| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |


From the Laboratoire de Neurophysiologie,*
Faculté de Médecine, Université Libre de Bruxelles,
Brussels, Belgium; the Service dAnatomie
Pathologique
and the Service de
Chirurgie Digestive,
Hôpital Beaujon,
Clichy, France; and the Department of
Pathology,§
Osaka University Graduate
School of Medicine, Osaka, Japan
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Gastrointestinal stromal tumors (GISTs) are the most common mesenchymal tumors of the human GI tract. A majority of GISTs are KIT-immunoreactive10,11 and several mutations in the juxtamembrane domain of KIT have been reported in GISTs. These mutations cause a constitutive, ligand-independent, activation of KIT responsible for their oncogenic potential.10,12 Furthermore, a germline mutation in the juxtamembrane domain of KIT gene has been identified in familial and multiple GISTs.13 We have studied a family with multiple GISTs and diffuse hyperplasia of ICCs-MP in the gut unaffected by GISTs. No mutation was found in the juxtamembrane domain, but a novel mutation in the kinase domain I was identified, and we further investigated the functional aspects of this mutant.
| Materials and Methods |
|---|
|
|
|---|
A French woman and her son (67 and 40 years old, respectively) presented with multiple (20 and 13 tumors, respectively) macroscopic GISTs, measuring from 1 to 8 cm, in duodenum and jejunum. All tumors examined were of low malignancy grade (ie, mitotic index <1 mitosis per 10 high-power fields) and in both cases there was no metastasis. There was no familial history of von Recklinghausens complex, multiple endocrine neoplasia, or intestinal ganglioneuromatosis. A detailed report of the cases will appear elsewhere. Tissues from GISTs, intestinal mucosa unaffected by GISTs, and normal pancreatic tissues were obtained from both patients as surgical waste at the time of pancreato-duodenectomy performed to relieve intestinal obstruction.
Preparation of Complementary DNA, Genomic DNA, and Sequencing
RNA was extracted from frozen tissues by a RNA extraction kit (RNeasy Mini Kit, Qiagen, Valencia, CA). Single-strand complementary DNA (cDNA) was synthesized by AMV reverse transcriptase (Boehringer Mannheim, Mannheim, Germany). The double-strand cDNA was then amplified by polymerase chain reaction (PCR) and sequenced, directly or after subcloning into Bluescript I KS(-), as described.10 Genomic DNA was isolated from frozen GISTs by the use of NaOH boiling preps. The genomic DNA was amplified by PCR using the forward primer (GTCGCTGTAAAGATGCTCAAG) in the exon 12 and the reverse primer (TAGCAAGAGAGAACAACAGT) in the intron 13 of human KIT DNA, and was sequenced after subcloning into Bluescript I KS(-).
Construction and Transfection of Murine Mutant-Type KIT cDNA
Generation of the murine counterpart of the human KIT mutant cDNA was carried out by site-directed mutagenesis as described.14 Stable transfection into the interleukin-3 (IL-3)-dependent murine lymphoid Ba/F3 cell line and selection of transfectant clones by the method of limiting dilution were performed as described.10 Mouse wild-type KIT cDNA and two mutated KIT cDNAs encoding well-characterized constitutively activated KIT mutants, an in-frame deletion of 6 bp encoding Val-559-Val-560 (KITdel559560) in the juxtamembrane domain and a substitution of Asp-816 to Val (KIT816Val) in the kinase domain II respectively, were also expressed in Ba/F3 cells as controls.
Immunoprecipitation and Immunoblotting
Ba/F3 clones expressing the various forms of KIT were cultivated with or without SCF (0.1 µg/ml) for 10 minutes. Cell lysates were immunoprecipitated with rat monoclonal antibody raised against mouse KIT (clone 2B8, Pharmingen, San Diego, CA). After sodium dodecyl sulfate-polyacrylamide gel electrophoresis, immunoblotting was performed with anti-phosphotyrosine mouse monoclonal antibody (4G10, Transduction Laboratories, Lexington, KY) as described.14
In Vitro Proliferation Assay
[3-(4,5-Dimethylthiazol-2-yl)-2, 5-diphenyl tetrazolium bromide] (MTT; Sigma, St. Louis, MO) colorimetric assay was performed as described.15 Briefly, cells were cultured with various concentrations of recombinant mouse (rm) IL-3 or rmSCF for 48 hours. Cells were further cultured for 4 hours in the presence of MTT (5 mg/ml). Reaction was stopped by adjunction of acid isopropanol and the optical density at a wavelength of 540 nm was measured on a Titertek Multiskan MCC/340 (ICN Biomedicals, Costa Mesa, CA).
Tumorigenicity Assay in Vivo
Tumorigenicity assay was performed as described15 after approval by the Veterinary Committee of the Faculty of Medicine, Université Libre de Bruxelles (Brussels, Belgium). The various transfectants and original Ba/F3 cells were injected subcutaneously into the posterior flank of nude mice (Iffa-Credo, Brussels, Belgium), 5 animals in each group. The size of tumors was measured with the vernier caliper every 4 days. Tumor volume was calculated with the formula: tumor volume = 0.5 x a x b2, where a and b are the length and width in millimeters, respectively, of the tumoral mass. Animals were euthanized between 3 and 5 weeks after injection, depending on tumor growth rate and animal health.
| Results |
|---|
|
|
|---|
|
GAA), resulting in a Lys-to-Glu substitution at codon 642 of
the kinase domain I of KIT
(KIT642Glu) was identified (Figure 1B)
Activation of the KIT signaling pathway was evaluated by KIT
autophosphorylation after immunoprecipitation and immunoblotting
(Figure 2)
. In Ba/F3 cells expressing
wild-type KIT, strong tyrosine phosphorylation of KIT
occurred only after stimulation by rmSCF. In contrast, tyrosine
residues of products of KITdel559560 and
KIT816Val were phosphorylated even without
stimulation by rmSCF, indicating the constitutive (ligand-independent)
activation of these mutants. The magnitude of constitutive tyrosine
phosphorylation was greater in Ba/F3 cells expressing
KIT816Val than in cells expressing
KITdel559560. In Ba/F3 cells expressing
KIT642Glu, tyrosine residues of KIT were
also phosphorylated independently of rmSCF, at a level similar to that
conferred by KITdel559560.
|
|
| Discussion |
|---|
|
|
|---|
The relationship between GISTs and ICCs has been postulated since KIT immunoreactivity was identified in a majority of GISTs.10,18-20 The presence of KIT is an essential characteristics of ICCs throughout life.7,21 ICCs-MP in stomach and intestine are dependant of the SCF-KIT signaling for their development and function.7 Furthermore, differentiation and survival of embryonic ICCs in vitro also requires SCF.22 Marked hyperplasia of KIT-positive cells in the MP layer of the GI tract unaffected by GISTs is a striking feature of our patients. This is reminiscent of another family with multiple GISTs, diffuse hyperplasia of KIT-positive spindle-shaped cells in the MP region23 and a germline mutation in juxtamembrane domain of KIT.17 It is noteworthy that in both families, hyperplasia of KIT-positive spindle-shaped cells was observed only in MP layer. KIT-positive ICCs in the deep muscular plexus layer (ICCs-DMP) appeared unaffected. In mouse, ICCs-DMP do not dependent on SCF-KIT signaling for their development.7 Therefore, the presence of germline-activating mutations of KIT in both families indicates that constitutive activation of the KIT signaling pathway during development lead to both hyperplastic development of ICCs-MP and occurrence of GISTs in adulthood. A similar mechanism has been demonstrated for germline-activating mutations of another receptor tyrosine kinase, the proto-oncogene c-ret, which is involved in hyperplasia of the C cells of the thyroid gland and development of multiple endocrine neoplasia (MEN) syndromes.24,25 Whether the hyperplastic cells observed in the GI tract of patients with germline-activating mutations of KIT gene fulfill the ultrastructural criteria of mature ICCs or of immature precursors remains to be determined but taken together, these observations favor the hypothesis of a possible common lineage for ICCs-MP and GISTs.
Intriguingly, germline-activating mutations of KIT apparently have little, if any, influence on melanocytes, which, like ICCs-MP, are dependent on the SCF-KIT pathway for their development.26 Some hyperpigmentation of the perineum has been reported in familial GISTs with gain-of-function mutation in the juxtamembrane domain of KIT. This feature was attributed without investigation to hyperplasia of melanocytes.13 Our patients did not show any abnormal pigmentation. These results suggest that germline-activating mutations in the juxtamembrane domain and in the kinase domain I of KIT may have different transduction pathways in various cell lineages.
Activating mutations in the juxtamembrane domain of KIT have been previously identified in a number of KIT-positive GISTs.10 Activating mutations in the juxtamembrane domain of KIT have been previously identified in a number of KIT-positive GISTs.10 The recent identification of mutations in the extracellular domain and tyrosine kinase domain of KIT16 suggests that the prevalence of KIT mutations in GISTs is very high and emphasizes the pivotal role of the proto-oncogene KIT in the ontogeny of GISTs. Mutations of KIT may be of prognosis value in GISTs27-29 but, so far, only mutations in the juxtamembrane domain have been investigated. Reappraisal should now take into account mutations occurring in the whole coding sequence of KIT and their somatic or germinal as well as homozygous or heterozygous nature, as these factors may differentially influence the behavior of GISTs.
| Acknowledgements |
|---|
| Footnotes |
|---|
Supported by grants from Fonds de la Recherche Scientifique Médicale, Belgium (3.4551.98 and 3.4618.99), the Fondation Médicale Reine Elisabeth, Belgium (Neurobiology 19992001), and the Ministery of Education, Science, Culture and Sports of Japan. K. I. is a Research Fellow of the Japan Society for the Promotion of Science. J. M. V. is a Research Associate of the National Fund for Scientific Research (Belgium).
Accepted for publication July 24, 2000.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A. Torkamani, N. Kannan, S. S. Taylor, and N. J. Schork Congenital disease SNPs target lineage specific structural elements in protein kinases PNAS, July 1, 2008; 105(26): 9011 - 9016. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Tabone-Eglinger, F. Subra, H. El Sayadi, L. Alberti, E. Tabone, J.-P. Michot, N. Theou-Anton, A. Lemoine, J.-Y. Blay, and J.-F. Emile KIT Mutations Induce Intracellular Retention and Activation of an Immature Form of the KIT Protein in Gastrointestinal Stromal Tumors Clin. Cancer Res., April 15, 2008; 14(8): 2285 - 2294. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Fecher, S. D. Cummings, M. J. Keefe, and R. M. Alani Toward a Molecular Classification of Melanoma J. Clin. Oncol., April 20, 2007; 25(12): 1606 - 1620. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Salmons, R. J Gregg, A. Pallalau, I. Woolhouse, I. Geh, and P. Taniere Lymphomatoid granulomatosis in a patient previously diagnosed with a gastrointestinal stromal tumour and treated with imatinib J. Clin. Pathol., February 1, 2007; 60(2): 199 - 201. [Full Text] [PDF] |
||||
![]() |
J. A. Curtin, K. Busam, D. Pinkel, and B. C. Bastian Somatic Activation of KIT in Distinct Subtypes of Melanoma J. Clin. Oncol., September 10, 2006; 24(26): 4340 - 4346. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. P. Rubin, C. R. Antonescu, J. P. Scott-Browne, M. L. Comstock, Y. Gu, M. R. Tanas, C. B. Ware, and J. Woodell A Knock-In Mouse Model of Gastrointestinal Stromal Tumor Harboring Kit K641E Cancer Res., August 1, 2005; 65(15): 6631 - 6639. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Tarn, E. Merkel, A. A. Canutescu, W. Shen, Y. Skorobogatko, M. J. Heslin, B. Eisenberg, R. Birbe, A. Patchefsky, R. Dunbrack, et al. Analysis of KIT Mutations in Sporadic and Familial Gastrointestinal Stromal Tumors: Therapeutic Implications through Protein Modeling Clin. Cancer Res., May 15, 2005; 11(10): 3668 - 3677. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. P. Li, J. A. Fletcher, M. C. Heinrich, J. E. Garber, S. E. Sallan, C. Curiel-Lewandrowski, A. Duensing, M. van de Rijn, L. E. Schnipper, and G. D. Demetri Familial Gastrointestinal Stromal Tumor Syndrome: Phenotypic and Molecular Features in a Kindred J. Clin. Oncol., April 20, 2005; 23(12): 2735 - 2743. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Corless, L. McGreevey, A. Town, A. Schroeder, T. Bainbridge, P. Harrell, J. A. Fletcher, and M. C. Heinrich KIT Gene Deletions at the Intron 10-Exon 11 Boundary in GI Stromal Tumors J. Mol. Diagn., November 1, 2004; 6(4): 366 - 370. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Corless, J. A. Fletcher, and M. C. Heinrich Biology of Gastrointestinal Stromal Tumors J. Clin. Oncol., September 15, 2004; 22(18): 3813 - 3825. [Abstract] [Full Text] [PDF] |
||||
![]() |
X Tang, M Boxer, A Drummond, P Ogston, M Hodgins, and A D Burden A germline mutation in KIT in familial diffuse cutaneous mastocytosis J. Med. Genet., June 1, 2004; 41(6): e88 - e88. [Full Text] [PDF] |
||||
![]() |
M. E. Robson, E. Glogowski, G. Sommer, C. R. Antonescu, K. Nafa, R. G. Maki, N. Ellis, P. Besmer, M. Brennan, and K. Offit Pleomorphic Characteristics of a Germ-Line KIT Mutation in a Large Kindred with Gastrointestinal Stromal Tumors, Hyperpigmentation, and Dysphagia Clin. Cancer Res., February 15, 2004; 10(4): 1250 - 1254. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R. Antonescu, G. Sommer, L. Sarran, S. J. Tschernyavsky, E. Riedel, J. M. Woodruff, M. Robson, R. Maki, M. F. Brennan, M. Ladanyi, et al. Association of KIT Exon 9 Mutations with Nongastric Primary Site and Aggressive Behavior: KIT Mutation Analysis and Clinical Correlates of 120 Gastrointestinal Stromal Tumors Clin. Cancer Res., August 1, 2003; 9(9): 3329 - 3337. [Abstract] [Full Text] [PDF] |
||||
![]() |
H Chen, S Hirota, K Isozaki, H Sun, A Ohashi, K Kinoshita, P O'Brien, L Kapusta, I Dardick, T Obayashi, et al. Polyclonal nature of diffuse proliferation of interstitial cells of Cajal in patients with familial and multiple gastrointestinal stromal tumours Gut, December 1, 2002; 51(6): 793 - 796. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Corless, L. McGreevey, A. Haley, A. Town, and M. C. Heinrich KIT Mutations Are Common in Incidental Gastrointestinal Stromal Tumors One Centimeter or Less in Size Am. J. Pathol., May 1, 2002; 160(5): 1567 - 1572. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Heinrich, C. D. Blanke, B. J. Druker, and C. L. Corless Inhibition of KIT Tyrosine Kinase Activity: A Novel Molecular Approach to the Treatment of KIT-Positive Malignancies J. Clin. Oncol., March 15, 2002; 20(6): 1692 - 1703. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Andersson, H. Sjogren, J. M. Meis-Kindblom, G. Stenman, P. Aman, and L.-G. Kindblom The Complexity of KIT Gene Mutations and Chromosome Rearrangements and Their Clinical Correlation in Gastrointestinal Stromal (Pacemaker Cell) Tumors Am. J. Pathol., January 1, 2002; 160(1): 15 - 22. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |