| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |
From the Department of Medicine,*
Division of Nephrology
and Osteology, University of Hamburg, Hamburg, Germany; and the
Department of Medicine,
Division of
Nephrology, University of Washington School of Medicine,
Seattle, Washington
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cell proliferation is regulated at the level of the cell cycle by cell cycle proteins, where activation of cyclin-dependent kinases (CDK) is required for progression through the cell cycle. In contrast, CDK inhibitors inactivate CDKs, and cause cell cycle arrest. There is a growing body of literature showing that CDK inhibitors may also be critical regulators of cell hypertrophy.8-10 The present study was undertaken to determine the role of the CDK inhibitor p27Kip1 in mediating glucose-induced mesangial cell hypertrophy. We show that in contrast to p27Kip1+/+ mesangial cells, p27Kip1-/- mesangial cells do not undergo glucose-induced hypertrophy. However, reconstituting p27 levels is necessary to induce hypertrophy in p27Kip1-/- cells. Our results provide evidence for a role of p27Kip1 in high glucose-induced hypertrophy of cultured mesangial cells.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Mesangial cells from litter mate p27Kip1+/+ and p27Kip1-/- mice were isolated by differential sieving and characterized as previously described.11 Cells were grown in Dulbecco’s modified Eagle’s medium (Gibco-BRL, Eggenstein, Germany) containing 100 mg/dl D-glucose (G100) supplemented with 10% fetal calf serum, 100 U/ml penicillin, 100 µg/ml streptomycin, and 2 mmol/L glutamine. Mesangial cells were cultured at 37°C in 5% CO2, and passaged every 4 to 5 days. Experiments were done using cells of passages 10 to 20.
Inducible p27Kip1 Expression Construct and Transfections
A full-length mouse p27Kip1 cDNA was constructed using reverse transcriptase-polymerase chain reaction (RT-PCR) techniques. Briefly, total RNA was isolated from murine mesangial cells12 rested in serum-free medium. Ten µg of total RNA was reverse-transcribed using 0.7 µg of poly-d(T)primer (Pharmacia Diagnostics, Freiburg, Germany) in the presence of 500 U of Maloney murine leukemia virus reverse transcriptase diluted in 50 µl of a buffer containing 50 mmol/L Tris-HCl (pH 8.3), 75 mmol/L KCl, 3 mmol/L MgCl2, 10 mmol/L dithiothreitol, and 500 µmol/L dNTP. After incubation for 2 hours at 37°C, 5 µl of the cDNA preparation was directly used for the PCR amplification with 5 µl of 10x amplification buffer, 25 mmol/L MgCl2, 10 mmol/L dNTPs, and 1.5 µl of each primer (50 ng/µl), and 2.5 U Taq-polymerase (Promega, Madison, WI). The following primers specific for the murine p27Kip1 were used: 5'GGGCCACCATGCAAACGTGAGAGTG3', 5'GCTGTTTACGTCTGGCGTCGAAGG3'.13 The 5'end primer contained an optimized Kozak sequence for efficient mRNA translation initiation.14 A total of 40 amplification cycles (denaturing for 30 seconds at 94°C, annealing for 90 seconds at 50°C, and extension for 90 seconds at 72°C) were performed. Fifteen µl of the reaction product were separated in a 1.8% agarose gel containing 0.5 µg/ml ethidium bromide and a single band of the predicted 607 bp was isolated using a DEAE membrane.
The full-length p27Kip1 cDNA was then cloned into the pIND TOPO vector (Invitrogen, Leek, The Netherlands) and the correct orientation was confirmed by sequencing. The expression plasmid pIND contains five modified ecdysone response elements upstream of a minimal heat-shock promoter allowing inducible expression.15 For transient transfections, 105 cells were rested in serum-free medium for 24 hours and were co-transfected with 10 µg of pINDp27Kip1 and 10 µg of the plasmid pVgRXR (Invitrogen) encoding subunits of the ecdysone receptor using lipofectin (Gibco-BRL) as previously described.8 After 12 hours, cells were split into 24- or 96-well plates (for measurement of leucine and thymidine incorporation) or left in cell culture flasks (for Western blots). Cells were then treated with 0 to 5 µg/ml muristone (Invitrogen) to induce p27Kip1 expression.
To establish stabile cell lines, p27Kip1-/- mesangial cells were first transfected with pVgRXR and stable clones were selected in medium with 500 µg/ml Zeocin (Invitrogen) by several rounds of limited dilution. A stable cell line expressing pVgRXR was subsequently transfected with pINDp27Kip1 and selection was then performed in medium with 500 µg/ml of Zeocin and 250 µg/ml of G418 (Sigma). Surviving cells were cloned by three rounds of limited dilution and several stable cell lines containing pVgRXR and pINDp27Kip1 were established. These cell lines were carried normally in medium containing Zeocin and G418 to prevent back mutations.
Measuring the Expression of CDK Inhibitors
A total of 106 cells from the various cell lines and clones were incubated in serum-free G100 or G450 (450 mg/dl D-glucose) medium for 48 hours. To restore p27Kip1 expression, p27Kip1-/- cells were transient-transfected with pINDp27Kip1 or permanent-transfected clones (clones 5.2, 6.2) were treated with 0 to 5 µg/ml of muristone for 24 hours. Cells were rinsed twice in ice-cold phosphate-buffered saline (PBS) at the end of the incubation period. After removing all PBS, monolayers were directly lysed in 150 µl of lysis buffer (2% sodium dodecyl sulfate, 60 mmol/L Tris-HCl, pH 6.8), and the protein content was measured in supernatants after centrifugation by a modification of the Lowry method that is insensitive to the used concentrations of sodium dodecyl sulfate.8 Protein concentrations were adjusted to 80 µg/sample, and 100 mmol/L dithiothreitol, 5% glycerol, and 0.03% bromophenol blue were added and samples were boiled for 5 minutes. After centrifugation, supernatants were loaded onto a 12% sodium dodecyl sulfate-polyacrylamide gel. Low molecular rainbow markers (comprising 2,350 to 45,000 Daltons; Amersham, Braunschweig, Germany) served as the molecular weight standards.
After completion of electrophoresis, proteins were electroblotted onto a nitrocellulose membrane (Highbond-N, Amersham) in transfer buffer (50 mmol/L Tris-HCl, pH 7.0; 380 mmol/L glycine, 20% methanol). Filters were stained with Ponceau S to control for equal loading and transfer. Membranes were blocked for 1 hour at room temperature with 5% nonfat dry milk redissolved in PBS with 0.1% Tween 20. For the detection of p27Kip1 protein, a 1:1,000 dilution of a mouse monoclonal anti-p27Kip1 antibody (Transduction Laboratories, Lexington, MA) was used. This antibody reacts with murine p27Kip1. p21Cip1 protein expression was detected with a mouse monoclonal anti-human p21Cip1 antibody exhibiting cross-reactivity with the murine protein at a 1:500 dilution (DAKO, Glostrup, Denmark). After incubation for another hour, membranes were washed in PBS with 0.1% Tween for 3 x 10 minutes, and a horseradish peroxidase-conjugated rabbit polyclonal anti-mouse antibody (Transduction Laboratories) was added at a 1:1,000 dilution. The luminescence detection of peroxidase activity was performed with the ECL system (Amersham) according to the manufacturer’s recommendations. To control for small variations in protein loading and transfer, membranes were washed and re-incubated with a mouse monoclonal anti-ß-actin antibody (Sigma). Incubation with secondary antibody and detection was performed as described above. Exposed films were scanned with Fluor-S multi-imager (Bio-Rad Laboratories, Hercules, CA), and data were analyzed with the computer program MultiAnalyst from Bio-Rad. Western blots were independently performed three to four times with qualitatively similar results.
Northern Blot Hybridization for TGF-ß and Fibronectin
p27Kip1-/- or +/+ cells (107 cells) were made quiescent in serum-free G100 medium and were stimulated for 48 hours in either serum-free G100 or G450 medium. Some cells were also treated in G100 with 1 ng/ml of ultrapure human transforming growth factor (TGF)-ß1 (Sigma). After washing in RNase-free PBS, cells were directly lysed with acid guanidinium thiocyanate, and total RNA was isolated.5 Equal amounts of total RNA (25 µg per lane) were denatured in formamide-formaldehyde at 65°C and electrophoresed through a 1.2% agarose gel containing 2.2 mol/L formaldehyde. Blotting, hybridization, and washing conditions were exactly as previously described.5 A 0.7-kb PvuII cDNA fragment encoding human fibronectin was used. For control hybridizations, a 2.0-kb cDNA insert of the plasmid pMCI encoding the murine ribosomal 18S band was used. Northern blots were repeated twice with qualitatively similar result.
Determination of TGF-ß Protein in Culture Supernatants
To investigate whether p27Kip1-/- and +/+ mouse mesangial cells increased the synthesis of TGF-ß, 2 x 106 cells were plated in small culture flasks. After incubation for 12 hours in serum-free medium with normal glucose, cells were incubated for another 48 hours in either normal or high glucose medium. The supernatant was harvested and dried using a speed vac. Cell layers were lysed in 0.5 mol/L of NaOH and protein was determined with a modification of the Lowry method. TGF-ß1 protein measurements were performed with a commercially available enzyme-linked immunosorbent assay (Predicta, Genzyme, Cambridge, MA). In brief, dried supernatants were reconstituted in 200 µl of sample diluent, activated by addition of 20 µl of 1 mol/L HCl, and neutralized by 15 µl of 1 mol/L NaOH. Measurements of TGF-ß1 were done according to the manufacturer’s recommendations. Concentrations were calculated as pg TGF-ß1 per µg protein. TGF-ß1 measurements were independently repeated five times with qualitatively similar results.
Measuring Protein and DNA Synthesis
The incorporation of [3H]leucine was used to assess de novo protein synthesis.5,8,9 Cells were plated (105 per well) in 24-well plates, and were made quiescent for 12 hours in normal glucose-containing medium. After an additional 12 hours, the medium was changed to normal glucose or high glucose for another 48 hours. Five µCi of [3H]leucine (142 Ci/mmol, Amersham) were included per well for the last 12 hours. At the end of the incubation period, cells were washed twice in ice-cold PBS and proteins were subsequently precipitated with ice-cold 10% trichloroacetic acid. After redissolving the precipitates in 0.5 mol/L NaOH containing 0.1% Triton X-100, 5 ml of scintillation cocktail (Roth, Karlsruhe, Germany) was added, and vials were measured by liquid scintillation spectroscopy. [3H]leucine incorporation experiments were repeated five times with duplicate measurements for each experiment.
The incorporation of [3H]thymidine into DNA was used to measure proliferation. Cells (104 cells per well) were transferred to a 96-well micrometer plate. After incubation for 12 hours in normal glucose medium, they were subsequently incubated for another 48 hours in either normal or high glucose. They were pulsed with 1 µCi [3H]thymidine (5 Ci/mmol, Amersham) during the last 6 hours of culture. At the end of the incubation period, MMCs were washed in PBS, trypsinized for 10 minutes at 37°C, and finally collected on glass-fiber paper with an automatic cell harvester. Radioactivity of dry filters was measured by liquid scintillation spectroscopy. [3H]thymidine experiments were independently performed four times with triplicate measurements.
A ratio of total protein content to cell number was determined as another parameter of cellular hypertrophy. For this experiment, 105 cells were seeded into each well of a 6-well plate and were made quiescent for 12 hours in normal glucose-containing medium. After incubation for another 48 hours as appropriate, cells were shortly trypsinized, scraped off the plate with a rubber policeman, and were washed twice in PBS. A small aliquot of cells was counted in a Fuchs-Rosenthal chamber after resuspension of cells in PBS. The remaining cells were lysed in 0.5 mol/L NaOH and total protein content was measured by a modified Lowry method. Total protein content was expressed as µg protein per 103 cells. These experiments were independently performed five times.
Statistical Analysis
All values are presented as means ± SEM. Statistical significance among multiple groups was tested with nonparametric Kruskal-Wallis test. Individual groups were then tested using the Wilcoxon-Mann-Whitney test. A P value of < 0.05 was considered significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Figure 1
shows that quiescent
p27Kip1+/+ mesangial cells express
p27Kip1 protein. However, the incubation of
p27Kip1+/+ mesangial cells in serum-free media
with high glucose (450 mg/dl) for 48 to 72 hours increased the levels
of p27Kip1 protein (Figure 1)
(G100 for 48
hours:1.0 ± 0.0; G450 for 48 hours: 4.8 ± 0.6*; G450 for 72
hours: 6.2 ± 0.8* relative changes in
p27Kip1 expression normalized to ß-actin;
*P < 0.05, n = 3.). As expected,
p27Kip1 protein expression was totally absent in
p27Kip1-/- mesangial cells and was not induced
by high glucose (Figure 1)
.
|
(p27Kip1-/- G100 for 48 hours: 1.0 ± 0.0;
p27Kip1-/- G450 for 48 hours: 8.1 ± 1.1*;
p27Kip1+/+ G100 for 48 hours: 1.0 ± 0.0,
p27Kip1+/+ G450 for 48 hours: 8.6 ± 0.9*,
relative changes in p21Cip expression normalized
to ß-actin; *P < 0.05, n = 3). To
ensure that any differences in glucose-induced hypertrophy were not
because of alterations in TGF-ß expression,5
TGF-ß
mRNA and protein were measured in p27Kip1+/+ and
p27Kip1-/- mesangial cells grown in high
glucose. Figure 3, A and B
, shows that
TGF-ß mRNA as well as protein were increased similarly in both cell
lines when incubated with high glucose medium (G450) for 48 hours.
Moreover, exogenous TGF-ß1 increased fibronectin mRNA expression in
both p27Kip1-/- and +/+ cells (Figure 3C)
.
These results convincingly show that the response to high glucose is
not different in p27Kip1+/+ and -/- mesangial
cells, except for the expected lack of p27Kip1
response in the p27Kip1-/- cells. Furthermore,
putative TGF-ß1 receptors and signaling transduction pathways
involved in fibronectin transcription are present in both cell lines.
|
|
Proliferation was measured by
[3H]thymidine incorporation. There was no
significant difference in DNA synthesis in
p27Kip1+/+ and -/- mesangial cells when grown
in serum-free media with normal glucose (Table 1)
. However, incubation of
p27Kip1+/+ mesangial cells in serum-free medium
with high glucose (G450) for 48 hours significantly reduced
proliferation, consistent with glucose-induced cell cycle arrest in
p27Kip1+/+ cells. In marked contrast, high
glucose caused a significant increase in cell cycle progression and
proliferation in p27Kip1-/- cells.
|
. High glucose stimulated de
novo protein synthesis in p27Kip1+/+
mesangial cells. In contrast, [3H]leucine
incorporation did not increase in p27Kip1-/-
mesangial cells in response to high glucose (Table 1)
.
In addition, total protein content and cell number were
determined and a hypertrophy index (protein content divided by cell
number) was calculated. As shown in Table 2
, high glucose significantly increased
protein content/cell number only in p27Kip1
cells. Taken together, these results show that high glucose induced
hypertrophy in p27Kip1+/+ mesangial cells, but
not in p27Kip1-/- cells.
|
To confirm a role for p27Kip1 in
glucose-induced hypertrophy, we used an ecdysone-inducible gene
expression system to reconstitute p27Kip1
expression in p27Kip1-/- mesangial cells. This
system offers the advantage of a lower basal activity compared to
tetracycline-based expression vectors and the absence of any toxicity
of the inducer muristone, a synthetic analog of the insect molting
hormone ecdysone.15
Figure 4A
shows that
p27Kip1-/- cells transiently transfected with
pINDp27Kip1/pVgRXR grown in normal glucose medium
(100 mg/dl) showed no detectable p27Kip1 protein
expression in the absence of muristone. However, incubating cells with
1 and 5 µg/ml of muristone for 24 hours increased
p27Kip1 expression (0 µg/ml muristone, 1.0
± 0.0; 1 µg/ml muristone, 2.1 ± 0.3*; 5 µg/ml muristone,
4.7 ± 0.9* relative changes in p27Kip1
expression normalized to ß-actin; P < 0.05,
n = 3). A similar pattern was observed when cells were
grown in high glucose medium (450 mg/dl; Figure 4B
; 0 µg/ml
muristone: 1.0 ± 0.0, 1 µg/ml muristone: 3.1 ± 0.4*, 3
µg/ml muristone: 2.8 + 0.3*, 5 µg/ml muristone: 3.7 ± 0.5*
relative changes in p27Kip1 expression normalized
to ß-actin; *P < 0.05, n = 3).
However, the levels of p27Kip1 were not increased
in p27Kip1+/+ cells transiently transfected with
pINDp27Kip1/pVgRXR (Figure 4C)
.
|
. Restoring
p27Kip1 expression with muristone inhibited
[3H]thymidine incorporation in
p27Kip1-/- cells, and induced cell cycle arrest
(Table 3)
. Moreover, in the presence of high glucose, muristone induced
cellular hypertrophy in p27Kip1-/- cells to
levels comparable to p27Kip1+/+ cells (Table 4)
.
Thus, transiently reconstituting p27Kip1 was
required to induced hypertrophy in p27Kip1-/-
cells independent of the medium glucose content
(Table 4)
.
|
|
To circumvent some of the intrinsic problems using mass cultures of transiently transfected cells, stable cell lines were generated. Therefore, mesangial cells from p27Kip1-/- mice were first transfected with pVgRXR and selected in Zeocin to permanently express the ecdysone receptor. After several rounds of limited dilutions, a cell line was obtained that showed muristone-inducible expression of p27Kip1 after transient transfection with pINDp27Kip1 (data not shown). This cell line was subsequently transfected with pINDp27Kip1 and selection of surviving cells was performed in medium containing Zeocin and G418. Two cell lines (clones 5.2 and 6.2) were selected for further analysis.
As shown in Figure 5
, muristone induced
p27Kip1 expression in these two cell lines
suggesting that the inducible expression systems works in
permanent-transfected cell lines. However, in contrast to
transient-transfected cells, clones 5.2 and 6.2 revealed some minimal
basal p27Kip1 expression even in the absence of
the inducer muristone indicating that the suppression is somewhat leaky
(Figure 5)
. Similar to the transiently transfected cells,
muristone-induced p27Kip1 expression inhibited
the proliferation of both cell clones in high glucose medium (Table 5)
. In addition, muristone converted the
proliferation into a hypertrophy phenotype only in the presence of high
glucose (Table 5)
.
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
High glucose as well as advanced glycation end products induce in vitro and in vivo TGF-ß in the kidney.17-20 Furthermore, angiotensin II may additionally induce TGF-ß synthesis, particularly in the setting of high ambient glucose.21 Neutralization experiments have clearly demonstrated that TGF-ß is a necessary prerequisite for the development of glomerular hypertrophy in streptozotocin-induced diabetic mice.20
We and others have been interested in the role of specific cell cycle proteins in diabetic hypertrophy, because we have previously described that high glucose, in the absence of other factors, induces immediate early genes in mesangial cells and the early entry G0 to G1 phases.5 However, after a very limited proliferation, mesangial cells exposed to high glucose are growth-arrested in the G1 phase, and do not progress into the S phase of the cell cycle.5 Moreover, high glucose-mediated expression of TGF-ß is pivotal for this G1-phase arrest because neutralizing anti-TGF-ß antibodies convert the G1-phase arrest into a proliferative phenotype.5 Young and colleagues7 showed similar results in vivo where an early and limited glomerular proliferation occurred in the streptozotocin model which preceded glomerular hypertrophy.
CDK inhibitors cause cell cycle arrest by inactivating specific cyclin-CDK complexes required for cell cycle progression. In the current study we focused on specific CDK inhibitors because we have previously shown p21Cip1 and p27Kip1 are increased in vitro and in vivo in response to high glucose.8-10 The major finding in the current study was that an induction of p27Kip1 is necessary for high glucose-induced mesangial cell hypertrophy. Our results show that in contrast to an increase in protein synthesis and decrease in DNA synthesis (measures of hypertrophy) in p27Kip1+/+ cells, high glucose did not stimulate the de novo synthesis of proteins in p27Kip1-/- cells. Moreover, in contrast to glucose-induced cell cycle arrest in p27Kip1+/+ cells, glucose increased cell cycle progression in p27Kip1-/- cells. Finally, we showed that in the presence of high glucose, reconstituting p27Kip1 levels in p27Kip1-/- mesangial cells by either a transient or stable transfection converted these cells from a proliferative to hypertrophic phenotype.
A second major finding in this study was that in accord with our previous in vitro and in vivo studies,10 the CDK inhibitor p21Cip1 was increased in both p27Kip1+/+ and p27Kip1-/- mesangial cells in response to high glucose.22,23 Because TGF-ß can mediate p21Cip1 expression by p53-dependent and -independent pathways,24-26 it is possible that high glucose-induced TGF-ß is responsible for the increase in p21Cip1 in the diabetic environment. This expression of p21Cip1 is required for glomerular hypertrophy because p21Cip1-/- mice made diabetic by streptozotocin did not develop glomerular hypertrophy as measured by computer image analysis of glomerular tufts.27 This absence of glomerular hypertrophy in p21Cip1-/- diabetic mice seemed to be protective of renal function because these animals did not develop proteinuria.27
A role for specific CDK inhibitors in hypertrophy has been recently shown. We found that treatment of BBdp rats, a model of autoimmune diabetes mellitus type I, with angiotensin-converting enzyme inhibitors prevented glomerular expression of p16 and p27Kip1, but not of p21Cip1.28 Increased kidney weight, a parameter of hypertrophy, was also abolished by angiotensin-converting enzyme inhibitor treatment.28 Hence, a picture is emerging in which both CDK inhibitors, p27Kip1 and p21Cip1, are required for the development of high glucose-mediated hypertrophy, but interference with the expression of one of these proteins may attenuate hypertrophy.
Terada and co-workers29 overexpressed p21Cip1 and p27Kip1 in tubular LLC-PK1 cells using adenovirus vectors. Although overexpression of each of the CDK inhibitors alone was sufficient to stimulate de novo protein synthesis of tubular cells in the presence of the mitogen epidermal growth factor, these overexpressions surprisingly failed to cause an inhibition of proliferation.29 On the other hand, overexpression of p21Cip1 in vascular smooth muscle cells suppressed serum-induced proliferation and stimulated hypertrophy.30 Although species differences and/or the particular cell type may all explain these somewhat inconsistent findings, a more likely explanation is the fact that different total amounts of CDK inhibitors may have been expressed in the various systems.
It has been suggested that CDK inhibitors, in particular those of the Cip/Kip family, are redundant in some of their cell-cycle regulatory functions.31,32 The rationale for this assumption was the observation that mice with targeted disruption of the p27Kip1 gene, although exhibiting more cells in several organs, nevertheless revealed normal cell cycle arrest of lymphocytes treated with TGF-ß or rapamycin.33,34 Moreover, despite a high frequency of pituitary tumors in p27Kip1-deficient mice, these animals are not predisposed to a general increase in cancer frequency suggesting that p27Kip1 is not a genuine tumor suppressor gene.33,34
p27Kip1 inhibits several cyclin/CDK complexes including cyclin E/CDK2, and cyclin D/CDK4,6.31 However, these cyclin/CDK complexes may show different susceptibilities to inhibition by p27Kip1.35 For example, binding of p27Kip1 does not necessarily inhibit cyclin D/CDK4 in proliferating cells, whereas it always inactivates cyclin E/CDK2 and cyclin A/CDK2.31,35 Studies with inducible p27Kip1 expression have shown that the amount of p27Kip1 required for the inhibition of cyclin D/CDK4 is much larger than that required for the inhibition of cyclin A/CDK2.35 TGF-ß decreases the expression of CDK436 and also induces the CDK4-specific inhibitor p15INK4b.37 These changes will disrupt binding of p27Kip1 to cyclin D/CDK4 complexes leading to a redistribution and binding of p27Kip1 to cyclin E/CDK2 and cyclin A/CDK2 complexes with their inhibition.36,37 Thus, our observation that induced p27Kip1 expression leads to hypertrophy only in high glucose medium may be explained by the fact that TGF-ß-mediated down-regulation of CDK4 expression and/or induction of p15INK4b, which occurs only in high glucose medium, is necessary for liberation of p27Kip1 from cyclin D/CDK4 complexes with consecutive inhibition of cyclin E/CDK2. In accordance with this theory, Huang and Preisig38 have demonstrated that cyclin D/CDK2 is activated, but cyclin E/CDK2 kinase is inhibited during diabetic hypertrophy.38 This effect is mediated by TGF-ß. The switch from the initial hyperplastic to the hypertrophic response of tubular cells was mediated by a decrease in cyclin E activity and p21Cip1, p27Kip1, and p57 played a role in this inhibition38 suggesting that all three CKI may be necessary in diabetic hypertrophy.
In summary, we would like to propose the following orderly molecular
course of glucose-mediated hypertrophy of mesangial cells as shown in
Figure 6
: high ambient glucose primarily
induces dormant cells to re-enter the cell cycle. After completing one
or two rounds, CDK inhibitors such as p21Cip1 and
p27Kip1 are induced,8-10
likely
through TGF-ß-dependent as well as -independent mechanisms. Direct
phosphorylation of p27Kip1 by high
glucose-activated MAP kinases could additionally increase the protein
stability.39-41
These CDK inhibitors interact with
cyclin/CDK complexes, inhibit their activities, and arrest cells in the
G1 phase. It seems that
p27Kip1 is the major CDK inhibitor being
necessary for this arrest. In addition, p21Cip1
and p27Kip1 may counteract apoptosis so that the
overall number of G1-phase-arrested cells remain
intact.11,40
Arrested cells are undergoing cellular
hypertrophy through stimulated protein synthesis, increases in
extracellular matrix, reduction in protein and matrix turnover, and
maybe cellular enlargement by additional osmotic
changes.42-44
It is likely that TGF-ß plays a central
role in several of these processes.20,45
Hence,
interference with any of these consecutive events would inevitably
abolish mesangial hypertrophy. However, whether a prevention of
glomerular hypertrophy would ultimately attenuate renal function and
structure in diabetic nephropathy remains unclear.46
|
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Supported by the Deutsche Forschungsgemeinschaft (Wo 460/2-4, and a Heisenberg scholarship (to G. W.), and by National Institutes of Health grants DK52121, DK51096, DK47659 (to S. J. S.).
Parts of this study were presented at the 32nd Annual Meeting of the American Society of Nephrology, November 1 to 8, 1999, Miami Beach, Florida, and are published in abstract form (J Am Soc Nephrol 10:692A0, 1999).
Accepted for publication December 5, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  J. Ren, V. C. Hascall, and A. Wang Cyclin D3 Mediates Synthesis of a Hyaluronan Matrix That Is Adhesive for Monocytes in Mesangial Cells Stimulated to Divide in Hyperglycemic Medium J. Biol. Chem., June 12, 2009; 284(24): 16621 - 16632. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Verzola, M. T. Gandolfo, G. Gaetani, A. Ferraris, R. Mangerini, F. Ferrario, B. Villaggio, F. Gianiorio, F. Tosetti, U. Weiss, et al. Accelerated senescence in the kidneys of patients with type 2 diabetic nephropathy Am J Physiol Renal Physiol, November 1, 2008; 295(5): F1563 - F1573. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Popescu, Y. Park, N. Lue, C. Best-Popescu, L. Deflores, R. R. Dasari, M. S. Feld, and K. Badizadegan Optical imaging of cell mass and growth dynamics Am J Physiol Cell Physiol, August 1, 2008; 295(2): C538 - C544. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Yuan, L. Lanting, Z.-G. Xu, S.-L. Li, P. Swiderski, S. Putta, M. Jonnalagadda, M. Kato, and R. Natarajan Effects of cholesterol-tagged small interfering RNAs targeting 12/15-lipoxygenase on parameters of diabetic nephropathy in a mouse model of type 1 diabetes Am J Physiol Renal Physiol, August 1, 2008; 295(2): F605 - F617. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Ruster, T. Bondeva, S. Franke, M. Forster, and G. Wolf Advanced glycation end-products induce cell cycle arrest and hypertrophy in podocytes Nephrol. Dial. Transplant., July 1, 2008; 23(7): 2179 - 2191. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Zhang, X. Chen, D. Wu, W. Liu, J. Wang, Z. Feng, G. Cai, B. Fu, Q. Hong, and J. Du Downregulation of Connexin 43 Expression by High Glucose Induces Senescence in Glomerular Mesangial Cells J. Am. Soc. Nephrol., June 1, 2006; 17(6): 1532 - 1542. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Baba, J. Wada, J. Eguchi, I. Hashimoto, T. Okada, A. Yasuhara, K. Shikata, Y. S. Kanwar, and H. Makino Galectin-9 Inhibits Glomerular Hypertrophy in db/db Diabetic Mice via Cell-Cycle-Dependent Mechanisms J. Am. Soc. Nephrol., November 1, 2005; 16(11): 3222 - 3234. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Feng, A. R. Plati, Q.-l. Cheng, M. Berho, A. Banerjee, M. Potier, W.-c. Jy, A. Koff, L. J. Striker, and G. E. Striker Glomerular Aging in Females Is a Multi-Stage Reversible Process Mediated by Phenotypic Changes in Progenitors Am. J. Pathol., August 1, 2005; 167(2): 355 - 363. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Zheng, F. Cornacchia, I. Schulman, A. Banerjee, Q.-l. Cheng, M. Potier, A. R. Plati, M. Berho, S. J. Elliot, J. Li, et al. Development of Albuminuria and Glomerular Lesions in Normoglycemic B6 Recipients of db/db Mice Bone Marrow: The Role of Mesangial Cell Progenitors Diabetes, September 1, 2004; 53(9): 2420 - 2427. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Zeng, H. Xu, T.-L. Chew, R. Chisholm, M. M. Sadeghi, Y. S. Kanwar, and F. R. Danesh Simvastatin Modulates Angiotensin II Signaling Pathway by Preventing Rac1-Mediated Upregulation of p27 J. Am. Soc. Nephrol., July 1, 2004; 15(7): 1711 - 1720. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Wolf and U. O. Wenzel Angiotensin II and Cell Cycle Regulation Hypertension, April 1, 2004; 43(4): 693 - 698. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Zhou, J. Li, A. M. Goldsmith, D. C. Newcomb, D. M. Giannola, R. G. Vosk, E. M. Eves, M. R. Rosner, J. Solway, and M. B. Hershenson Human Bronchial Smooth Muscle Cell Lines Show a Hypertrophic Phenotype Typical of Severe Asthma Am. J. Respir. Crit. Care Med., March 15, 2004; 169(6): 703 - 711. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. V. Griffin and S. J. Shankland Not Just an Inhibitor: A Role for p21 Beyond The Cell Cycle--"The Truth Is Rarely Pure and Never Simple" J. Am. Soc. Nephrol., March 1, 2004; 15(3): 825 - 826. [Full Text] [PDF]
|
|
|
|
|
|
K. Sharma, L. Deelman, M. Madesh, B. Kurz, E. Ciccone, S. Siva, T. Hu, Y. Zhu, L. Wang, R. Henning, et al. Involvement of transforming growth factor-{beta} in regulation of calcium transients in diabetic vascular smooth muscle cells Am J Physiol Renal Physiol, December 1, 2003; 285(6): F1258 - F1270. [Abstract] [Full Text]
|
|
|
|
 |
|
 N. G. Abraham, T. Kushida, J. McClung, M. Weiss, S. Quan, R. Lafaro, Z. Darzynkiewicz, and M. Wolin Heme Oxygenase-1 Attenuates Glucose-Mediated Cell Growth Arrest and Apoptosis in Human Microvessel Endothelial Cells Circ. Res., September 19, 2003; 93(6): 507 - 514. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Gorin, J. M. Ricono, N.-H. Kim, B. Bhandari, G. G. Choudhury, and H. E. Abboud Nox4 mediates angiotensin II-induced activation of Akt/protein kinase B in mesangial cells Am J Physiol Renal Physiol, August 1, 2003; 285(2): F219 - F229. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. McGinn, P. Poronnik, M. King, E. D. M. Gallery, and C. A. Pollock High glucose and endothelial cell growth: novel effects independent of autocrine TGF-beta 1 and hyperosmolarity Am J Physiol Cell Physiol, June 1, 2003; 284(6): C1374 - C1386. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Awazu, S. Omori, K. Ishikura, M. Hida, and H. Fujita The Lack of Cyclin Kinase Inhibitor p27Kip1 Ameliorates Progression of Diabetic Nephropathy J. Am. Soc. Nephrol., March 1, 2003; 14(3): 699 - 708. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Wolf and S. J. Shankland p27Kip1: The "Rosebud" of Diabetic Nephropathy? J. Am. Soc. Nephrol., March 1, 2003; 14(3): 819 - 822. [Full Text] [PDF]
|
|
|
|
 |
|
 J. Cheng and J. P. Grande Transforming Growth Factor-{beta} Signal Transduction and Progressive Renal Disease Experimental Biology and Medicine, December 1, 2002; 227(11): 943 - 956. [Abstract] [Full Text]
|
|
|
|
|
|
D. Feliers, M. A. Frank, and D. J. Riley Activation of Cyclin D1-Cdk4 and Cdk4-Directed Phosphorylation of RB Protein in Diabetic Mesangial Hypertrophy Diabetes, November 1, 2002; 51(11): 3290 - 3299. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. A. Wahab, B. S. Weston, T. Roberts, and R. M. Mason Connective Tissue Growth Factor and Regulation of the Mesangial Cell Cycle: Role in Cellular Hypertrophy J. Am. Soc. Nephrol., October 1, 2002; 13(10): 2437 - 2445. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Wolf Molecular Mechanisms of Diabetic Mesangial Cell Hypertrophy: A Proliferation of Novel Factors J. Am. Soc. Nephrol., October 1, 2002; 13(10): 2611 - 2613. [Full Text] [PDF]
|
|
|
|
|
|
M. Hlaing, X. Shen, P. Dazin, and H. S. Bernstein The Hypertrophic Response in C2C12 Myoblasts Recruits the G1 Cell Cycle Machinery J. Biol. Chem., June 21, 2002; 277(26): 23794 - 23799. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Monkawa, K. Hiromura, G. Wolf, and S. J Shankland The Hypertrophic Effect of Transforming Growth Factor-{beta} is Reduced in the Absence of Cyclin-Dependent Kinase-Inhibitors p21 and p27 J. Am. Soc. Nephrol., May 1, 2002; 13(5): 1172 - 1178. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
= induction; · · · ·