
calcium from internal stores.11,12
Blockers of calcium
channels inhibit calcium influx into colon cells.12
The
apical distribution of this channel in colonic surface cells suggests
that these channels might also participate in transepithelial calcium
absorption in the colon, however a substantial calcium absorption in
this segment occurs only after resection of the small
bowel.26
Increased calcium stimulates prostaglandin
synthesis by COX 1 and COX 227
an enzyme that is elevated
in colon cancer.28
We have shown
1C subunit protein is present in colonic T84
and HCT epithelial cells by both Western blotting and
immunocytochemistry. The abundance of the calcium channel protein is
not altered by cAMP or p53, but is increased in nonconfluent cells
compared to confluent cultures (Figure 8, B and C)
suggesting that
decreased tight junctions during growth may increase the expression of
this protein. However, these channels do not seem to contribute to cell
growth itself, because the L-type calcium channel agonist BAYK 8644
does not increase [3H]thymidine incorporation
or cell number. Both the agonist and antagonist inhibit growth
nonspecifically only at µmol/L concentrations that are well above
their relative affinities on L-type calcium channels (data not shown).
HGF/scatter factor acts through c-Met tyrosine kinase to increase cell
motility by disrupting cell-cell junctions thereby allowing cells to
disperse. When both groups were combined, HGF mRNA was still
significantly increased in colon cancer compared to normal adjacent
tissue, suggesting that like the 1C calcium
channel, increased mRNA of HGF is also a marker of cancer but the
difference between tumor and normal is not as large as that of
1C. This study confirms previous work that
found HGF greater in cancer tissue22
compared to normal
mucosa. Increases in mRNA for HGF in early stage tumor may suggest a
transformation of the stromal compartment early in tumor progression.
Because the c-Met receptor gene is also increased in colorectal
tumors,21
there appears a synergistic interaction between
the fibroblast and epithelial compartment that would result in
increased scattering of epithelial cells.
Cytokeratins are intermediate filaments that are thought to maintain the polarized integrity of intestinal cells by attaching at desmosomes to maintain cell-cell adhesion. CK20 is a major protein in mature enterocytes and goblet cells19 and was reported to be decreased in colon cancer1 but is also decreased in the adjacent mucosa from colon cancer patients.24 We found variable levels of CK20 mRNA in colon cancer samples compared to samples of normal mucosa from the same patient in group A, but group B had a small statistical decrease in CK20 mRNA in cancer tissue compared to the normal adjacent mucosa. A decrease in CK20 would support the view that tumors have fewer differentiated cells than normal colon tissue.
Low levels of vitamin D have been implicated as a risk for colon cancer
in men.29
Vitamin D inhibits proliferation of colon cancer
cells by arresting cells in the G0 phase of cell
cycle by a direct action on p21/WAF1/CIP1.30
Some vitamin
D analogs like EB 1089 cause less calcemia when compared to the
naturally occurring active analog 1,25-dihydroxyvitamin
D3 (1,25 D3), and are more
effective in arresting cell growth than the parent compound 1,25
D3.31
Colonocytes have an altered
metabolism of vitamin D that is
differentiation-dependent.32
The nuclear VDR increases
transcription of numerous genes, some of which are involved in
differentiation.33
It was previously reported that VDR
protein expression increased in early cancer stages in both tumors and
adjacent mucosa (T2-T3) when compared to the normal mucosa from
noncancer patients,24
but in advanced cancer (T3), VDR
decreases when compared to normal mucosa from noncancer
patients.24
This study indicates that any increases in VDR
mRNA in tumors were not statistically different. Because the amount of
VDR is regulated by 1,25 D3,34
it is possible that any
association of VDR with colon cancer may be masked by dietary factors,
including calcium intake and serum levels of 1,25 D3.
In summary we conclude that the increase in mRNA of
1 subunit of the cardiac isoform of the L-type
calcium channel may be a useful marker of colon cancer compared to
other markers because the increase is large and this increase can be
documented on small samples using a simple semiquantitative RT-PCR. The
1 subunit is very abundant when T84 cells are
nonconfluent or dividing compared to cells that are confluent when both
immunocytochemistry and Western blots are compared. We infer from this
that cancer cells may also have more 1C
protein because these cells are more likely to be in a state of cell
division.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Supported by National Institutes of Health Grant DK 43423 (to S. E. G.) and the National Institutes of Health Training Grant T32 DK07632 (to X.-T. W.). X.-T. W. and Y. N. contributed equally to this project. Some preliminary data were presented at the American Gastroenterology Association meetings in New Orleans, 1998.
Accepted for publication August 18, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1D isoform by parathyroid hormone. Proc Natl Acad Sci USA 1995, 92:10914-10918, 25 dihydroxycholecalciferol metabolism in human colon adenocarcinoma-derived Caco-2 cells: production of 1, 25-dihydroxy-3epi-cholecalciferol. Exp Cell Res 1998, 241:194-201[Medline]
This article has been cited by other articles:
 |
|
 |
|
  J. Wright, M. M. Morales, J. Sousa-Menzes, D. Ornellas, J. Sipes, Y. Cui, I. Cui, P. Hulamm, V. Cebotaru, L. Cebotaru, et al. Transcriptional adaptation to Clcn5 knockout in proximal tubules of mouse kidney Physiol Genomics, May 9, 2008; 33(3): 341 - 354. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Baumann, S. C. Fas, M. Giaisi, W. W. Muller, A. Merling, K. Gulow, L. Edler, P. H. Krammer, and M. Li-Weber Wogonin preferentially kills malignant lymphocytes and suppresses T-cell tumor growth by inducing PLC{gamma}1- and Ca2+-dependent apoptosis Blood, February 15, 2008; 111(4): 2354 - 2363. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Tsugawa, H. Ito, M. Ohshima, and Y. Okawa Cell adherence-promoted activity of Plesiomonas shigelloides GroEL J. Med. Microbiol., January 1, 2007; 56(1): 23 - 29. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Spitzner, J. Ousingsawat, K. Scheidt, K. Kunzelmann, and R. Schreiber Voltage-gated K+ channels support proliferation of colonic carcinoma cells FASEB J, January 1, 2007; 21(1): 35 - 44. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Natrajan, S. E. Little, J. S. Reis-Filho, L. Hing, B. Messahel, P. E. Grundy, J. S. Dome, T. Schneider, G. M. Vujanic, K. Pritchard-Jones, et al. Amplification and Overexpression of CACNA1E Correlates with Relapse in Favorable Histology Wilms' Tumors Clin. Cancer Res., December 15, 2006; 12(24): 7284 - 7293. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. B Walsh and G. E Parks Changes in cardiac myocyte morphology alter the properties of voltage-gated ion channels Cardiovasc Res, July 1, 2002; 55(1): 64 - 75. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U. Wenzel, S. Kuntz, S. Diestel, and H. Daniel PEPT1-Mediated Cefixime Uptake into Human Intestinal Epithelial Cells Is Increased by Ca2+ Channel Blockers Antimicrob. Agents Chemother., May 1, 2002; 46(5): 1375 - 1380. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Blumenstein, N. Kanevsky, G. Sahar, R. Barzilai, T. Ivanina, and N. Dascal A Novel Long N-terminal Isoform of Human L-type Ca2+ Channel Is Up-regulated by Protein Kinase C J. Biol. Chem., January 25, 2002; 277(5): 3419 - 3423. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. B. Hansen-Petrik, M. F. McEntee, B. Jull, H. Shi, M. B. Zemel, and J. Whelan Prostaglandin E2 Protects Intestinal Tumors from Nonsteroidal Anti-inflammatory Drug-induced Regression in ApcMin/+ Mice Cancer Res., January 1, 2002; 62(2): 403 - 408. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||
