| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Institutes of Experimental and Clinical Pharmacology and
Toxicology*
and Pathology,
University of Erlangen-Nürnberg, Erlangen, Germany, and the
Department of Cell Biology and Immunology,
Vrije Universiteit, Amsterdam, The Netherlands
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
)
population in the body. They are activated by invading bacteria,
particularly by the cell wall constituent lipopolysaccharide (LPS) of
gram-negative germs. As a consequence, KCs produce proinflammatory
cytokines such as tumor necrosis factor (TNF)-
, interleukin
(IL)-1ß, and IL-6.1-3
TNF is an important immune
mediator that has been implicated in the pathogenesis of septic shock
in laboratory animals,4
certain autoimmune
diseases,5,6
inflammatory organ damage, including
heart7
and acute experimental liver failure,8
and other disorders. However, the importance of KCs for TNF-dependent
diseases still remains unclear, and even the results of experiments on
the role of KCs and splenic M in LPS shock are
controversial.9,10
For functional studies, M can be
eliminated in experimental animals by administration of silica
particles, by injection of gadolinium chloride
(GdCl3), by carrageenan, or by the
liposome-mediated macrophage suicide approach using
liposome-encapsulated dichloromethylene-bisphosphonate
(Cl2MBP).11
The use of silica
particles, GdCl3, or carrageenan has
disadvantages because these drugs by themselves can activate KCs (all
three), depress lymphocyte reactions (carrageenan), or induce a mitotic
phenotype in hepatocytes (GdCl3).11
Hence, any hepatoprotective potency may at least partially be explained
by these activities. The liposome-mediated macrophage suicide approach
is the most effective and best accepted method of M depletion
without stimulating the production of proinflammatory cytokines and/or
nitric oxide by M.11
Cl2MBP
liposomes eliminate M depending on their dosage and their route of
administration.12 Liver damage occurring as a consequence of T cell activation is a serious health problem worldwide. The most common causes of life-threatening T-cell-mediated liver damage in humans are infections with hepatitis B or C viruses and autoimmune hepatitis. Therefore, different animal models of T-cell-mediated liver injury have been developed, including acute liver failure in mice induced by intravenous injection of the T-cell-stimulatory plant lectin concanavalin A (Con A).13 Recently, we showed that T cells also contribute to liver injury induced by P. aeruginosa exotoxin A (PEA), an important virulence factor of the nosocomial gram-negative pathogen P. aeruginosa, in mice.14 Furthermore, when given in small doses, PEA sensitizes mouse livers to superantigen-induced, T-cell-dependent liver injury, as shown after combined treatment of mice with a low dose of PEA together with Staphylococcus aureus enterotoxin B (SEB).14,15 These results showed that the participation of T cells in liver cell destruction is a common mechanism. TNF plays a critical role in the aforementioned14-22 and several other23,26 mouse models of T cell activation-induced liver injury.
KCs are the primary source of intrahepatic TNF induced by either LPS3 or PEA14 in rodents. In the case of PEA, TNF production by KCs depends on the presence of T cells.14 However, clear functional data on the role of KCs in T-cell-dependent liver injury and intrahepatic TNF production is still missing. Carrageenan was used to analyze KC function in a transgenic mouse model of hepatitis B, in which mice overexpressing the hepatitis B surface antigen (HBsAg) were injected with previously activated CD8-positive cytotoxic T lymphocytes directed against the viral antigen. Extensive pretreatment with carrageenan attenuated liver injury in this animal model.27 However, activation of KCs by carrageenan11 and induction of hepatocellular resistance before the hepatotoxic challenge might have been responsible for the protective effect. Moreover, controversial results exist for the hepatotoxic potency of Con A in mice pretreated with GdCl3, because both protective effects28 and ineffectiveness29 of GdCl3 pretreatment have been described. Hence, the aim of this study was to analyze the effect of KC depletion by Cl2MBP liposomes on T-cell-mediated hepatic damage and TNF production.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Male BALB/c mice were obtained from Charles River, Sulzfeld, Germany. Animals received humane care according to the criteria outlined in the "Guide for the Care and Use of Laboratory Animals" prepared by the National Academy of Sciences and published by the National Institutes of Health. The legal requirements in Germany were met as well. Mice were maintained under controlled conditions (22°C, 55% humidity, 12-hour day/night rhythm) and were fed a standard laboratory chow (Altromin 1313, Altromin, Lage, Germany) ad libitum.
Animal Treatments
For depletion of KCs, BALB/c mice were injected with 100 µl of
Cl2MBP liposomes intravenously 48 hours before
challenge.12
Cl2MBP liposomes were
prepared as described previously,30
and diluted in
pyrogen-free saline. Cl2MBP was a gift of Roche
Diagnostics, Mannheim, Germany. In control experiments, BALB/c mice
were pretreated with saline instead of liposome-encapsulated
Cl2MBP. Saline liposomes were not used because
liposomes themselves block macrophage phagocytosis for certain periods
of time.30
The toxins were administered as follows: PEA
(Sigma, St. Louis, MO), 85 µg/kg i.v.; Con A (Sigma), 20 mg/kg
i.v.; SEB (Sigma), 2.5 mg/kg i.p.; recombinant murine (rmu)TNF (kindly
provided by Dr. G. R. Adolf, Bender & Co., Vienna, Austria),
various doses; recombinant murine interferon-
(rmuIFN-) (kindly
provided by Dr. G. R. Adolf), 50 µg/kg i.v. In case of
co-administration, 10 µg/kg of PEA were given intravenously 15
minutes before SEB. rmuTNF was administered 60 minutes and rmuIFN-
75 minutes after toxin challenge.
Sampling of Material
Mice were lethally anesthetized with 150 mg/kg i.v. pentobarbital, containing 15 mg/kg heparin. From anesthetized mice blood was withdrawn for plasma cytokine determination or analysis of plasma transaminases. Livers were excised and divided into three parts. One small part was frozen in liquid nitrogen for preparation of RNA and subsequent real-time reverse transcriptase-polymerase chain reaction (RT-PCR), a second small part was embedded in Tissue Embedding Medium (Slee, Mainz, Germany) and frozen at -50°C for immunofluorescent staining and confocal laser imaging, and the rest of the livers was disintegrated in ice-cold Ripa buffer (150 mmol/L NaCl, 5 mmol/L ethylenediaminetetraacetic acid, 50 mmol/L Tris, pH 7.4) containing protease inhibitors, DNase, and detergents (0.3% Triton X-100, 0.03% sodium dodecyl sulfate, 0.3% sodium deoxycholate), resulting in a 50% (w/w) liver homogenate. The homogenates were incubated on ice for 30 minutes and centrifuged at 15,000 x g for 30 minutes at 4°C. The supernatants were subjected to a second centrifugation at 15,000 x g for 20 minutes at 4°C. The resulting supernatants were then stored at -75°C for later quantification of intrahepatic TNF protein using an enzyme-linked immunosorbent assay. For histopathological determination of liver damage, mouse livers were perfused with 4% formalin/phosphate-buffered saline (PBS) via the portal vein before excision of the organ and storage at 4°C in 4% formalin/PBS.
Analysis of Plasma Transaminases and Plasma Cytokines
Liver injury was quantified by determination of plasma
transaminase activities. The activities of alanine aminotransferase
(ALT) and aspartate aminotransferase (AST) in plasma were determined
using an automated procedure, according to Bergmeyer.31
The plasma concentrations of TNF, IL-6, IL-2, and IFN- were
determined with the help of specific enzyme-linked immunosorbent assays
(ELISAs) purchased from PharMingen, Hamburg, Germany.
Hematoxylin and Eosin (H&E) Staining of Liver Sections
Formalin-fixed liver tissue was embedded in paraffin, sliced, and stained with H&E using a standard protocol.
Immunofluorescent Staining and Confocal Laser Imaging
Cryostat sections (12-µm thick) of livers were thawed onto
poly-L-lysine-coated glass slides, air-dried, and fixed in
acetone/methanol (1/1) for 10 minutes at 4°C before they were
incubated in 3% bovine serum albumin/PBS for 30 minutes at room
temperature. After the slides had been rinsed in PBS, incubation was
continued with polyclonal rabbit anti-mouse TNF neat hyperimmune
antiserum (Genzyme Virotech, Rüsselsheim, Germany; 1/750)
together with a rat mAb directed against murine M (clone BM 8,
Dianova, Hamburg, Germany; 1/100) or a rat mAb directed against mouse
CD4 (clone RM4–5, 1/50; PharMingen) in 3% bovine serum albumin/PBS
overnight at 4°C. After rinsing with PBS, binding sites were detected
by the use of appropriate secondary antibodies: fluorescein
isothiocyanate-conjugated swine anti-rabbit IgG (1/30; DAKO, Hamburg,
Germany) for staining of TNF, and Texas Red-conjugated goat anti-rat
IgG (1/200; Dianova) for staining of M or CD4+
cells. Secondary antibodies were diluted in 3% bovine serum
albumin/PBS, and incubation was performed for 1 hour at room
temperature. After rinsing with PBS, sections were coverslipped with
10% glycerol/PBS, pH 8.6. Sections processed for immunofluorescence
were examined by confocal laser scanning microscopy (MRC 1000; Bio-Rad,
Richmond, CA).
Real-Time RT-PCR for TNF mRNA in Liver Tissue
RNA was isolated from pieces of 
25-mg liver tissue by the use
of a RNA purification kit (Clontech, Heidelberg, Germany). For
real-time RT-PCR, primers and probes were selected for murine ß-actin
and TNF (TIB Molbiol, Berlin, Germany). ß-actin: 5'
TCACCCACACTGTGCCCATCTACGA; 3' GGATGCCACAGGATTCCATACCCA. ß-actin
TaqMan probe: (FAM) TATGCTC (TAMRA) TCCCTCACGCCATCCTGCGT. TNF: 5'
TCTATGGCCCAGACCCTCAC; 3' GACGGCAGAGAGGAGGTTGA. TNF TaqMan probe: (FAM)
CTCAGATCATCTTCTCAAAATTCGAGTGACAAGC (TAMRA). Probes were 5'-labeled with
6-carboxyfluorescin (FAM) and internally with
6-carboxy-N,N,N',N'-tetramethylrhodamine (TAMRA). Amplification and
detection were done with an ABI 7700 system with the following profile:
2 minutes 50°C, 30 minutes 60°C, 5 minutes 95°C, and 45 cycles at
95°C for 15 seconds and 60°C for 1 minute. For more detailed
information see User Bulletin 2 "ABI PRISM 7700 Sequence Detection
System" by Perkin-Elmer’s Applied Biosystems (Perkin-Elmer,
Emeryville, CA) describing the procedure of relative quantification of
gene expression. ß-actin was used as a housekeeping gene to normalize
mRNA levels. The relative amounts of ß-actin and TNF mRNA were
determined and divided by each other. The resulting normalized values
for TNF mRNA are arbitrary unitless numbers.
Quantification of Intrahepatic TNF
Liver lysates were prepared as described in Sampling of Material. They were directly used in a murine TNF ELISA kit purchased from R&D systems (Wiesbaden, Germany). Liver lysates were adjusted to equal protein concentrations after protein quantification by the Bradford method, as used in the Bio-Rad protein assay (Bio-Rad, Munich, Germany).
Statistical Analysis
The results were analyzed using the Student’s t-test or the Dunnett’s test. If variances were inhomogeneous, the data were transformed or analyzed using the Welsh test. Survival curves were compared using the log-rank test. All data in this study are expressed as the mean ± SEM. P < 0.05 was considered significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
KCs turned out to be the major source of intrahepatic TNF after
intravenous injection of PEA to mice and TNF is known to contribute to
PEA-induced liver injury.14
However, these correlating
results did not prove the importance of KCs for PEA-induced liver
injury. To this end, mice were depleted of KCs with the help of
liposome-encapsulated Cl2MBP.12
KC-deficient mice were treated with 85 µg/kg of PEA. Their
susceptibility to PEA-induced liver injury was compared to that of
control mice that had been pretreated with saline instead of
liposome-encapsulated Cl2MBP. Liver damage was
quantified by determination of plasma transaminase activities.
Furthermore, livers were analyzed histopathologically. Pretreatment of
mice with liposome-encapsulated Cl2MBP strongly
inhibited PEA-induced release of transaminases. This protective effect
of KC depletion was observed 12 hours and 17 hours after PEA challenge
(Figure 1)
. Histopathological examination
of H&E-stained liver sections (Figure 2A)
revealed that PEA induced single-cell necrosis of hepatocytes,
morphologically resembling apoptosis, as well as focal confluent
necrosis within 12 hours. The formation of apoptotic Councilman-like
acidophil bodies was observed. Focal confluent necrosis with
pale-stained hepatocytes predominantly appeared in the periportal
areas. Immediately before death, ie, 17 hours after injection of PEA,
livers were primarily injured. In these livers all stages of
single-cell death could be observed, including formation of
Councilman-like acidophil bodies, nuclear hyperchromasia, and
karyorrhexis, in addition to pale-stained, confluent necrotic areas. In
KC-depleted mice, PEA-induced hepatocellular death was strongly
attenuated. Most strikingly, single-cell necrosis was not observed at
all in livers of Cl2MBP liposome-pretreated,
PEA-challenged mice. However, limited focal confluent necrosis was
still detectable. Interestingly, limited focal confluent necrosis in
the absence of KCs was not sufficient to induce significant
transaminase release (Figure 1)
.
|
|
, KCs were the predominant
TNF-producing cells on injection of PEA and the absence of KCs
prevented the induction of TNF within livers of PEA-treated mice. To
get quantitative results, the amount of intrahepatic TNF in liver
lysates was determined using an ELISA. As shown in Figure 3A
, the induction of intrahepatic TNF by
PEA could be ascertained quantitatively. We also attempted to confirm
these results by quantifying intrahepatic TNF mRNA with the help of
real-time RT-PCR. As shown in Figure 3B
, the absence of KCs
significantly inhibited the accumulation of TNF mRNA within mouse
livers 2 hours after challenge with PEA.
|
. Hence, as little as 0.5 µg/kg of
rmuTNF was able to overcome the protective effect of KC depletion. Even
with 0.1 µg/kg of rmuTNF liver injury could be restored (data not
shown).
|
, survival after injection of PEA was
significantly prolonged by pretreatment with liposome-encapsulated
Cl2MBP. The enhanced survival of the KC-depleted
animals points to a prominent role of KCs for PEA-induced toxicity.
Interestingly, 0.5 µg/kg and even as little as 0.1 µg/kg of rmuTNF
significantly reduced the beneficial effect on survival conferred by KC
depletion. Higher doses of rmuTNF caused death at earlier stages. For
example, all mice died within 4 hours, if 10 µg/kg of rmuTNF were
administered to KC-depleted, PEA-treated mice.
|
The superantigen SEB exerts its toxicity through activation of a subset of T cells and subsequent production of TNF.15,23,34-36 Prerequisite for the induction of apoptotic liver injury by SEB is the presence of inhibitors of transcription (GalN)23 or translation (PEA).14,15 Dendritic cells rather than macrophages are considered essential for SEB-induced clonal expansion of Vß8-specific T cells37 and local expression of cytokine mRNAs within the spleen.38 Functional studies on the role of macrophages in SEB-induced toxicity are missing. We wondered whether KCs are required to mediate a SEB-triggered hepatotoxic response in mice and whether KC-depletion has an impact on the intrahepatic TNF response. We used a mixed intoxication model with a low dose of PEA as sensitizing agent plus SEB. This treatment causes T-cell- and TNF-dependent liver injury in mice within 12 hours, whereas the single toxins given alone are nontoxic.14,15
KC-depleted mice were completely protected from PEA/SEB-induced liver
injury as assessed by a significant inhibition of transaminase release
12 hours after challenge (Figure 5)
.
|
. This TNF production was mainly
co-localized with liver M and also with some individual
CD4+ cells. Depletion of KCs clearly prevented
PEA/SEB-induced TNF production within the liver. Quantification of
intrahepatic TNF in liver lysates corroborated these results.
PEA/SEB-induced production of intrahepatic TNF was significantly
attenuated in the absence of KCs (Figure 7A)
. Similar results were obtained by
real-time RT-PCR. TNF mRNA was clearly detectable within livers of
PEA/SEB-treated mice (Figure 7B)
. This induction of TNF mRNA was
significantly impaired in livers of Cl2MBP
liposome-pretreated mice (Figure 7B)
.
|
|
Importance of KCs for Con A-Induced Liver Injury and TNF Production
It is well established that intravenous injection of Con A induces
CD4+ T-cell-, TNF-, and IFN--dependent liver
injury in mice 8 hours after challenge.13,16-22
Early
production of TNF 2 hours after Con A injection has been proven by
determination of TNF in plasma,16-18
and by Western blot
analysis of liver tissue.19
However, the identity of the
TNF-producing cells in this model is unknown. Therefore, we wondered
whether KCs are the primary sources of Con A-induced intrahepatic TNF
and whether KCs play a role in Con A hepatitis.
Mice depleted of KCs were protected from Con A-induced liver injury, as
assessed by significantly reduced plasma transaminase activities 8
hours after challenge (Figure 8)
.
Histopathological analysis of liver sections (Figure 9)
revealed that Con A induced very large
confluent areas of necrosis connecting several hepatic lobules
(bridging necrosis). Single-cell necroses and the formation of
Councilman-like acidophil bodies, ie, characteristic of livers in
PEA-treated mice, was not observed at all. Pretreatment with
Cl2MBP liposomes limited the spreading of focal
confluent necroses induced by Con A, resulting in a more restricted
pattern similar to the histopathology of livers of KC-depleted,
PEA-treated mice (Figure 2A)
. Again, the restricted formation of
confluent necrotic areas was not sufficient to cause a significant
increase in plasma transaminase activities.
|
|
. The
levels of Con A-induced circulating IL-2 and IFN- were only
partially reduced in KC-depleted mice (Figure 10)
. However, the release
of IL-6 was strongly impaired (Figure 10)
. Hence, although KCs were the
main cell population producing Con A-induced intrahepatic TNF (see
below), depletion of KCs had no influence on Con A-induced plasma TNF
levels. Immunofluorescent staining of liver sections revealed that Con
A-induced intrahepatic TNF is mainly produced by KCs and to a lesser
extent by some individual CD4+ T cells (Figure 11)
. Markedly less TNF was observed in
livers of Cl2MBP pretreated as compared to livers
of normal mice, although, despite the absence of KCs, some individual
CD4+ cells still produced TNF (Figure 11)
. Hence,
depletion of KCs inhibited Con A-induced intrahepatic TNF production.
Quantification of intrahepatic TNF in liver lysates corroborated these
results. Con A-induced production of intrahepatic TNF was significantly
attenuated in the absence of KCs (Figure 12A)
. Similar results were obtained by
real-time RT-PCR. Intravenous injection of Con A clearly induced
intrahepatic TNF mRNA within 2 hours (Figure 12B)
. Pretreatment with
Cl2MBP liposomes significantly diminished the
intrahepatic induction of TNF mRNA by Con A (Figure 12B)
.
|
|
|
was ineffective to render KC-depleted mice susceptible to
Con A-induced liver injury (Con A: ALT, 1,370 ± 180 U/L;
Cl2MBP/Con A: ALT, 110 ± 23 U/L;
Cl2MBP/Con A/rmuTNF: ALT, 97 ± 25;
Cl2MBP/Con A/rmuTNF/rmuIFN-: ALT, 156 ±
39 U/L). Because membrane-bound TNF is also involved in Con A
hepatitis,19
it is conceivable that this form of TNF might
be required to mediate Con A-induced liver disease despite the presence
of high amounts of soluble TNF and IFN- (see Discussion). |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
are partially
eliminated by this treatment as well.12
However, because
Con A is able to induce liver injury in mice after removal of the
spleen (M. Leist, personal communication), the spleen does obviously
not play an important role in T-cell-dependent liver injury. Hence, it
is very likely that the hepatoprotective effect of 100 µl of
intravenously administered Cl2MBP liposomes is
because of the depletion of the KCs.
Histopathological studies revealed that pretreatment with
Cl2MBP liposomes strongly attenuated liver injury
induced by PEA or Con A. In both cases, this pretreatment restricted
liver damage to some areas of focal confluent necrosis, which were not
sufficient to cause significant release of transaminases. PEA- and Con
A-induced liver injury were morphologically different. Although the
livers of PEA-treated mice contained foci of confluent necrosis and
cells with apoptotic morphology (single-cell necrosis), which have been
morphologically identified by others as well,39
apoptotic
cell death could not be observed morphologically in livers of Con
A-treated mice. Instead, very large bridging necroses were visible.
With respect to the lack of apoptosis induction after injection of Con
A, our results seem to be in contrast to an earlier study, in which
apoptotic bodies were found in livers of Con A-treated
mice.17
However, our results are in line with a previous
study, in which only a sparse occurrence of apoptotic cells has been
described.40
As demonstrated by Künstle et
al,40
Con A hepatitis is characterized by the presence of
intrahepatic internucleosomal DNA fragmentation, being characteristic
of apoptotic cell death, and a concomitant lack of morphological
features of apoptosis as well as of activation of caspase-3-like
proteases. Also, Küsters et al18
demonstrated
intrahepatic DNA laddering on Con A injection and Trautwein et
al,41
showed terminal dUTP nick-end labeling-positive
staining of hepatocytes. Hence, Con A seems to induce TNF-dependent
hepatocellular death characterized by internucleosomal DNA
fragmentation by nonapoptotic morphology and without caspase-3
activation. The rarely observed apoptotic bodies within livers of Con
A-challenged mice17,40
might be derived from
nonparenchymal cells such as T cells that undergo activation-induced
cell death. Accordingly, caspase-inhibitors failed to prevent Con
A-induced liver injury,40
whereas PEA-induced liver damage
was prevented by these agents.14
Hence, it seems that in
the PEA model, TNF induces caspase-dependent hepatic apoptosis, while
in the Con A model TNF-dependent, caspase-3-independent necrosis was
observed. It should be pointed out that PEA-induced, rather than Con
A-induced, liver injury morphologically resembles viral hepatitis,
which is characterized by the presence of numerous Councilman bodies.
The prevalence of apoptotic cell death in viral hepatitis or
PEA-induced liver injury could be explained by mechanisms of
sensitization toward TNF. These include synthesis of certain viral gene
products in the case of viral hepatitis42
and significant
inhibition of protein synthesis in the case of PEA-induced liver
damage.43
Furthermore, cytotoxic lymphocytes may
contribute to the apoptotic morphology in viral
hepatitis27,44
or PEA-induced liver injury,14
eg, by producing perforin. Accordingly, the requirement of sensitizing
events, such as strong inhibition of protein synthesis, for induction
of apoptosis provides an explanation why Con A-induced liver injury
proceeds with hardly any morphological signs of apoptosis, whereas in
the presence of the transcriptional inhibitor GalN the livers of Con
A-treated mice contain significant numbers of apoptotic cells and are
characterized by strongly induced caspase-3-like
activity40
(Figure 13)
.
|
. KC depletion was not life saving for
PEA-treated mice, similar to T cell depletion that also prolonged
survival of PEA-treated mice, but did not protect them from death at
later stages.14
This points to additional mechanisms
leading to death in KC-depleted, PEA-treated animals at later stages,
such as ongoing inhibition of protein synthesis in PEA-sensitive
cells43
and systemic TNF release, eg, by blood monocytes
and by macrophages within other tissues, which are not affected by
intravenously injected liposome-encapsulated
Cl2MBP.1,12,48
Indeed, systemic TNF
levels, as determined in plasma 12 hours after injection of PEA to
mice,14
were even slightly enhanced in the absence of KCs
(data not shown). It is conceivable that the clearance of PEA is
disturbed in the absence of KC. Hence, continuously high levels of PEA
might cause stronger systemic TNF release and more potent inhibition of
protein synthesis and therefore lead to late-stage death in KC-depleted
mice. TNF release into the circulation of KC-depleted mice might be
further enhanced by missing KC-produced controllers such as IL-10 (see
below). In contrast to the PEA model, rmuTNF and rmuIFN- were
ineffective to restore the animals’ susceptibility to Con A. An
explanation is the absence of contemporaneous strong inhibition of
protein synthesis by Con A.49
Furthermore, Con A-induced
liver injury significantly depends on the expression of transmembrane
TNF,19
which cannot be simulated by a bolus injection of
rmuTNF. Transmembrane TNF might have to be present to sustain Con A
hepatitis in KC-depleted mice. Additionally, the macrophage cytokine
IL-18 might have to be present to allow Con A toxicity in KC-depleted
mice. An active role of IL-18 in Con A hepatitis has been described
recently.22
Despite depletion of KCs and strongly inhibited production of
intrahepatic TNF, the plasma TNF levels were neither reduced in Con A-
nor in PEA/SEB-treated mice. Leukocytes (lymphocytes, neutrophils,
monocytes, and/or M) in other tissues or in the blood stream may
account for this discrepancy. The fact that the plasma TNF levels in
Con A- or PEA/SEB-treated mice even tended to be slightly higher in the
absence of KCs suggests a controlling function of KCs. A similar
phenomenon has also been observed in LPS-challenged mice,1
and in PEA-challenged mice (see above). IL-10 may be such a KC-produced
controller of TNF synthesis. The liver is the main producer of
LPS-induced IL-10,50
and pretreatment of mice with
anti-IL-10 mAb aggravates LPS lethality51,52
as well as
Con A-induced liver injury,53
associated with enhanced
production of TNF.51-53
Additionally, it cannot be
excluded that KCs participate in the removal of either the toxins PEA,
SEB, or Con A or of TNF. In contrast to TNF, the plasma concentration
of Con A-induced IL-6 strongly correlated with the presence or absence
of KCs. However, the protection caused by KC depletion is probably not
related to impaired IL-6 production, because IL-6-deficient mice were
highly susceptible to Con A-induced liver injury.54
In conclusion, T-cell- and TNF-dependent liver injury clearly depends on the activation of KCs. We propose that KCs contribute to the rapid spreading of liver necrosis and to the induction of apoptosis by producing TNF. Importantly, T-cell-, KC-, and TNF-mediated liver injury results in different morphological patterns indicating different mechanisms of hepatocellular death, ie, necrosis and "conventional" apoptosis or necrosis and "cryptic" caspase-3-independent apoptosis, as described by Künstle et al.40 The development of morphologically visible apoptosis likely depends on the sensitization of the hepatocyte toward TNF. This observation will enforce further studies on the molecular and cellular prerequisites deciding the morphological character of liver disease.
Considering on the one hand the deleterious role of KCs and TNF in T cell-mediated liver injury, which can be induced by bacterial toxins or viruses, and on the other hand the protective role of KCs and TNF in host defense against bacteria35,55-57 and viruses,44,58 any therapeutic manipulations of KCs or TNF should be taken with great care. Therapeutic approaches in infectious liver diseases should rather be directed against TNF-dependent later events that solely play a role in the disease progression. However autoimmune hepatitis, which is not associated with infections, may be well controlled by neutralization of TNF or by attenuation of KC function.
|
Acknowledgements |
|---|
, Dr. W.
Neuhuber (Institute of Anatomy, University or Erlangen-Nürnberg,
Erlangen, Germany) for experimental support regarding confocal laser
scanning microscopy, and A. Agli and S. Heinlein for perfect technical
assistance. |
Footnotes |
|---|
Supported by Deutsche Forschungsgemeinschaft Grants Ti 169/3-4 and Ti 169/4-2 and by Interdisziplinäres Zentrum für Klinische Forschung, Universität Erlangen-Nürnberg.
Accepted for publication August 3, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, ß and tumor necrosis factor during experimental endotoxemia. Kinetics, Kupffer cell expression, and glucocorticoid effects. Am J Pathol 1991, 138:395-402[Abstract]
(cA2) versus placebo in rheumatoid arthritis. Lancet 1994, 344:1105-1110[Medline]
for Crohn’s disease. Crohn’s disease cA2 study group. N Engl J Med 1997, 337:1029-1035 and Fas ligand in concanavalin A-induced hepatitis. J Immunol 1998, 160:4082-4089 and IL-18. Proc Natl Acad Sci USA 2000, 97:2367-2372 in the pathogenesis of activated macrophage-mediated hepatitis in mice. Gastroenterology 1990, 99:758-765[Medline]
in galactosamine-sensitized mice. Biochem Pharmacol 1990, 40:1317-1322[Medline]
. Proc Natl Acad Sci USA 1997, 94:8744-8749 and TNF- production by liver-associated T cells and acute liver injury in rats administered concanavalin A. Immunol Cell Biol 1998, 76:542-549[Medline]
. Eur J Immunol 1995, 25:2888-2893[Medline]
double-mutant mice resist septic arthritis but display increased mortality in response to Staphylococcus aureus. J Immunol 1998, 161:5937-5942This article has been cited by other articles:
 |
|
 |
|
  W. Jiang, R. Sun, R. Zhou, H. Wei, and Z. Tian TLR-9 Activation Aggravates Concanavalin A-Induced Hepatitis via Promoting Accumulation and Activation of Liver CD4+ NKT Cells J. Immunol., March 15, 2009; 182(6): 3768 - 3774. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Gao, G. Kou, H. Chen, H. Wang, B. Li, Y. Lu, D. Zhang, S. Wang, S. Hou, W. Qian, et al. Treatment of hepatocellular carcinoma in mice with PE38KDEL type I mutant-loaded poly(lactic-co-glycolic acid) nanoparticles conjugated with humanized SM5-1 F(ab') fragments Mol. Cancer Ther., October 1, 2008; 7(10): 3399 - 3407. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Biburger and G. Tiegs Activation-induced NKT cell hyporesponsiveness protects from {alpha}-galactosylceramide hepatitis and is independent of active transregulatory factors J. Leukoc. Biol., July 1, 2008; 84(1): 264 - 279. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. L. Hegde, S. Hegde, B. F. Cravatt, L. J. Hofseth, M. Nagarkatti, and P. S. Nagarkatti Attenuation of Experimental Autoimmune Hepatitis by Exogenous and Endogenous Cannabinoids: Involvement of Regulatory T Cells Mol. Pharmacol., July 1, 2008; 74(1): 20 - 33. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. O. Osburn, M. S. Yates, P. D. Dolan, S. Chen, K. T. Liby, M. B. Sporn, K. Taguchi, M. Yamamoto, and T. W. Kensler Genetic or Pharmacologic Amplification of Nrf2 Signaling Inhibits Acute Inflammatory Liver Injury in Mice Toxicol. Sci., July 1, 2008; 104(1): 218 - 227. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Ohta, D. Lukashev, E. K. Jackson, B. B. Fredholm, and M. Sitkovsky 1,3,7-Trimethylxanthine (Caffeine) May Exacerbate Acute Inflammatory Liver Injury by Weakening the Physiological Immunosuppressive Mechanism J. Immunol., December 1, 2007; 179(11): 7431 - 7438. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Safadi, E. Zigmond, O. Pappo, Z. Shalev, and Y. Ilan Amelioration of hepatic fibrosis via beta-glucosylceramide-mediated immune modulation is associated with altered CD8 and NKT lymphocyte distribution Int. Immunol., August 13, 2007; (2007) dxm069v1. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. N. Ajuebor, Z. Wondimu, C. M. Hogaboam, T. Le, A. E.I. Proudfoot, and M. G. Swain CCR5 Deficiency Drives Enhanced Natural Killer Cell Trafficking to and Activation within the Liver in Murine T Cell-Mediated Hepatitis Am. J. Pathol., June 1, 2007; 170(6): 1975 - 1988. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. A. Roberts, P. E. Ganey, C. Ju, L. M. Kamendulis, I. Rusyn, and J. E. Klaunig Role of the Kupffer Cell in Mediating Hepatic Toxicity and Carcinogenesis Toxicol. Sci., March 1, 2007; 96(1): 2 - 15. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. C. Wetzel, M. A. Leonis, A. Dent, M. A. Olson, A. M. Longmeier, P. A. Ney, G. P. Boivin, S. A. Kader, C. C. Caldwell, S. J. F. Degen, et al. Short-form Ron receptor is required for normal IFN-{gamma} production in concanavalin A-induced acute liver injury Am J Physiol Gastrointest Liver Physiol, January 1, 2007; 292(1): G253 - G261. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Wald, I. D. Weiss, H. Wald, H. Shoham, Y. Bar-Shavit, K. Beider, E. Galun, L. Weiss, L. Flaishon, I. Shachar, et al. IFN-{gamma} Acts on T Cells to Induce NK Cell Mobilization and Accumulation in Target Organs. J. Immunol., April 15, 2006; 176(8): 4716 - 4729. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Kawasuji, M. Hasegawa, M. Horikawa, T. Fujita, Y. Matsushita, T. Matsushita, M. Fujimoto, D. A. Steeber, T. F. Tedder, K. Takehara, et al. L-selectin and intercellular adhesion molecule-1 regulate the development of Concanavalin A-induced liver injury J. Leukoc. Biol., April 1, 2006; 79(4): 696 - 705. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. K. Polakos, J. C. Cornejo, D. A. Murray, K. O. Wright, J. J. Treanor, I. N. Crispe, D. J. Topham, and R. H. Pierce Kupffer Cell-Dependent Hepatitis Occurs during Influenza Infection Am. J. Pathol., April 1, 2006; 168(4): 1169 - 1178. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Ragin, N. Sahu, and A. August Differential Regulation of Cytokine Production by CD1d-Restricted NKT Cells in Response to Superantigen Staphylococcal Enterotoxin B Exposure Infect. Immun., January 1, 2006; 74(1): 282 - 288. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Margalit, S. A. Ghazala, R. Alper, E. Elinav, A. Klein, V. Doviner, Y. Sherman, B. Thalenfeld, D. Engelhardt, E. Rabbani, et al. Glucocerebroside treatment ameliorates ConA hepatitis by inhibition of NKT lymphocytes Am J Physiol Gastrointest Liver Physiol, November 1, 2005; 289(5): G917 - G925. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. M. Wolf, D. Wolf, H. Rumpold, S. Ludwiczek, B. Enrich, G. Gastl, G. Weiss, and H. Tilg The kinase inhibitor imatinib mesylate inhibits TNF-{alpha} production in vitro and prevents TNF-dependent acute hepatic inflammation PNAS, September 20, 2005; 102(38): 13622 - 13627. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Biburger and G. Tiegs {alpha}-Galactosylceramide-Induced Liver Injury in Mice Is Mediated by TNF-{alpha} but Independent of Kupffer Cells J. Immunol., August 1, 2005; 175(3): 1540 - 1550. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. J. McKallip, M. Fisher, U. Gunthert, A. K. Szakal, P. S. Nagarkatti, and M. Nagarkatti Role of CD44 and Its v7 Isoform in Staphylococcal Enterotoxin B-Induced Toxic Shock: CD44 Deficiency on Hepatic Mononuclear Cells Leads to Reduced Activation-Induced Apoptosis That Results in Increased Liver Damage Infect. Immun., January 1, 2005; 73(1): 50 - 61. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Yamanaka, S. Hamano, Y. Miyazaki, K. Ishii, A. Takeda, T. W. Mak, K. Himeno, A. Yoshimura, and H. Yoshida Hyperproduction of Proinflammatory Cytokines by WSX-1-Deficient NKT Cells in Concanavalin A-Induced Hepatitis J. Immunol., March 15, 2004; 172(6): 3590 - 3596. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. A. Muhlen, J. Schumann, F. Wittke, S. Stenger, N. van Rooijen, L. van Kaer, and G. Tiegs NK Cells, but Not NKT Cells, Are Involved in Pseudomonas aeruginosa Exotoxin A-Induced Hepatotoxicity in Mice J. Immunol., March 1, 2004; 172(5): 3034 - 3041. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. S. Bonder, M. N. Ajuebor, L. D. Zbytnuik, P. Kubes, and M. G. Swain Essential Role for Neutrophil Recruitment to the Liver in Concanavalin A-Induced Hepatitis J. Immunol., January 1, 2004; 172(1): 45 - 53. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Di Paolo, J. Willuda, S. Kubetzko, I. Lauffer, D. Tschudi, R. Waibel, A. Pluckthun, R. A. Stahel, and U. Zangemeister-Wittke A Recombinant Immunotoxin Derived from a Humanized Epithelial Cell Adhesion Molecule-specific Single-Chain Antibody Fragment Has Potent and Selective Antitumor Activity Clin. Cancer Res., July 1, 2003; 9(7): 2837 - 2848. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. N. Ajuebor, C. M. Hogaboam, T. Le, and M. G. Swain C-C Chemokine Ligand 2/Monocyte Chemoattractant Protein-1 Directly Inhibits NKT Cell IL-4 Production and Is Hepatoprotective in T Cell-Mediated Hepatitis in the Mouse J. Immunol., May 15, 2003; 170(10): 5252 - 5259. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Schumann, K. Muhlen, A. K. Kiemer, A. M. Vollmar, and G. Tiegs Parenchymal, But Not Leukocyte, TNF Receptor 2 Mediates T Cell-Dependent Hepatitis in Mice J. Immunol., February 15, 2003; 170(4): 2129 - 2137. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Zhou, J. Fandrey, J. Schumann, G. Tiegs, and B. Brune NO and TNF-alpha released from activated macrophages stabilize HIF-1alpha in resting tubular LLC-PK1 cells Am J Physiol Cell Physiol, February 1, 2003; 284(2): C439 - C446. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Tolosano, S. Fagoonee, E. Hirsch, F. G. Berger, H. Baumann, L. Silengo, and F. Altruda Enhanced splenomegaly and severe liver inflammation in haptoglobin/hemopexin double-null mice after acute hemolysis Blood, December 1, 2002; 100(12): 4201 - 4208. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Boisclair, M. Dore, G. Beauchamp, L. Chouinard, and C. Girard Characterization of the Inflammatory Infiltrate in Canine Chronic Hepatitis Vet. Pathol., November 1, 2001; 38(6): 628 - 635. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
