| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Short Communication |
and IFN-
Expression in Muscle Fibers with MHC Class I on Sarcolemma
From INSERM U533 Laboratoire de Physiopathologie et Pharmacologie
Cellulaires et Moleculaires-Hotel Dieu,*
Nantes, France; the
Institute of Orthopaedics Rizzoli,
Bologna,
Italy; the Service d’Anatomo-Pathologie-Ecole Nationale
Veterinaire,
Nantes, France; and the Institut
de Myologie,§
Paris, France
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, interferon-
, and p65 subunit of nuclear
factor-
B, molecules known to induce synergistically and to
mediate major histocompatibility complex (MHC) class I
expression, were determined in muscle sections from control and
X-linked vacuolated myopathy patients. MHC class I colocalized with
tumor necrosis factor- and interferon-, as well as
with p65, in most of the membrane attack complex- and/or
calcium-positive muscle fibers in X-linked vacuolated myopathy.
These results suggest that the expression of MHC class I in X-linked
vacuolated myopathy could be induced by tumor necrosis factor- and
interferon- and partly mediated by nuclear
factor-B.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We have demonstrated MHC I expression in
XLVM,2
but the mechanism underlying this expression was
not clearly understood. It is known that interferon (IFN)-
especially, but also tumor necrosis factor (TNF)-, induce
upregulation of major histocompatibility complex (MHC) I and II
molecules in cultured muscle cells, whereas TNF-{beta}, interleukin
(IL)-2, IL-1, and IL-1{beta} displayed no such
induction.5,6
However, IFN- and TNF- are absent most
of the time in the biopsy samples of patients with inflammatory
myopathies, for example.
MHC class I gene expression is synergistically induced by the cytokines
TNF- and IFN-. A portion of this cooperativity is mediated by
synergism between two distinct transcription factors, nuclear factor
(NF)-B and signal transducer and activator of transcription-1
(STAT-1).7
TNF- induces binding of NF-B subunits p50
and p65 to the NF-B-like element of the MHC class I promoter,
whereas IFN- induces the expression of STAT-1.7
Furthermore, IFN-, which typically does not activate NF-B,
synergistically can enhance TNF--induced NF-B nuclear
translocation via a mechanism that involves the induced degradation of
I-B.8
Thus, NF-B, involved in the
inducible regulation of a large number of genes, appears to participate
in the control of MHC class I genes’ basal expression as well as in
their transcriptional upregulation after treatment by TNF- and
IFN-.9
The goals of the present work were (i) to characterize the putative
expression of TNF- and IFN- in muscle fibers of patients with
XLVM and the possible colocalization of these cytokines in muscle
fibers exhibiting MHC class I, and (ii) to study the putative
immunolocalization of NF-B and its relationship with TNF-,
IFN-, and MHC class I in XLVM.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Skeletal muscle biopsy samples were from deltoid muscles of patients presenting with XLVM (n = 5) originating from three French families and from deltoid muscles from nonweak control subjects (n = 5) obtained during surgical intervention. The patients with XLVM presented with the symptomatology previously reported.2 All of these patients fulfilled the pathological criteria for the diagnosis of XLVM (vacuoles in muscle fibers, deposition of MAC in the sarcolemma, and deposition of calcium on the membrane of muscle fibers). We also used biopsy samples of patients diagnosed with acid maltase deficiency, a myopathy with vacuoles in the muscle fibers, as a control. The biopsy specimens of patients with XLVM and acid maltase deficiency were considered as "pre-existing pathological specimens" obtained for diagnostic purposes and did not require informed consent. Informed consent was obtained from control subjects, and the study was approved by the Ethical Committee of the institution.
Antibodies
For immunocytochemistry, we used antibodies anti-developmental
myosin heavy chain (d-MHC), anti-slow myosin heavy chain (s-MHC),
anti-fast myosin heavy chain (f-MHC) (Novocastra, Newcastle upon Tyne,
UK), anti-MAC C5b-C9 (Dako, Carpenteria, CA), anti-p65 subunit
of NF-B, anti-TNF-, and anti-IFN- (Santa Cruz Biotechnology,
Santa Cruz, CA). All antibodies were used according to the
recommendations of the manufacturers.
Morphological Analysis, Histochemistry, and Immunocytochemistry
Muscle specimens were frozen in isopentane cooled in liquid
nitrogen. Transverse cryostat sections (10 µm thick, Frigocut 2800;
Reichert-Jung, Nussloch, Germany) were stained by hematoxylin and
eosin. Calcium staining and immunocytochemistry were performed as
previously reported on 10-µm-thick serial cryostat
sections.2,4
For immunocytochemistry, negative controls
consisted of omission of the primary antibody, preincubation with PBS,
and substitution of non-immune isotype-matched control antibody for
primary antibody. Mouse IgG1 and IgG2a (Dako), rabbit IgG (Dako), and
goat IgG (Dako) were used as controls. The three types of controls
mentioned above were performed for each experiment. p65-, cytokines
(IFN-, TNF-)-positive fibers were counted in cross-sections of
muscle appropriately stained and the number of each was calculated as a
percentage of at least 300 fibers randomly chosen from five different
regions within a section of the muscle using an image analyzer (Phase
Three Imaging Systems, PA).
Reverse Transcription-Polymerase Chain Reaction (RT-PCR)
Total RNA was isolated from muscle samples stored at -80°C
using RNA TRI reagent (Gibco BRL) as instructed by the manufacturer.
First strand cDNA synthesis for RT-PCR for cytokines was primed from 1
µg total RNA with 50 ng random primer under the conditions suggested
by the manufacturer (Qiagen Inc., Chatsworth, CA). PCR was performed
with cytokine-specific primers (Clontech, Palo Alto, CA) according to
the manufacturer’s instructions. PCR conditions were 35 cycles at
94°C for 30 seconds, 55°C for 1 minute, and 72°C for 1 minute,
followed by a final extension at 72°C for 10 minutes. The sequences
of the primers for TNF- were, for the sense primer,
cgggaccgtggagctgggcgaggag and, for the antisense primer,
caccagctggttatctctcagctc. For IFN-, the sequences of the primers
were for the sense primer, atgaaatatacaagttatatcttggcttt and, for the
antisense primer, gatggtcttcgacctcgaaacagcat. The sequences of the
primers for {beta}-actin were for the sense primer,
tgacggggtcacccacactgtgcccatcta and, for the antisense primer,
ctagaagcatttgcggtggacgatggaggg. According to personal unpublished data
and previous results10
showing a strong expression of
{beta}-actin gene expression in muscles, only 1/20th of the
cDNA that was used for amplifying cytokine cDNAs was used to amplify
{beta}-actin cDNA.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B Is Overexpressed in the Cytoplasm of Muscle Fibers in XLVM
Figure 1A
shows that the
immunoreactivity of the p65 subunit of NF-B was faint in the muscle
of normal subjects or in muscle of patients with acid maltase
deficiency (not shown) compared to patients with XLVM. In XLVM,
p65-positive fibers could be small or normal-sized fibers, either
vacuolated or not. No immunoreactivity for p65 was observed in the
vessels and in the conjunctive tissue. Regenerating muscle fibers are
rare in XLVM,2
and p65-positive fibers were rarely
d-MHC-positive fibers (<1% of the p65-positive fibers), but mostly
f-MHC-positive fibers (not shown). The percentage of p65-positive
fibers in XLVM is figured in Table 1
. No
staining was seen after substitution of primary antibody by non-immune
isotype-matched control antibody, or after omission of the primary
antibody.
|
|
and IFN- Are Expressed in Muscle Fibers of Patients with
XLVM
The percentages of TNF-- and IFN--positive fibers are
figured in Table 1
. Figure 1B
shows that TNF- and IFN- were
immunolocalized in muscle fibers of patients with XLVM, and that these
cytokines were most of the time colocalized in muscle fibers exhibiting
a deposition of MAC on the sarcolemma. About 89% of TNF--positive
fibers were IFN--positive. p65 was commonly coimmunocolocalized with
IFN- and TNF- in MAC-positive muscle fibers. Respectively, 92%
of TNF--positive fibers and 88% of IFN--positive-fibers were
p65-positive. No expression of TNF- and IFN- was observed in the
muscle biopsies of control subjects or in the muscle biopsies of
patients with acid maltase deficiency. Substitution of non-immune
isotype-matched control antibody for primary antibody resulted in no
staining, as well as omission of primary antibody. Figure 1C
shows the
expression of TNF- mRNA and IFN- mRNA by RT-PCR in patients with
XLVM, whereas no expression of the mRNA of these cytokines was observed
in normal muscles.
MHC I in Muscle Fibers of XLVM Patients Is Coimmunolocalized with
TNF- and/or IFN-
We have previously shown that the MAC-positive fibers exhibited a
staining of the cell surface membrane with the antibody against the MHC
class I antigen.2
Figure 2
shows that MHC I immunostaining colocalized with MAC and calcium
deposition in XLVM. About 84% of MHC class I-positive fibers were
p65-positive fibers, whereas not all p65-positive fibers were MHC class
I-positive. Most of the MHC class I-positive fibers exhibited
immunoreactivity for TNF- or IFN- (91 and 88%, respectively).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The class I MHC is not found in normal muscle
fibers.11
Several studies described expression of MHC I
and II molecules in inflammatory myopathies and muscular
dystrophies.12-16
However, the relationship between MHC
class I expression and cytokines known to induce it has never been
clearly demonstrated. In fact, if various cytokines and chemokines have
been found in muscle biopsies of inflammatory myopathies and Duchenne
muscular dystrophy (DMD) by a variety of
techniques,10
the expression of cytokines by muscle fibers
themselves was rarely demonstrated in situ in muscle
disorders.12
Because there are very few inflammatory cells
in XLVM,2
it could be suggested that TNF- mRNA and
IFN- mRNA expressions observed on RT-PCR are due to the expression
of the mRNA of these cytokines by the muscle fibers themselves and not
by inflammatory cells, in contrast with inflammatory myopathies, for
example.10
We previously showed an expression of MHC class I in
XLVM.2
In the present paper, we showed that MHC I
expression on the sarcolemma colocalized with TNF- and IFN-
expression in the cytoplasm of MAC- and/or calcium-positive fibers. To
our knowledge, it is the first time that such colocalization has been
demonstrated in muscle fibers. The colocalization of IFN- and
TNF- in the same muscle fibers expressing MHC class I could suggest
that they act synergistically to induce MHC class I expression.
Expression of p65 in XLVM
NF-B regulates the expression of many genes involved in immune
and inflammatory responses, as well as in cell proliferation
and growth: MHC class I genes, immunoglobulins, light chains, IL-2
and its receptor, IL-6, IL-8, granulocyte-macrophage colony-stimulating
factor (GM-CSF), iNOS, interferon-{beta}, T cell receptor {beta}
chain.9
The role of NF-B in muscle biology is not clear yet. During muscle
development, NF-B is required for membrane fusion of chicken
embryonic myoblasts, and downregulation of transcription factors
activator protein-1, Sp-1, and NF-B precedes myocyte
differentiation.17
It has also been shown that cytokines
such as TNF- proved to be potent inducers of transient NF-B
activation in myoblasts.18
Abnormalities of IB/NFB
pathway have rarely been reported in muscle disorders.19
Illa et al demonstrated high expression of the transcription factor
STAT-1 in many perifascicular atrophic muscle fibers from
dermatomyositis patients.20
As we observed it with p65 in
XLVM, the localization was cytoplasmic and not nuclear. STAT-1 is
involved in cell response to IFN-. In vitro, STAT-1 was
stimulated in human myotubes by IFN-.20
Comparing XLVM and DMD, we observed that the main differences between
them were the lower percentage of TNF--positive muscle fibers in DMD
(<5%) compared to XLVM (
50%) and the expression of p65 in
regenerating (dMHC-positive) and in some fast-twitch (f-MHC-positive)
muscle fibers in DMD, whereas this expression was seen only in
fast-twitch muscle fibers in XLVM (manuscript in preparation).
Role of MAC Deposition
Sublytic concentrations of MAC have been shown to induce
endothelial IL-8 and MCP-1 through NF-B activation and, in this way,
it has been proposed that MAC could be considered as an important
mediator of proinflammatory genes expression via NF-B
activation.21
If the present data could suggest that MAC deposition on the muscle
sarcolemma could activate NF-B, the relationship between MAC
deposition and expression of IFN-, for example, is not clear. It is
known that a loop exists between NF-B and TNF-, but nothing
similar has been reported between NF-B and IFN-.
In XLVM, we demonstrated a colocalization of p65, IFN-, and TNF-
in MAC-positive muscle fibers and a colocalization of MHC I, IFN-,
and TNF- in MAC- and/or calcium-positive muscle fibers. These
results could suggest that in XLVM, IFN-, and TNF- induce MHC I
expression, partly via NF-B activation. However, the role of other
transcription factors in the expression of MHC class I in XLVM is
currently under investigation.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Supported in part by the Association Francaise contre les Myopathies (AFM) and the Delegation a la Recherche Clinique (DRCC) du CHU de Nantes.
The two first authors contributed equally to this work.
Accepted for publication November 10, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
B by tumor necrosis factor alpha and gamma interferon via enhanced I kappaB alpha degradation and de novo I kappaB beta degradation. Mol Cell Biol 1997, 17:6746-6754[Abstract]
B: ten years after. Cell 1996, 87:13-20[Medline]
-induced NF-B activation in skeletal muscle-derived L6 cells. Biochem Biophys Res Commun 1997, 237:645-649[Medline]
B pathway in limb-girdle muscular dystrophy type 1A. Nat Med 1999, 5:503-511[Medline]
B activation. Am J Pathol 1997, 150:2019-2031[Abstract]
This article has been cited by other articles:
 |
|
 |
|
  J.-P. Louboutin, B. Liu, B. A.S. Reyes, E. J. Van Bockstaele, and D. S. Strayer Rat Bone Marrow Progenitor Cells Transduced In Situ by rSV40 Vectors Differentiate into Multiple Central Nervous System Cell Lineages Stem Cells, December 1, 2006; 24(12): 2801 - 2809. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. A. Minassian, R. Aiyar, S. Alic, B. Banwell, M. Villanova, M. Fardeau, J. W. Mandell, V. C. Juel, M. Rafii, M. Auranen, et al. Narrowing in on the causative defect of an intriguing X-linked myopathy with excessive autophagy Neurology, August 27, 2002; 59(4): 596 - 601. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
