(American Journal of Pathology. 2001;158:19-24.)
© 2001 American Society for Investigative Pathology
Identification of a Novel Gene with Increasing Rate of Suppression in High Grade Prostate Cancers
Yan Ping Yu,
Fan Lin,
Michelle Bisceglia,
Diane Krill,
Rajiv Dhir,
Michael Becich and
Jian-Hua Luo
From the Department of Pathology, University of Pittsburgh School
of Medicine, Pittsburgh, Pennsylvania
 |
Abstract
|
|---|
Prostate cancer is the second leading cause of cancer-related
deaths in the United States. However, the underlying molecular
events for prostate cancer development are not clear. In this
study, we applied the recently developed technology known as
differential subtraction chain (DSC) to identify a novel gene whose
expression is inactivated in high grade prostate cancer. This
gene, designated as SAPC, is expressed in
normal prostate acinar cells. Its expression is dramatically
down-regulated in high grade prostate cancers (4/4) but is unaltered in
low grade prostate cancers. It encodes a 7.7-kd protein. Its sequence
shares some homology with the cysteine-rich domain of
2–5A-dependent RNase L, which is a critical component
of the interferon-induced apoptosis cascade. The selective inactivation
in the more aggressive prostate cancers holds promise for
SAPC as a potential prognostic marker for high grade
prostate cancer.
|
Introduction
|
|---|
Prostate cancer is one of the most frequently diagnosed
malignancies in American men. Approximately 40,000 people die from this
disease annually.1
Despite the recent advances in our
understanding of the environmental, hormonal, and nutritional
etiologies of prostate cancer, much remains to be learned about the
pathogenesis of prostate cancer.
The prostate gland is an organ with a unique predilection for abnormal
growth along with advancing age. Although the incidence of prostate
cancer is frequent, occurring in almost one-third of men over age
45,2,3
the proportion of cases reaching the stages with
clinical symptoms varies widely among different areas of the
world.4,5
There is strong evidence for both genetic and
environmental factors in prostate cancer development.2
However, it is not clear what molecular events are responsible for the
progression of prostate cancer from a relatively indolent disease to
one that could be life-threatening.
Recently we developed a new technology, termed differential subtraction
chain (DSC), that detects the differences of genomic DNA or mRNA
expression between two types of tissues.6
In comparison
with differential display, DSC has the advantage of evaluating all
species of mRNA in a single trial. With this technique, there is no
need to handle radio-isotope, run sequencing gels, or excise manual
gels for DNA fragment isolation. We applied this technology to prostate
cancer and have identified expression sequences whose expressions were
down-regulated in prostate cancer. One of these genes, designated
SAPC (suppressed in
aggressive prostate cancer), was found
to have its expression limited to the epithelium of the normal prostate
gland, but inactivated in prostate cancer with high Gleason score at
advanced clinical stages.
|
Materials and Methods
|
|---|
Full Length cDNA Synthesis
Fresh surgical specimen of prostate cancer tissue was
macrodissected to procure a tumor nodule and was confirmed to be free
of normal prostate glandular tissue by examining multiple levels of
frozen sections. Epithelial cells were separated from stromal cells by
Percoll gradient centrifugation. Total RNA was extracted from
epithelial cells with the Trizol method (Gibco-BRL, Rockville,
MD). The extraction procedure was performed according to
manufacturer’s recommendation. Oligo-d(T)
(TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTV) and a switching primer
BgIIIaG (AGGCAACTGTGCTATCCGAGGGAAGGG) were used in the first
strand cDNA synthesis with 1 µg of total RNA and Superscript II
(Gibco-BRL). For cDNA synthesis of normal prostate tissue, a pool of
total RNA from prostate tissue of 8 normal organ donors was used. This
was followed by polymerase chain reaction (PCR) of 94°C for 1 minute,
then 94°C for 30 seconds, 56°C for 1 minute, and 72°C for 4
minutes for 26 to 30 cycles to amplify the full length cDNA fragments.
cDNA Amplicon Generation
One microgram of cDNA from tumor or normal prostate tissue was
digested with 10 units of DpnII at 37°C for 6 hours. The digestion
mixture was purified by QIAquick PCR purification kit (Qiagen,
Valencia, CA), and ligated with adapter sequences BamIa/Ib
(for normal prostate) (BamIa,
ATGAAGTGCACCCTACGATTCGAG, BamIb,
pGATCCTCGAATCGTAGTGGGCACT) and BamIIa/IIb (for
tumor prostate) (BamIIa,
ATGAGACATGTTTCGTAGCCTAGG, BamIIb,
pGATCCCTAGG CTACG AAACATGTC) by T4 DNA ligase (New England
Biolabs, Beverly, MA) at 25°C for 6 to 16 hours. The ligation mixture
was purified and amplified by PCR (94°C for 1 minute, then 94°C for
30 seconds and 68°C for 3 minutes for 30 cycles).
cDNA DSC
Five hundred nanograms of normal prostate cDNA amplicons were
mixed with 10 µg of prostate cancer cDNA amplicons, which had been
digested with DpnII to remove the attached adapter
sequences, in a total volume of 8 µl. The mixture was then heated to
98°C for 3 minutes, and 2 µl of 5 mol/L NaCl were added to the
reaction to give the final concentration of 1 mol/L while maintaining
the temperature at 98°C. The mixture was then incubated at 98°C for
an additional 2 minutes and hybridized at 67°C for 20 hours. The
hybridization mixture was purified by sodium acetate/ethanol
precipitation. The pellet was then washed with 70% ethanol. The dry
pellet of the hybridization mixture was reconstituted in 50 µl of 1x
Mung bean nuclease buffer and digested with 10 units of Mung bean
nuclease at 30°C for 30 minutes. The digestion products were treated
with 0.5 µl of 10% sodium dodecyl sulfate (SDS) and purified with
ethanol precipitation. The DNA was resuspended in 9 µl of 3x EE (3
mmol/L EDTA, 3mmol/L EPPS, pH 8.0) buffer. One microliter was
removed for PCR (quality control). The remainder of the sample was
reheated to 98°C for rehybridization. This procedure was repeated
twice.
DSC Product Cloning, Colony Screening, and Sequencing
Round 3 DSC products were amplified by PCR (94°C for 1 minute,
then 35 cycles of 94°C for 30 seconds, 68°C for 3 minutes). The
amplified products were visualized by agarose gel electrophoresis. An
aliquot of the amplified products was ligated with TOPO TA
cloning vector (Invitrogen, Carlsbad, CA) and transfected into
Escherichia coli. Fifteen colonies were randomly picked and
grown overnight in LB broth with 100 µg/ml of ampicillin. Aliquots of
the bacterial culture were spotted onto colony screen filter and
hybridized with amplicons generated from normal or tumor prostate
tissues. To identify which DSC fragment was not present in the tumor
specimen, only those colonies without hybridization signal for tumor
amplicons but positive for normal amplicons were selected. DNA was
extracted from the selected colonies and sequenced using M13 forward
and reverse primers.
Obtaining Full Length cDNA
Rapid amplification of cDNA end (RACE) was used. 5' and 3' ends of
SAPC, a gene fragment identified in the previous procedure,
were amplified with pairs of gene-specific primers and adapter/primers
(gene-specific sense primer/AP1, gene-specific anti-sense primer/AP2)
in PCR (94°C for 1 minute, then 35 cycles of 94°C for 30 seconds,
68°C for 4 minutes.) from Marathon cDNA library of normal prostate
tissue (Clontech, Palo Alto, CA). The RACE products were visualized by
agarose electrophoresis. An aliquot of the RACE products was ligated to
TOPO TA cloning vector. Two hundred colonies were randomly picked and
cultured in Luria-Bertani broth. The overnight cultures were spotted on
genescreen filter and hybridized with 32P-labeled
SAPC DNA fragments. DNA was extracted from colonies that
showed positive reactions and sequenced.
In Situ RNA Hybridization
5' end rhodamine-labeled 24-mer oligonucleotides corresponding to
anti-sense or sense sequence (control) of SAPC were
incubated with pronase digested, prehybridized, 3-µm-thin sections of
prostate tissue from polyester-embedded tissue blocks at 37°C for 12
hours in hybridization solution. The slides were then washed twice with
2x standard saline citrate for 15 minutes, and then twice with 1x
standard saline citrate for 15 minutes.7
In Vitro Transcription and Translation
A 1.5-kb PCR product of SAPC was ligated to pCR2
vector. One microgram of the purified DNA from the selected colonies
was used in a TNT Couple Wheat Germ Extract system (Promega, Madison,
WI) for in vitro transcription and translation assay. The
procedure was performed according to the manufacturer’s instruction.
|
Results
|
|---|
To identify gene expression inactivation in prostate cancer,
prostate cancer cell cDNA amplicons were used as drivers in a DSC
reaction to subtract the counterparts from a pool of normal prostates.
After 3 rounds of DSC as shown in Figure 1A, a
distinct banding pattern was
obtained. These DSC products were subcloned into TOPO TA cloning
vector. Fifteen colonies were randomly picked and hybridized with
amplicons from tumors and normal prostate tissues. The DNA inserts from
those colonies that gave positive signals in hybridization with
amplicons from normal cells but negative from cancer cells were
interpreted as specific for normal prostate; thus, expression was
inactivated in prostate cancer. From those colonies that contain
inserts specific for normal prostate tissues, the DNA fragments were
extracted and sequenced. Most of the DSC cDNA fragments obtained
through this procedure represent previously unknown sequences. Three of
the 15 colonies were determined to contain the same sequence.
This sequence, designated SAPC, was used as a probe to
hybridize with total RNA from normal and tumor samples that were used
to produce cDNA amplicons. As shown in Figure 1D, a
band corresponding
to a 1.6-kb mRNA is identified in the normal prostate tissue in a
Northern blot analyses. To further confirm the specificity of this DNA
fragment, PCR was performed on amplicons generated from prostate cancer
or normal prostate tissues. No PCR product was amplified from the tumor
sample. In contrast, a 120-bp DNA fragment was identified in the normal
prostate tissue (Figure 1B)
. Similar results were also obtained in
RT-PCR (Figure 1C)
, confirming the inactivation of expression of this
cDNA fragment in prostate cancer.
View larger version (48K):
[in this window]
[in a new window]
|
Figure 1. Identification of SAPC through differential subtraction
chain. A: Agarose electrophoresis of PCR amplified DSC
products after rounds 0 (lane
1), 1 (lane
2), 2 (lane
3), and 3
(lane 4).
B: PCR on cDNA amplicons generated from normal prostate
tissues (lane
1) and prostate cancer
(lane 2) with
primers specific for SAPC. The primer sequences are
AAAACTCTGGATTGCCGACTCTGC and CCATTAGGCAAGTCAAAGCATTTC. C:
RT-PCR on total RNA isolated from normal prostate and prostate cancer
using primers specific for SAPC as of B. Primers
specific for ubiquitin were used as control. The primer sequences are
GACGCAAACATGCAGATCTTTGTG and AATGAAAGGGACACTTTATTGAGG. D:
Northern blot analysis of SAPC expression on total RNA
isolated from normal prostate tissues
(lanes 1 and
3) and prostate cancer
(lanes 2 and
4). Random primed
32P labeled SAPC fragment was used as
a probe.
|
|
A survey study was performed to investigate whether inactivation of
this cDNA fragment also occurs in other prostate cancer cases. A panel
of 16 prostate cancer cases of various clinical stages and Gleason
scores was tested by reverse transcriptase (RT) PCR to examine the
expression status of SAPC (Table 1)
. As shown in Figure 2, 3
of 16 prostate cancer cases from
frozen tissues had the inactivation of expression of this gene.
Interestingly, the clinical stage, Gleason score and seminal vesical
involvement of two of these prostate cancer cases were similar to the
case where SAPC was originally identified, whereas the third
case presented with a distant metastasis. All four cases where
SAPC expression was inactivated shared the features of
higher Gleason scores,8,9
extensive seminal vesicle
involvement and multiple foci of capsular penetration. In three cases,
there were metastases of prostate cancer. These features generally
characterized more aggressive prostate cancer. In contrast, the 13
other cases of prostate cancer that were positive for SAPC
expression were characterized with lower Gleason
score,5-7
no seminal vesicle involvement, negative
lymph node metastasis, and few with capsular penetration.
View larger version (48K):
[in this window]
[in a new window]
|
Figure 2. Expression of SAPC in prostate cancer. A: Agarose
electrophoresis of RT-PCR products generated from 1 µg total RNA
obtained from microdissected prostate cancer cells
(middle panel)
and paired normal prostate tissues (upper
panel) with primers specific for
SAPC. Sixteen cases of prostate cancer were shown from case
#1 (lane 1)
through #16 (lane
15). Lower panel represents
RT-PCR products of ubiquitin from the same tumor RNA samples of the
middle panel. PCR was performed under the following condition: 94°C
for 1 minute, then 26 cycles of 94°C for 30 seconds and 68°C for 3
minutes. B: Hematoxylin and eosin
(H&E) stains and RNA
in situ hybridization with SAPC on normal
prostate tissue. H&E stain
(upper) and
RNA in situ hybridization of SAPC
(lower) on
normal prostate tissue. C: H&E stain
(upper) and
RNA in situ hybridization with SAPC
(lower) on an
intermediate grade prostate cancer with a Gleason score of 3 + 3 =
6. D: H&E stains and RNA in situ hybridization
with SAPC on a high grade prostate cancer with a Gleason
score of 4 + 4 = 8.
|
|
View larger version (76K):
[in this window]
[in a new window]
|
Figure 3. Expression of SAPC in 24 different types of human organs.
RT-PCR products of SAPC were produced from total RNA of 24
organ tissues with primers specific for SAPC. The specific
organs are indicated under each lane. PCR was performed for 35 cycles.
Positive controls with primers specific for actin were performed
(data not shown).
|
|
To identify cells or structure within the prostate glands that are
expressing SAPC, in situ hybridization with
oligonucleotides corresponding to SAPC coding region as
probes was performed on normal prostate tissue. As shown in Figure 2B
,
the expression of SAPC mRNA was restricted to prostate
acinar cells, with the strongest expression occurring at the top layer
of the epithelium. In contrast, the expression of SAPC was
strongly suppressed in a high grade prostate cancer (Gleason score 4 +
4 = 8; Figure 2D
), whereas the expression of SAPC was
essentially unchanged in an intermediate grade prostate cancer (Figure 2C)
. To investigate whether the expression of SAPC is
specific for prostate tissue, RT-PCR was performed on the tissues of 24
different human organs. As demonstrated in Figure 3
, in addition to prostate, the
expression of SAPC was also identified in placenta, kidney,
lung, adrenal gland, spleen, and heart.
To obtain the full length SAPC cDNA from normal prostate
tissue, RACE with gene-specific primers derived from SAPC
sequences was performed. A 1.6-kb cDNA fragment was obtained. As shown
in Figure 4A
, this DNA fragment contains
an open reading frame that encodes a 64-amino acid protein. A homology
search of this protein indicates that it shares weak (60% positive)
homology with the cysteine-rich domain of 2–5A-dependent RNase L
(Figure 4B)
. To determine the orientation of SAPC cDNA and
to rule out the potential artifacts generated during the library
construction process, reverse transcriptions were performed using
primers corresponding to the putative sense and anti-sense orientation
of SAPC, respectively. Subsequently, PCRs were performed to
detect the presence of reverse transcription products. As shown in
Figure 4C
, RT-PCR with the primer of the putative anti-sense direction
(lane 2) generated a SAPC PCR product, whereas the sense
primer (lane 1) did not. This confirms the orientation of
SAPC mRNA, where the 64-amino acid open reading frame is
located. To test whether this open reading frame is indeed functioning,
in vitro transcription and translation with a plasmid
containing the full length cDNA of SAPC were performed. A
7.7-kd protein was identified in a SDS-PAGE (Figure 4D)
, consistent
with the predicted molecular weight of the SAPC gene
product.
View larger version (75K):
[in this window]
[in a new window]
|
Figure 4. Open reading frame of SAPC and its homology with
2–5A-dependent RNase L. A: Nucleotide sequence and the
correspondent amino acid sequence of SAPC. B:
Amino acid sequence homology of SAPC with cysteine-rich
domain of 2–5A-dependent RNase L. C: Identifying the
orientation of SAPC cDNA. One microgram of total RNA from
normal prostate tissues was reverse transcribed with a primer
(CCATTAGGCAAGTCAAAGCATTTC, lane
1) corresponding to the putative sense
orientation of SAPC DNA fragment and a primer
(AAAACTCTGGATTGCCGACTCTGC, lane
2) corresponding to the putative
anti-sense, respectively. The SAPC DNA was subsequently
amplified with primers corresponding to the downstream SAPC
DNA
(GCATTTCTCTAGAACTGCCTGAGGGCAG/GATTGCCGACTCTGCACATCCTGGTTCC).
D: In vitro transcription and in vitro
translation of SAPC gene product. Vectors pCR2.1 containing
full length SAPC cDNA fragment
(lane 2) or
containing no insert (lane
1) were in vitro transcribed and
translated with S35-methionine. The translation
products were separated with SDS-PAGE.
|
|
|
Discussion
|
|---|
Currently, histological classification of prostate cancer,
specifically Gleason grading and pathological staging, is the mainstay
of prognostic assessment once a cancer is verified by tissue sampling.
However, to produce an accurate Gleason score and staging, extensive
tissue sampling is required. This may limit the usefulness of
histological classification when the amount of diagnostic tissue is
small, such as when needle core biopsy samples are used.
Molecular markers with prognostic significance may be of great value in
assessing the invasiveness of a tumor. Suppression of SAPC
expression in cancer cells correlates well (4/4) with the metastatic
and aggressive behavior of prostate cancers. Examining the expression
of SAPC in prostate cancer tissues may help to predict the
stages of the disease. It will be of interest to see whether change in
expression status of SAPC occurs in the early stages of
aggressive prostate cancers.
Although the functional role of SAPC has not been
established, there are some probabilities that SAPC may
interact with 2–5A-dependent RNase L in vivo. First,
SAPC is expressed mostly in terminally differentiated cells,
as evidenced by the most intense staining in the top layer of
epithelial cells of prostate glands. Its expression is dramatically
decreased when cells are stimulated with serum growth factors (data not
shown). Second, SAPC contains weak but distinctive homology
with the cysteine-rich region of 2–5A-dependent RNase L, which is
thought to be essential for dimerization and for protein-protein
interaction.8
It has been shown that expression and
activation of 2–5A-dependent RNase L is required for cells undergoing
apoptosis and differentiation.9-11
Decreased expression
of 2–5A-dependent RNase L is found in proliferating
cells.12
The regulation of cell cycle by 2–5A-dependent
RNase L is thought to occur through regulating the overall level
of RNA.13
It is tempting to hypothesize that
SAPC regulates the cell cycle through its interaction with
2–5A-dependent RNase L. However, the direct evidence of physical
interaction between SAPC and 2–5A-dependent RNase L, and
the effect of SAPC on RNA level must await the ongoing
complex formation study between SAPC and 2–5A-dependent
RNase L and the SAPC functional study.
The significance of suppression of SAPC expression is not
clear. However, in view of the fact that most of its expression
inactivation occurs exclusively in high Gleason score prostate
cancer, it is reasonable to postulate that the suppression of
SAPC expression represents a distinctive genetic event in
the prostate cancer development that underlies a more aggressive
behavior. Expression of SAPC is restricted to several
organs. In situ hybridization suggests that its expression
is present in prostate acinar cells, in certain area of proximal
tubules of the kidney and the lobules of the breast (data not shown).
The predominant expression of SAPC in mature and
differentiated epithelium is consistent with the hypothesis that
expression of SAPC is associated with terminal cell
differentiation and possibly programmed cell death. A correlation
between SAPC expression, differentiation, and/or
apoptosis will help to address the hypothesis.
In conclusion, using DSC methodology, we have identified a novel gene
whose expression is frequently inactivated in high grade prostate
carcinoma and may represent an important component in cell
differentiation and apoptosis. It is possible that suppression of
SAPC expression in prostate cancer can be used as a
prognostic factor to evaluate the potential behavior of a prostate
cancer.
|
Acknowledgements
|
|---|
We thank Judy Stoner for technical support and Tracie Wagner
and Petrina DeFlavia for providing prostate tissue.
|
Footnotes
|
|---|
Address reprint requests to Jian-Hua Luo, Department of Pathology, University of Pittsburgh School of Medicine, Scaife Hall A-725, 3550 Terrace Street, Pittsburgh, PA 15260. E-mail: luojh+{at}pitt.edu
Supported by a grant (CRTG-00-139-01-CCE) from the American Cancer Society to J.-H. L.
Accepted for publication September 28, 2000.
|
References
|
|---|
-
Landis SH, Murray T, Bolden S, Wingo PA: Cancer statistics, CA. Cancer J Clin 1999, 49:8-31[Abstract/Free Full Text]
-
Issacs JT: Molecular markers for prostate cancer metastasis. Am J Pathol 1997, 150:1511-1521[Medline]
-
Dohm G: Classification and grading of prostatic carcinoma: recent results. Cancer Res 1977, 60:14-18
-
Yatani R, Chigusa I, Akazaki K, Stemmerman G, Welsh R, Correa P: Geographic pathology of latent prostatic carcinoma. Int J Cancer 1982, 29:611-616[Medline]
-
Breslow N, Chan G, Dhom G, Drury R, Franks L, Gellei B, Lee Y, Lundberg S, Sparke B, Sternby N, Tulinius H: Latent carcinoma of the prostate at autopsy in seven areas. Int J Cancer 1977, 20:680-688[Medline]
-
Luo JH, Puc JA, Slosberg ED, Yao Y, Bruce JN, Wright TC, Becich MJ, Parsons R: Differential subtraction chain, a method for identifying differences in genomic DNA and mRNA. Nucleic Acids Res 1999, 27:24e, i-viii
-
Wang FL, Wang Y, Wong WK, Liu Y, Addivinola FJ, Liang P, Chen LB, Kantoff PW, Pardee AB: Two differentially expressed genes in normal prostate tissue and in carcinoma. Cancer Res 1996, 56:3634-3637[Abstract/Free Full Text]
-
Zhou A, Hassel BA, Silverman RH: Expression cloning of 2–5A-dependent RNase: a uniquely regulated mediator of interferon action. Cell 1993, 72:753-765[Medline]
-
Castelli J, Wood KA, Youle RJ: The 2–5A system in viral infection and apoptosis. Biomed Pharmacother 1998, 52:386-390[Medline]
-
Hovanessian AG, Wood JN: Anticellular and antiviral effects of pppA(2'p5'A)n. Virology 1980, 101:81-90[Medline]
-
Zhou A, Paranjape J, Brown TL, Nie H, Naik S, Dong B, Chang A, Trapp B, Fairchild R, Colmenares C, Silverman RH: Interferon action and apoptosis are defective in mice devoid of 2',5'-oligoadenylate-dependent RNase L. EMBO J 1997, 16:6355-6363[Medline]
-
Rysiecki G, Gewert DR, Williams RRG: Constitutive expression of a 2',5'-oligoadenylate synthetase cDNA results in increased antiviral activity and growth suppression. J Interferon Res 1989, 9:649-657[Medline]
-
Stark G, Dower WJ, Schimke RT, Brown RE, Kerr IM: 2–5A synthetase: assay, distribution and variation with growth or hormone status. Nature 1979, 278:471-473[Medline]
Top
Abstract
Introduction
