help button home button Am J Pathol R & D Systems
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kupferman, M. E.
Right arrow Articles by Muschel, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kupferman, M. E.
Right arrow Articles by Muschel, R. J.
(American Journal of Pathology. 2000;157:1777-1783.)
© 2000 American Society for Investigative Pathology


Short Communications

Matrix Metalloproteinase 9 Promoter Activity Is Induced Coincident with Invasion during Tumor Progression

Michael E. Kupferman*{dagger}, M. Elizabeth Fini{ddagger}, William J. Muller§, Randal Weber{dagger}, Yi Cheng* and Ruth J. Muschel*

From the Departments of Pathology and Laboratory Medicine *
and Otorhinolaryngology,{dagger}
University of Pennsylvania, Philadelphia, Pennsylvania; the Vision Research Laboratories,{ddagger}
New England Eye Center, Tufts University School of Medicine, Boston, Massachusetts; and the Departments of Biology and Pathology,§
Institute for Molecular Biology and Biotechnology, McMaster University, Hamilton, Ontario, Canada


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Matrix metalloproteinase 9 (MMP-9, also known as gelatinase B or 92-kd Type IV collagenase) is overexpressed in many human and murine cancers. We induced carcinomas in mice carrying a transgene that links the MMP-9 promoter to the reporter ß-galactosidase so that activation of the MMP-9 promoter would be indicated by ß-galactosidase. Mammary carcinomas were induced by mating the MMP-9 promoter reporter transgenic mice with mice carrying a transgene for murine mammary tumor virus promoter linked to polyoma middle T antigen, a transgene that leads to rapid development of mammary tumors in female mice. None of the hyperplastic mammary glands and none of the carcinomas in situ expressed ß-galactosidase. However, all invasive tumors had evidence of ß-galactosidase expression. In addition to the breast carcinomas, a malignant teratoma in a female and a papillary adenocarcinoma in the pelvic region of a male arose and were also ß-galactosidase positive. We also induced skin tumors in the mice with the MMP-9 reporter transgene with 7, 12-dimethylbenz[a]anthracene (DMBA) treatment followed by phorbol 12 myristate 13-acetate (TPA). None of the papillomas or in situ carcinomas showed any ß-galactosidase expression, but expression was seen in invasive carcinoma. Although normal skin epithelial cells did not express ß-galactosidase, we did find staining in a few cells at the duct of the sebaceous gland at the base of the hair follicles. The MMP-9 reporter transgene did not lead to expression in the alveolar macrophages, confirming that additional upstream sequences are required for expression in macrophages. These experiments have revealed that MMP-9 promoter activity is induced coincident with invasion during tumor progression. Furthermore, this indicates that the more proximal upstream elements of the promoter are sufficient for MMP-9 transcription during tumor progression.



    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Carcinogenesis is a multistep process, often with early proliferative lesions characterized by distinctive histological patterns. With time there is often increased proliferation accompanied by altered morphology. Those lesions with nuclear dysplasia, but without evidence of invasion, sometimes termed carcinoma in situ, precede the development of frank carcinoma in which invasion can be detected. Tumor progression can be modeled in mice by the introduction of oncogenes into specific tissues using transgenes technology and/or recombinant knockout technology, and also by carcinogenesis. For example, expression of the polyoma middle T gene, the transforming gene of polyoma virus specifically induced in breast tissue by the murine mammary tumor virus promoter, leads to widespread proliferation or hyperplasia of the mammary epithelia early in development and is later accompanied by frequent development of malignant, invasive mammary adenocarcinomas. When these carcinomas reach a large size, macroscopic metastases can develop. Thus, during the neonatal period, benign hyperplasia of the mammary ducts is seen, followed by progression to malignancy.1-3 Similarly, in skin carcinogenesis using the initiator-promoter methods, a mutagen is first applied to the skin, followed by frequent application of a tumor promoter. Either treatment in itself is insufficient to lead to carcinoma formation, but together, in the order of mutagen followed by promoter, they lead to the frequent generation of benign skin proliferations or papillomas. Some of these papillomas then progress to invasive carcinoma.4 We have used these models to assess alterations in the promoter activity for MMP-9.

Matrix metalloproteinase 9 (MMP-9) is a member of the family of matrix metalloproteinases.5 Like other metalloproteinases, MMP-9 has a catalytic region that includes a putative metal binding domain. It is secreted as a latent proenzyme and is frequently isolated in a complex with its natural inhibitor, tissue inhibitor of metalloproteinase-1 (TIMP-1). An inhibitory propeptide must be cleaved to release an active enzyme. There is some evidence that the secreted molecule can bind to the surface of cells via CD44 or a chain of Type IV collagen.6,7 This binding may be critical for its biological action. MMP-9 has been shown to be required for metastasis by both murine prostate carcinoma cells and transformed rat embryo fibroblasts.8,9

MMP-9 is induced in tissue culture cells by a variety of cytokines and oncogenes.10 This induction is strongly based on transcriptional mechanisms. The 5' upstream region of MMP-9 has been cloned from the human, rabbit, and murine genome and in each case directs transcription both constitutively and after induction by TPA or other cytokines.10-13 The MMP-9 region upstream from each of these species is highly similar with identical transcriptional factor binding consensus sites including a proximal activated protein-1 (AP-1) site that is necessary, but not sufficient, for consitituitive expression or for TPA or tumor necrosis factor-{alpha} (TNF-{alpha}) induction.11 This element is also required for v-src-activated transcription, but, surprisingly, is not required for transcription in SK-N-SH cells.14,15 There is a GT-rich region that also makes a significant contribution to transcriptional control up-regulated by src, ras, or in SK-N-SH cells.11,14-19 The MMP-9 promoter from each species also contains a more distal activator protein-1 (AP-1) site, a nuclear factor {kappa}B (NF{kappa}B), an ets, and SP-1 recognition sites, all of which contribute to the activity of this promoter and its stimulation by the ras oncogene or TPA. The NF{kappa}B site is required for stimulation of MMP-9 transcription by cytokines in fibroblasts.20 The ets site was also required for maximal stimulation by ras, TNF, cell contact, and epidermal growth factor (EGF).11,16-19 Fini et al have identified activator protein-2 (AP-2) as a critical motif in the rat promoter for induction in wound healing.13

The MMP-9 promoter linked to the reporter gene ß-galactosidase has been used to generate transgenic mice.12,21 Fini et al used a 510-bp upstream fragment from the rabbit promoter to generate such a mouse. The promoter fragment they used was sufficient to drive ß-galactosidase expression during development, with strong staining at the endochondrial plates during bone development and in the ventricular lining and developing neuroblasts of the central nervous system in a temporal pattern similar to that seen with in situ hybridization. This transgenic mouse also showed the expected pattern of MMP-9 expression during wound healing, with the migrating epithelium showing significant ß-galactosidase expression.21 This fragment of the promoter may not be sufficient to direct all expression during development. Munaut et al12 found that the murine region homologous to that of the rabbit used by Fini et al failed to stimulate ß-galactosidase expression in alveolar macrophages, cells of which a subset usually show very strong MMP-9 expression. Munaut et al also failed to see expression in osteoclasts. A 2.8-kb upstream fragment, however, led to expression in alveolar macrophages and osteoclasts. Thus, the rabbit promoter recapitulates much, but perhaps not all, of the expression expected to be directed by an MMP-9 promoter.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice, Breeding, and Tumor Development

Mice bearing the rabbit MMP-9 promoter (from -522 to +12) linked to the reporter ß-galactosidase were developed and described by Fini et al (derived from founder 3445).21 This founder had identical patterns of expession to a second founder, but overall levels of expression were higher. Hence, we chose to use this strain for these experiments.21 Mice bearing the transgene linking the promoter from the mouse mammary tumor virus to the oncogene polyoma virus middle T antigen were developed and characterized by Muller’s lab.1-3 Female mice homozygous for the rabbit MMP-9 promoter (from -522 to +12) linked to the reporter ß-galactosidase were mated to males homozygous for murine mammary tumor virus (MMTV) polyoma middle T antigen. All of the resultant offspring were expected to carry both transgenes. Presence of the ß-galactosidase transgene was confirmed in all offspring by polymerase chain reaction of DNA extracted from the tails of 2-week-old mice. (Primers were 5'ACTCGGCGTTTCATCTGTGG and 5' AGCGACATCCAGAGGCACTT, which yield a characteristic 1579-bp band.) All animals were sacrificed as soon as or before they developed tumors 3 cm in diameter.

Mice with the MMP-9 promoter linked to the ß-galactosidase reporter were maintained by mating the homozygous mice to each other. Presence of the transgene was confirmed by polymerase chain reaction analysis for ß-galactosidase and was found in all offspring as expected.

Carcinogenesis

Skin carcinogenesis by application of initiator and promoter was performed on 7 mice with the MMP-9 ß-galactosidase transgene.22 Fifty micrograms of 7,12-dimethylbenz[a]anthracene (DMBA) in 50 µl acetone were applied to the shaved skin of each 4- to 8-week-old mouse. Phorbol 12 myristate 13-acetate (TPA) (20 nmol) in 200 µl acetone was then applied after 10 days and twice weekly for 20 to 25 weeks. One animal died from no apparent cause without any visible tumors. Multiple papillomas were observed on 3 mice after 8 to 12 weeks and a carcinoma was observed in a fourth mouse. The remaining 2 animals had no visible tumors. Animals were sacrificed at 16 weeks.

Tissue Evaluation

After sacrifice, mice were immediately dissected. Tissues were harvested and frozen in OCT (Fisher, Trenton, NJ) on dry ice. Frozen sections (10 µm) were cut on a cryostat. ß-Galactosidase was visualized using the staining kit and protocol from Specialty Media (Phillipsburg, NJ). In brief, air-dried sections were washed in phosphate buffered saline including Ca2+ and Mg2+, and fixed in ice-cold 2% (v/v) formaldehyde and 0.2% (v/v) glutaraldehyde for 1 hour on ice. After washing, X-gal solution was placed on the section at 37°C in the dark overnight. Sections were then fixed in 10% formalin on ice for 10 minutes, washed, and counterstained in 2% hematoxylin for approximately 10 seconds. After washing in H2O, the sections were mounted in Permount. Skin sections were included in each batch for positive controls.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tumors Induced in MMTV-Polyoma Middle T Transgenic Mice

Female mice homozygous for the MMP-9 promoter ß-galactosidase transgene were mated to male mice bearing the MMTV polyoma middle T trangene. Mice resulting from this cross were sacrificed at 2 weeks of age or after development of tumors from 1 to 3 cm in diameter. Tissues were frozen and stained for ß-galactosidase activity using an X-gal-based method that results in a light blue stain. Females have hyperplasia of the mammary ducts at birth. Despite extensive hyperplasia, no ß-galactosidase was evident in these ducts or the adjacent fat and stromal tissue (Table 1 and Figure 1B ). Male mice at birth have histologically normal ducts; these were also negative for ß-galactosidase (Table 1 and Figure 1A ). The tumors were tested for ß-galactosidase activity. Only one carcinoma in situ without any evidence of invasion was found. There was no staining in this tumor. In addition, 12 adenocarcinomas were sectioned. Three of these tumors had distinct areas of intraductal carcinoma as well as areas with invasive carcinoma. These tumors had histologies similar to those previously described for MMTV-polyoma middle T-induced breast carcinomas.2 The areas of intraductal carcinoma or carcinoma in situ had no staining (Figure 1C) . In all 12, the areas of invasive tumor had ß-galactosidase staining. Only a fraction of the cells in the invasive areas were positive; not all tumor cells were positive. Thus, early neoplastic lesions of the breast, hyperplasia, and carcinoma in situ did not show evidence of activation of the MMP-9 promoter, but invasive lesions all contained some cells with MMP-9 promoter activity (Figure 1D) .


View this table:
[in this window]
[in a new window]
 
Table 1. Histological Analysis of Breast Tissue from Mice Transgenic for MMTV-Polyoma Middle T and MMP-9 Promoter-ß-Galactosidase

 


View larger version (163K):
[in this window]
[in a new window]
 
Figure 1. ß-Galactosidase staining in tissues from MMP-9 promoter-reporter mice. All section shown are stained for ß-galactosidase activity and counterstained with hematoxylin. A-D: Sections from breast tissue of mice transgenic for MMTV-polyoma middle T and MMP-9 promoter-ß-galactosidase. A: A section from a 2-week-old male mouse breast. B: A section from a 2-week-old female mouse. C: A higher power view of a section from an area of in situ carcinoma from a female mouse breast tumor. D: An area of invasive carcinoma from a female breast carcinoma. E-H: Sections of skin. E: Normal untreated skin. F: A section from a papilloma induced by skin carcinogenesis. G: Higher power view of a dysplastic area from a papilloma. H: Invasive squamous cell carcinoma. I: Section from adenocarcinoma that developed spontaneously in the pelvic region of a male mouse.

 
In addition to breast carcinoma, other types of neoplasms were found in these transgenic mice. One female had bilateral ovarian carcinomas with histopathology consistent with malignant teratocarcinoma. This mouse did not have breast carcinoma. Many of the malignant cells in these teratocarcinomas were positive for ß-galactosidase. Interestingly, the bony and cartilaginous areas were negative. One male had a carcinoma of the submandibular gland with histology consistent with a mucoepidermoid carcinoma. There was sporadic staining in this tumor as well (not shown). Another male mouse had a papillary serous cystadenocarcinoma in the testicular region that also stained positive (Figure 1I) .

Skin Carcinogenesis

To extend these observations indicating that the MMP-9 promoter is activated during the stages of tumor progression associated with invasion, we examined the expression of ß-galactosidase in skin tumors induced by intitiation-promotion with DMBA and TPA in mice bearing the MMP-9 ß-galactosidase transgene. Skin from an untreated area is shown in Figure 1E . The epithelium and subcutaneous tissue were negative. Cells at the neck of the duct connecting the sebaceous glands associated with hair follicles to the hair shaft consistently stained. Skin from mice treated with TPA was also negative, with the exception of cells in the sebaceous glands (not shown). Seven papillomas were examined. Four showed dysplasia suggestive of carcinoma in situ. None of these papillomas or carcinomas in situ had ß-galactosidase staining (Figure 1, F and G , and Table 2 ). Only 1 animal developed invasive carcinoma. This carcinoma had extensive staining, but again, only some, not all, of the tumor cells were positive (Figure 1H) .


View this table:
[in this window]
[in a new window]
 
Table 2. ß-Galactosidase in Skin from Mice Transgenic for MMP-9 Promoter-ß-Galactosidase after Skin Carcinogenesis

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study activation of the 510-b rabbit MMP-9 promoter was found to occur coincident with invasion during mammary carcinogenesis. Similarly, the MMP-9 promoter was inactive in benign papilloma and in dysplastic papillomas, but was activated in a squamous cell carcinoma. These results indicate that a new pattern of transcriptional activation emerges during conversion from benign to malignant lesions. One gene whose expression is activated by this switch is MMP-9.

In this study, we used two murine models for tumor progression. One, a model of squamous cell carcinoma of the skin based on carcinogenesis, results in activity of the MMP-9 promoter at the stage when invasive carcinoma can first be seen. Squamous cell carcinomas of the skin as well as at other sites in patients can be shown to express MMP-9 mRNA by in situ hybridization.23-25 MMP-9 expression is also correlated with invasion and poorer prognosis in squamous cell carcinoma.26-28 Its expression tends to be elevated at the invasive fronts, and this can be modeled in three-dimensional tissue culture.29 In melanoma, a tumor type with a clear histological distinction between different stages of tumor progression, cells from vertical growth phase melanomas, the most invasive and aggressive stage of melanoma, express MMP-9 in culture and after stimulation with transforming growth factor-ß, but cells from the earlier stage radial growth phase do not.30 We also used a model of breast cancer. The literature is more contradictory regarding expression patterns of MMP-9 in human breast carcinoma. Although some studies find increased expression in breast carcinonomas, others have failed to find any difference.31-38 However, in several instances, manipulations that led to increased invasiveness or metastasis by breast carcinoma cells were associated with increased expression of MMP-9.39-42 Studies in patient material tend to be difficult because immunohistochemical identification of secreted proteins may not be reliable and the sensitivity of in situ hybridization is variable. Nonetheless, the increase in promoter activity found here may not translate into increased MMP-9 in actual tumors. These experiments would suggest that there is a consistent change in transcriptional activity of an MMP-9 promoter during tumor progression.

The upstream elements of the MMP-9 promoter include two AP-1 sites, one adjacent to the MMP-9 transcript start site and the other more distal. In addition to AP-1, the MMP-9 promoters all contain AP-2, ets, NF{kappa}B, and Sp-1 recognition consensus elements. Each of these elements adds incrementally to MMP-9 expression in cells constitutively expressing MMP-9.11,14,17,18 There is some evidence of the potential involvement of many of these transcription factors in tumor progression. Saez et al found that treatment of the skin of mice genetically deficient in c-fos with an initiator-promoter protocol for induction of skin carcinogenesis resulted in papilloma formation that failed to progress to invasion or carcinoma.43 Since AP-1 is formed by heterodimers of fos and jun or jun homodimers, the absence of c-fos would disrupt many AP-1 complexes. This result is more complicated, however, because transgenic mice overexpressing a dominant negative inhibitor of jun in the skin fail to develop even papillomas after initiation and promotion.44 Ets-1, one of a large family of proteins binding to the ets consensus binding site, has been associated with transformation and is required for transformation. Mice with a single targeted deficient allele of ets-2 show decreased progression in MMTV-polyoma middle T-induced tumors.45 PEA-3, another transcription factor that binds to the ets consensus binding site, has been shown by Trimble et al to be overexpressed in the mammary carcinomas that result from expression of the MMTV-polyoma middle T transgene, making it an attractive candidate for involvement in the induction of MMP-9 promoter activity during tumor progression.46 There are several reports implicating enhanced NF{kappa}B expression in carcinomas including breast carcinoma and squamous cell carcinoma of the skin.47,48 In contrast, there is evidence that AP-2 is down-regulated during tumor progression in melanaoma and that the presence of AP-2 activity facilitates the expression of E-cadherin, a gene whose down-regulation is frequently required for invasion and metastasis. Furthermore, down-regulation of E-cadherin results in up-regulation of MMP-9 in squamous carcinoma cell lines.49 Interestingly, up-regulation of AP-2 has been suggested to be the critical factor regulating transcriptional activity of MMP-9 during wound healing in the cornea.21 Whether any of these transcriptional elements are activated during tumor progression and whether their enhanced activity leads to MMP-9 expression remain to be determined.

In addition to the elements indicated above, additional upstream regions have important roles in regulation of MMP-9 activity. The region we have used, 510 bp upstream from the start site of the rabbit gene, does not direct expression in alveolar macrophages, cells that frequently express MMP-9. Munaut et al obtained expression in macrophages with a 2.8kb upstream fragment, but not with a smaller fragment homologous to the promoter used here.12 This smaller fragment directs other normal expression, in macrophages in the spleen, during wound healing in murine corneas, and in the bone, cartilage, and nervous system during development.21

We have also observed expression in the cells at the junction of the sebaceous gland and the hair shaft in the hair follicles, recalling the interesting association between decreased MMP-9 expression and aberrant hair formation in mice engineered to have a genetic deficiency of ets-2.50

In this study, we found that the smaller fragment was activated coincident with tumors developing the ability to invade. This finding indicates that there is an alteration in the transcriptional regulation of cells as they become invasive and that the shorter MMP-9 promoter can monitor this change. Whether other elements further upstream will alter this expression pattern remains to be determined. Nonetheless, the requirement of MMP-9 for metastasis in other systems is consistent with the temporal pattern of MMP-9 expression during tumor progression.


    Footnotes
 
Address reprint requests to Ruth J. Muschel, M.D., Ph.D., Room 269, John Morgan Building, Department of Pathology and Laboratory Medicine, 3620 Hamilton Walk, University of Pennsylvania, Philadelphia, PA 19104.

Supported by National Institutes of Health grant RO1 NCI CA-46830 (to R. J. M). W. J. M. is supported by a Medical Research Council of Canada Scientist Award.

Accepted for publication September 8, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Siegel PM, Hardy WR, Muller WJ: Mammary gland neoplasia: insights from transgenic mouse models. Bioessays 2000, 22:554-563[Medline]
  2. Munn RJ, Webster M, Muller WJ, Cardiff RD: Histopathology of transgenic mouse mammary tumors (a short atlas). Semin Cancer Biol 1995, 6:153-158[Medline]
  3. Guy CT, Cardiff RD, Muller WJ: Induction of mammary tumors by expression of polyomavirus middle T oncogene: a transgenic mouse model for metastatic disease. Mol Cell Biol 1992, 12:954-961[Abstract/Free Full Text]
  4. Fusenig NE, Boukamp P: Multiple stages and genetic alterations in immortalization, malignant transformation, and tumor progression of human skin keratinocytes. Mol Carcinog 1998, 23:144-158[Medline]
  5. Nagase H, Woessner JF, Jr: Matrix metalloproteinases. J Biol Chem 1999, 274:21491-21494[Free Full Text]
  6. Yu Q, Stamenkovic I: Localization of matrix metalloproteinase 9 to the cell surface provides a mechanism for CD44-mediated tumor invasion. Genes Dev 1999, 13:35-48[Abstract/Free Full Text]
  7. Toth M, Sado Y, Ninomiya Y, Fridman R: Biosynthesis of alpha2(IV) and alpha1(IV) chains of collagen IV and interactions with matrix metalloproteinase-9. J Cell Physiol 1999, 180:131-139[Medline]
  8. Hua J, Muschel RJ: Inhibition of matrix metalloproteinase 9 expression by a ribozyme blocks metastasis in a rat sarcoma model system. Cancer Res 1996, 56:5279-5284[Abstract/Free Full Text]
  9. Sehgal G, Hua J, Bernhard EJ, Sehgal I, Thompson TC, Muschel RJ: Requirement for matrix metalloproteinase-9 (gelatinase B) expression in metastasis by murine prostate carcinoma. Am J Pathol 1998, 152:591-596[Abstract]
  10. Fini ME, Cook JR, Mohan R, Brinckerhoff CE: Regulation of matrix metalloproteinase gene expression. Parks W Meacham R eds. Matrix Metalloproteinases. 1998, :pp 350-356 Academic Press, San Diego
  11. Sato H, Seiki M: Regulatory mechanism of 92 kDa type IV collagenase gene expression which is associated with invasiveness of tumor cells. Oncogene 1993, 8:395-405[Medline]
  12. Munaut C, Salonurmi T, Kontusaari S, Reponen P, Morita T, Foidart JM, Tryggvason K: Murine matrix metalloproteinase 9 gene. 5'-upstream region contains cis-acting elements for expression in osteoclasts and migrating keratinocytes in transgenic mice. J Biol Chem 1999, 274:5588-5596[Abstract/Free Full Text]
  13. Fini ME, Bartlett JD, Matsubara M, Rinehart WB, Mody MK, Girard MT, Rainville M: The rabbit gene for 92-kDa matrix metalloproteinase. Role of AP1 and AP2 in cell type-specific transcription. J Biol Chem 1994, 269:28620-28628[Abstract/Free Full Text]
  14. Sato H, Kita M, Seiki M: v-Src activates the expression of 92-kDa type IV collagenase gene through the AP-1 site and the GT box homologous to retinoblastoma control elements: a mechanism regulating gene expression independent of that by inflammatory cytokines. J Biol Chem 1993, 268:23460-23468[Abstract/Free Full Text]
  15. Farina AR, Tacconelli A, Vacca A, Maroder M, Gulino A, Mackay AR: Transcriptional up-regulation of matrix metalloproteinase-9 expression during spontaneous epithelial to neuroblast phenotype conversion by SK-N-SH neuroblastoma cells, involved in enhanced invasivity, depends upon GT-box and nuclear factor kappaB elements. Cell Growth Differ 1999, 10:353-367[Abstract/Free Full Text]
  16. Watabe T, Yoshida K, Shindoh M, Kaya M, Fujikawa K, Sato H, Seiki M, Ishii S, Fujinaga K: The Ets-1 and Ets-2 transcription factors activate the promoters for invasion-associated urokinase and collagenase genes in response to epidermal growth factor. Int J Cancer 1998, 77:128-137[Medline]
  17. Himelstein BP, Lee EJ, Sato H, Seiki M, Muschel RJ: Tumor cell contact mediated transcriptional activation of the fibroblast matrix metalloproteinase-9 gene: involvement of multiple transcription factors including Ets and an alternating purine-pyrimidine repeat. Clin Exp Metastasis 1998, 16:169-177[Medline]
  18. Himelstein BP, Lee EJ, Sato H, Seiki M, Muschel RJ: Transcriptional activation of the matrix metalloproteinase-9 gene in an H-ras and v-myc transformed rat embryo cell line. Oncogene 1997, 14:1995-1998[Medline]
  19. Gum R, Lengyel E, Juarez J, Chen JH, Sato H, Seiki M, Boyd D: Stimulation of 92-kDa gelatinase B promoter activity by ras is mitogen-activated protein kinase kinase 1-independent and requires multiple transcription factor binding sites including closely spaced PEA3/ets and AP-1 sequences. J Biol Chem 1996, 271:10672-10680[Abstract/Free Full Text]
  20. Bond M, Fabunmi RP, Baker AH, Newby AC: Synergistic upregulation of metalloproteinase-9 by growth factors and inflammatory cytokines: an absolute requirement for transcription factor NF-kappa B. FEBS Lett 1998, 435:29-34[Medline]
  21. Mohan R, Rinehart WB, Bargagna-Mohan P, Fini ME: Gelatinase B/lacZ transgenic mice, a model for mapping gelatinase B expression during developmental and injury-related tissue remodeling. J Biol Chem 1998, 273:25903-25914[Abstract/Free Full Text]
  22. Hennings H, Glick AB, Lowry DT, Krsmanovic LS, Sly LM, Yuspa SH: FVB/N mice: an inbred strain sensitive to the chemical induction of squamous cell carcinomas in the skin. Carcinogenesis 1993, 14:2353-2358[Abstract/Free Full Text]
  23. Miyajima Y, Nakano R, Morimatsu M: Analysis of expression of matrix metalloproteinases-2 and -9 in hypopharyngeal squamous cell carcinoma by in situ hybridization. Ann Otol Rhinol Laryngol 1995, 104:678-684[Medline]
  24. Canete-Soler R, Litzky L, Lubensky I, Muschel RJ: Localization of the 92 kd gelatinase mRNA in squamous cell and adenocarcinomas of the lung using in situ hybridization. Am J Pathol 1994, 144:518-527[Abstract]
  25. Pyke C, Ralfkiaer E, Huhtala P, Hurskainen T, Dano K, Tryggvason K: Localization of messenger RNA for Mr 72,000 and 92,000 type IV collagenases in human skin cancers by in situ hybridization. Cancer Res 1992, 52:1336-1341[Abstract/Free Full Text]
  26. Heissenberg MC, Gorogh T, Lippert BM, Werner JA: Metalloproteinases and their inhibitors in squamous cell carcinoma of the hypopharynx: indicators of individual tumor aggressiveness. Otolaryngol Pol 1998, 52:521-526[Medline]
  27. Hong SS, Lee JJ, Lim CC: Expression of matrix metalloproteinase-2 and -9 in oral squamous cell carcinomas with regard to the metastatic potential. Oral Oncol 2000, 36:207-213[Medline]
  28. Shindoh M, Higashino F, Kaya M, Yasuda M, Funaoka K, Hanzawa M, Hida K, Kohgo T, Amemiya A, Yoshida K, Fujinaga K: Correlated expression of matrix metalloproteinases and ets family transcription factor E1A-F in invasive oral squamous-cell-carcinoma-derived cell lines. Am J Pathol 1996, 148:693-700[Abstract]
  29. Borchers AH, Steinbauer H, Schafer BS, Kramer M, Bowden GT, Fusenig NE: Fibroblast-directed expression and localization of 92-kDa type IV collagenase along the tumor-stroma interface in an in vitro three-dimensional model of human squamous cell carcinoma. Mol Carcinog 1997, 19:258-266[Medline]
  30. MacDougall JR, Bani MR, Lin Y, Muschel RJ, Kerbel RS: ‘Proteolytic switching’: opposite patterns of regulation of gelatinase B and its inhibitor TIMP-1 during human melanoma progression and consequences of gelatinase B overexpression. Br J Cancer 1999, 80:504-512[Medline]
  31. Lebeau A, Nerlich AG, Sauer U, Lichtinghagen R, Lohrs U: Tissue distribution of major matrix metalloproteinases and their transcripts in human breast carcinomas. Anticancer Res 1999, 19:4257-4264[Medline]
  32. Jones JL, Glynn P, Walker RA: Expression of MMP-2 and MMP-9, their inhibitors, and the activator MT1-MMP in primary breast carcinomas. J Pathol 1999, 189:161-168[Medline]
  33. Remacle AG, Noel A, Duggan C, McDermott E, O’Higgins N, Foidart JM, Duffy MJ: Assay of matrix metalloproteinases types 1, 2, 3 and 9 in breast cancer. Br J Cancer 1998, 77:926-931[Medline]
  34. Rha SY, Yang WI, Kim JH, Roh JK, Min JS, Lee KS, Kim BS, Chung HC: Different expression patterns of MMP-2 and MMP-9 in breast cancer. Oncol Rep 1998, 5:875-879[Medline]
  35. Rha SY, Kim JH, Roh JK, Lee KS, Min JS, Kim BS, Chung HC: Sequential production and activation of matrix-metalloproteinase-9 (MMP-9) with breast cancer progression. Breast Cancer Res Treat 1997, 43:175-181[Medline]
  36. Heppner KJ, Matrisian LM, Jensen RA, Rodgers WH: Expression of most matrix metalloproteinase family members in breast cancer represents a tumor-induced host response. Am J Pathol 1996, 149:273-282[Abstract]
  37. Soini Y, Hurskainen T, Hoyhtya M, Oikarinen A, Autio-Harmainen H: 72 KD and 92 KD type IV collagenase, type IV collagen, and laminin mRNAs in breast cancer: a study by in situ hybridization. J Histochem Cytochem 1994, 42:945-951[Abstract]
  38. Pacheco MM, Mourao M, Mantovani EB, Nishimoto IN, Brentani MM: Expression of gelatinases A and B, stromelysin-3 and matrilysin genes in breast carcinomas: clinico-pathological correlations. Clin Exp Metastasis 1998, 16:577-585[Medline]
  39. Kondapaka SB, Fridman R, Reddy KB: Epidermal growth factor and amphiregulin up-regulate matrix metalloproteinase-9 (MMP-9) in human breast cancer cells. Int J Cancer 1997, 70:722-726[Medline]
  40. Johnson MD, Torri JA, Lippman ME, Dickson RB: Regulation of motility and protease expression in PKC-mediated induction of MCF-7 breast cancer cell invasiveness. Exp Cell Res 1999, 247:105-113[Medline]
  41. Mira E, Manes S, Lacalle RA, Marquez G, Martinez AC: Insulin-like growth factor I-triggered cell migration and invasion are mediated by matrix metalloproteinase-9. Endocrinology 1999, 140:1657-1664[Abstract/Free Full Text]
  42. Hanzawa M, Shindoh M, Higashino F, Yasuda M, Inoue N, Hida K, Ono M, Kohgo T, Nakamura M, Notani K, Fukuda H, Totsuka Y, Yoshida K, Fujinaga K: Hepatocyte growth factor upregulates E1AF that induces oral squamous cell carcinoma cell invasion by activating matrix metalloproteinase genes. Carcinogenesis 2000, 21:1079-1085[Abstract/Free Full Text]
  43. Saez E, Rutberg SE, Mueller E, Oppenheim H, Smoluk J, Yuspa SH, Spiegelman BM: c-fos is required for malignant progression of skin tumors. Cell 1995, 82:721-732[Medline]
  44. Young MR, Li JJ, Rincon M, Flavell RA, Sathyanarayana BK, Hunziker R, Colburn N: Transgenic mice demonstrate AP-1 (activator protein-1) transactivation is required for tumor promotion. Proc Natl Acad Sci USA 1999, 96:9827-9832[Abstract/Free Full Text]
  45. Neznanov N, Man AK, Yamamoto H, Hauser CA, Cardiff RD, Oshima RG: A single targeted Ets2 allele restricts development of mammary tumors in transgenic mice. Cancer Res 1999, 59:4242-4246[Abstract/Free Full Text]
  46. Trimble MS, Xin JH, Guy CT, Muller WJ, Hassell JA: PEA3 is overexpressed in mouse metastatic mammary adenocarcinomas. Oncogene 1993, 8:3037-3042[Medline]
  47. Sovak MA, Bellas RE, Kim DW, Zanieski GJ, Rogers AE, Traish AM, Sonenshein GE: Aberrant nuclear factor-kappaB/Rel expression and the pathogenesis of breast cancer. J Clin Invest 1997, 100:2952-2960[Medline]
  48. Dong G, Chen Z, Kato T, Van Waes C: The host environment promotes the constitutive activation of nuclear factor-kappaB and proinflammatory cytokine expression during metastatic tumor progression of murine squamous cell carcinoma. Cancer Res 1999, 59:3495-3504[Abstract/Free Full Text]
  49. Llorens A, Rodrigo I, Lopez-Barcons L, Gonzalez-Garrigues M, Lozano E, Vinyals A, Quintanilla M, Cano A, Fabra A: Down-regulation of E-cadherin in mouse skin carcinoma cells enhances a migratory and invasive phenotype linked to matrix metalloproteinase-9 gelatinase expression. Lab Invest 1998, 78:1131-1142[Medline]
  50. Yamamoto H, Flannery ML, Kupriyanov S, Pearce J, McKercher SR, Henkel GW, Maki RA, Werb Z, Oshima RG: Defective trophoblast function in mice with a targeted mutation of Ets2. Genes Dev 1998, 12:1315-1326[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
T. Namba, T. Homan, T. Nishimura, S. Mima, T. Hoshino, and T. Mizushima
Up-regulation of S100P Expression by Non-steroidal Anti-inflammatory Drugs and Its Role in Anti-tumorigenic Effects
J. Biol. Chem., February 13, 2009; 284(7): 4158 - 4167.
[Abstract] [Full Text] [PDF]


Home page
Anticancer ResHome page
S. KNIPPEN, T. LONING, V. MULLER, C. SCHRODER, F. JANICKE, and K. MILDE-LANGOSCH
Expression and Prognostic Value of Activating Transcription Factor 2 (ATF2) and its Phosphorylated Form in Mammary Carcinomas
Anticancer Res, January 1, 2009; 29(1): 183 - 189.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. M. Lamar, K. M. Pumiglia, and C. M. DiPersio
An Immortalization-Dependent Switch in Integrin Function Up-regulates MMP-9 to Enhance Tumor Cell Invasion
Cancer Res., September 15, 2008; 68(18): 7371 - 7379.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. D. Martin, K. J. Carter, S. R. Jean-Philippe, M. Chang, S. Mobashery, S. Thiolloy, C. C. Lynch, L. M. Matrisian, and B. Fingleton
Effect of Ablation or Inhibition of Stromal Matrix Metalloproteinase-9 on Lung Metastasis in a Breast Cancer Model Is Dependent on Genetic Background
Cancer Res., August 1, 2008; 68(15): 6251 - 6259.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
T. Okawa, C. Z. Michaylira, J. Kalabis, D. B. Stairs, H. Nakagawa, C. Andl, C. N. Johnstone, A. J. Klein-Szanto, W. S. El-Deiry, E. Cukierman, et al.
The functional interplay between EGFR overexpression, hTERT activation, and p53 mutation in esophageal epithelial cells with activation of stromal fibroblasts induces tumor development, invasion, and differentiation
Genes & Dev., November 1, 2007; 21(21): 2788 - 2803.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Yan and R. Shao
Transduction of a Mesenchyme-specific Gene Periostin into 293T Cells Induces Cell Invasive Activity through Epithelial-Mesenchymal Transformation
J. Biol. Chem., July 14, 2006; 281(28): 19700 - 19708.
[Abstract] [Full Text] [PDF]


Home page
Toxicol PatholHome page
M. B. Genter, B. M. Warner, H.-W. Krell, and B. Bolon
Reduction of Alachlor-Induced Olfactory Mucosal Neoplasms by the Matrix Metalloproteinase Inhibitor Ro 28-2653
Toxicol Pathol, August 1, 2005; 33(5): 593 - 599.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M. Jorda, D. Olmeda, A. Vinyals, E. Valero, E. Cubillo, A. Llorens, A. Cano, and A. Fabra
Upregulation of MMP-9 in MDCK epithelial cell line in response to expression of the Snail transcription factor
J. Cell Sci., August 1, 2005; 118(15): 3371 - 3385.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
W. Debinski and D. M. Gibo
Fos-Related Antigen 1 Modulates Malignant Features of Glioma Cells
Mol. Cancer Res., April 1, 2005; 3(4): 237 - 249.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
W. Tangkeangsirisin and G. Serrero
PC cell-derived growth factor (PCDGF/GP88, progranulin) stimulates migration, invasiveness and VEGF expression in breast cancer cells
Carcinogenesis, September 1, 2004; 25(9): 1587 - 1592.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Sanceau, S. Truchet, and B. Bauvois
Matrix Metalloproteinase-9 Silencing by RNA Interference Triggers the Migratory-adhesive Switch in Ewing's Sarcoma Cells
J. Biol. Chem., September 19, 2003; 278(38): 36537 - 36546.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
H. Wang, J. Hicks, P. Khanbolooki, S.-J. Kim, C. Yan, Y. Wang, and D. Boyd
Transgenic Mice Demonstrate Novel Promoter Regions for Tissue-Specific Expression of the Urokinase Receptor Gene
Am. J. Pathol., August 1, 2003; 163(2): 453 - 464.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
F. Capozza, T. M. Williams, W. Schubert, S. McClain, B. Bouzahzah, F. Sotgia, and M. P. Lisanti
Absence of Caveolin-1 Sensitizes Mouse Skin to Carcinogen-Induced Epidermal Hyperplasia and Tumor Formation
Am. J. Pathol., June 1, 2003; 162(6): 2029 - 2039.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
T. M. Williams, M. W.-C. Cheung, D. S. Park, B. Razani, A. W. Cohen, W. J. Muller, D. Di Vizio, N. G. Chopra, R. G. Pestell, and M. P. Lisanti
Loss of Caveolin-1 Gene Expression Accelerates the Development of Dysplastic Mammary Lesions in Tumor-Prone Transgenic Mice
Mol. Biol. Cell, March 1, 2003; 14(3): 1027 - 1042.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Sanceau, D. D. Boyd, M. Seiki, and B. Bauvois
Interferons Inhibit Tumor Necrosis Factor-alpha -mediated Matrix Metalloproteinase-9 Activation via Interferon Regulatory Factor-1 Binding Competition with NF-kappa B
J. Biol. Chem., September 13, 2002; 277(38): 35766 - 35775.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Yan, H. Wang, and D. D. Boyd
ATF3 Represses 72-kDa Type IV Collagenase (MMP-2) Expression by Antagonizing p53-dependent trans-Activation of the Collagenase Promoter
J. Biol. Chem., March 22, 2002; 277(13): 10804 - 10812.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Jiang and R. J. Muschel
Regulation of Matrix Metalloproteinase-9 (MMP-9) by Translational Efficiency in Murine Prostate Carcinoma Cells
Cancer Res., March 1, 2002; 62(6): 1910 - 1914.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kupferman, M. E.
Right arrow Articles by Muschel, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kupferman, M. E.
Right arrow Articles by Muschel, R. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS