| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Short Communications |
From the Institute of Pathology,*
Universitätsklinikum Charité, Medizinische Fakultät
der Humboldt-Universität Berlin, Berlin, Germany; the Clinic of
Surgery and Surgical Oncology,
Robert-Rössle Klinik, Berlin, Germany; and the Department of
Obstetrics and Gynecology,
Baylor College of
Medicine, Houston Texas
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
]- and the
21-kd [ß]-isoform of caveolin-1 were detected in the nontumorigenic
human fibroblast cell line IMR-90. In contrast, in HT-1080
human fibrosarcoma cells, caveolin-1 is strongly
down-regulated. We show that the []-isoform of caveolin-1 is
potently up-regulated in HT-1080 cells by inhibition of the
mitogen-activated protein kinase-signaling pathway with the specific
inhibitor PD 98059, whereas the specific inhibitor of DNA
methylation 5-aza-2'-deoxycytidine only marginally up-regulates
caveolin-1. In addition, re-expression of caveolin-1 in HT-1080
fibrosarcoma cells potently inhibited colony formation. From these we
conclude that caveolin-1 is likely to act as a tumor suppressor gene in
human sarcomas.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-shaped invaginations of the plasma membrane that have been
implicated in endocytosis and signal transduction.1
Caveolae membranes are enriched with specific lipids
(glycosphingolipids, sphingomyelin, and cholesterol) and different
lipid-modified signaling molecules.2
Caveolins, a family
of highly conserved 20- to 25-kd integral membrane proteins, are the
principal protein component of caveolae. Thus far the mammalian
caveolin family consists of four proteins, caveolin-1[],
-1[ß], -2, and -3 encoded by three genes. Caveolins-1 and -2 are
co-expressed, whereas the expression of caveolin-3 is
muscle-specific.3 In general, caveolins bind to and inactivate signaling molecules including receptor tyrosine kinases, their downstream targets (eg, H-RAS, MEK1, and ERK2), serpentine receptors, G-proteins, and eNOS.4 Direct interaction of caveolin-1 with signaling molecules leads to their inhibition,5 therefore it has been suggested that caveolin-1 may possess transformation suppressor activity. Consistent with this hypothesis it was shown that 1) the caveolin-1 and -2 genes are co-localized to a suspected tumor suppressor locus in mice and humans [7q31.1/D7S522]6 and, 2) the first and second exons of the caveolin-1 gene are embedded within CpG islands.7 Therefore, it was proposed that regulation of caveolin-1 expression may be controlled, in part, by methylation of these regions. 3) Caveolin-1 expression is reduced or absent in NIH 3T3 cells transformed by activated oncogenes such as v-Abl, Bcr-Abl, or H-Ras [G12V], and caveolae are missing from these transformed cells.8 4) In addition, activation of the Ras-p42/44 mitogen-activated protein (MAP) kinase and protein kinase A (PKA) signaling pathways transcriptionally down-regulate caveolin-1.9 5) Most importantly, recombinant expression of caveolin-1 in transformed NIH 3T3 cells and breast cancer cells inhibits anchorage-independent growth.10,11
Caveolin-1 is most abundantly expressed in terminally differentiated
mesenchymal cells such as smooth muscle cells, adipocytes, and
endothelial cells.5
Tumors of the soft tissue and bone
represent a heterogeneous group of mesenchymal lesions, which account
for 
1% of all malignancies. Impaired function or inactivation of
several tumor suppressor gene products has been implicated in the
development of soft tissue tumors, including p53, the
retinoblastoma gene product, p16INK4A,
p18, and
p21WAF1/CIP1.12
To investigate
whether caveolin-1 is a candidate tumor suppressor in sarcomas, we have
analyzed its expression in normal human mesenchymal tissues, benign
mesenchymal tumors, and sarcomas. We demonstrate that caveolin-1 is
expressed in benign mesenchymal tumors at levels comparable to normal
mesenchymal cells, whereas the majority of sarcomas have a reduced
expression. Our data suggests that caveolin-1 may act as a tumor
suppressor in human sarcomas.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This study was conducted on formalin-fixed, paraffin-embedded specimens of benign and malignant mesenchymal tumors selected from the archives of the Institutes of Pathology, Universitätsklinikum Charité, Berlin, Germany. Histopathological diagnosis and grading of the tumors were performed using established diagnostic criteria.13,14 The tissues analyzed included seven leiomyomas, six hemangiomas, five fibromatoses, four lipomas, three fibrosarcomas (two grade 1 and one grade 2), 20 leiomyosarcomas (four grade 1, eight grade 2, and eight grade 3), 22 liposarcomas (six well-differentiated, 14 myxoid/round cell, and two pleomorphic), eight angiosarcomas (two grade 1, one grade 2, and five grade 3), 18 malignant fibrous histiocytomas (six grade 2 and 12 grade 3), and eight synovial sarcomas (six grade 2 and two grade 3). Normal mesenchymal tissues surrounding the tumors were analyzed for each case. In addition, snap-frozen benign and malignant tissues of selected cases were used for Western blot analysis.
Immunohistochemistry
Paraffin sections were cut on to silane-coated slides. Antigen retrieval was performed on deparaffinized sections by boiling in 10 mmol/L sodium citrate buffer, pH 6.0, for 5 minutes. The mouse monoclonal anti-caveolin-1 antibody (clone 2297; Transduction Labs, Lexington, KY) was applied for 1 hour at a dilution of 1:500. To ensure consistency of staining intensity, normal mesenchymal tissue at the periphery of each tumor specimen and endothelial cells of capillaries within the tumors were evaluated as a positive control. In negative controls the primary antibody was omitted or replaced by an antibody with irrelevant specificity (mouse IgG1, X 0931; DAKO, Hamburg, Germany). Immunostaining was accomplished using a Vectastain ABC-AP kit (Vector Laboratories, Burlingame, CA) as recommended by the manufacturer. The sections were then counterstained with hematoxylin and mounted in Permount. Digital images were acquired with an Olympus DP-10 charge-coupled device camera. Adjustments in image contrast were performed identically on the images.
For caveolin-1 immunostaining, a semiquantitative estimation was made, using a composite score obtained by multiplying the values of the immunoreaction intensity and relative abundance of caveolin-1-positive cells slightly modified as described previously.15 The intensity was graded as 1 (weakly positive), 2 (moderately positive), or 3 (intense stain equivalent to normal smooth muscle cells, adipocytes, or endothelial cells). The abundance of caveolin-1-positive cells was graded from 0 to 4 (0, <5% positive cells; 1, 5 to 25%; 2, 26 to 50%; 3, 51 to 75%; 4, 76 to 100%).
Cell Culture and Inhibitors
The fibrosarcoma cell line HT-1080 and the SV40-immortalized nontumorigenic fibroblast cell line IMR-90 were obtained from the American Type Culture Collection (Rockville, MD). Cell lines were maintained at 37°C in a humidified atmosphere of 5% CO2 and 95% air in Dulbecco’s modified Eagle’s medium containing 10% fetal calf serum and 2 mmol/L glutamine. The MAP kinase or ERK kinase (MEK) inhibitor PD 98059 (Calbiochem, San Diego, CA) was dissolved in dimethyl sulfoxide at a concentration of 50 mmol/L and used at a final concentration of 50 µmol/L for 48 hours. The inhibitor of DNA methylation, 5-aza-2'-deoxycytidine (Sigma, St. Louis, MO), was dissolved in phosphate buffer, pH 6.0, at a concentration of 1 mmol/L and applied at a concentration of 1 µmol/L for 48 hours.
Western Blot Analysis
To obtain total protein lysates, 2 x 106 cells plated on 10-cm dishes, were washed twice with cold phosphate-buffered saline and incubated on ice for 30 minutes in RIPA-buffer [150 mmol/L NaCl, 1% Nonidet P-40, 0.5% deoxycholate, 0.1% sodium dodecyl sulfate (SDS), 50 mmol/L Tris-HCl, pH 8.0, and 2 µg/ml aprotinin]. Cells were scraped off the plates, lysates were mixed with 2x SDS sample buffer (120 mmol/L Tris-HCl, pH 6.8, 0.2 mol/L dithiothreitol, 4% SDS, 20% glycerol, 0.002% bromphenol blue), boiled for 5 minutes, and centrifuged for 5 minutes at 12,000 x g. The protein concentration of the supernatants was measured using the amido black method as described by Schaffner and Weissmann.16 Equal amounts of protein (10 µg) were separated on 12% polyacrylamide gels by SDS-gel electrophoresis and transferred to polyvinylidene difluoride membranes (Hybond-P; Amersham, Freiburg, Germany). Immunodetection was performed using the caveolin-1-specific monoclonal antibody clone 2297 at a dilution of 1:1,000 followed by detection with the enhanced chemiluminescence system (Amersham). To ensure equal loading amounts, the blots were stripped in 200 mmol/L glycine, 1% Tween-20, 0.1% SDS, pH 2.2, for 2 hours at room temperature and reprobed using a monoclonal antibody to actin (clone C4; Roche, Mannheim, Germany) at a dilution of 1:5,000. Frozen samples of tumors and benign tissues were homogenized in RIPA buffer and processed as described above.
Caveolin-1 Expression Construct
A 631-bp cDNA fragment containing the complete coding region of human caveolin-1 was amplified by reverse transcriptase-polymerase chain reaction using the caveolin-1-specific forward primer 5' CCTCCTCACAGTTTTCATCCA 3' and the reverse primer 5' ACTTGAAATTGGCACCAGGA 3' and cloned into the HpaI site of the pLNHX expression vector (Clontech, Palo Alto, CA). The insert was sequenced to ensure for a correct caveolin-1 sequence.
Colony Formation Assay
HT-1080 cells (2 x 105) were plated onto 25 cm2 dishes and transfected after 24 hours with 1.5 µg of caveolin-1 expression plasmid or the empty pLNHX vector as a control using the Fugene 6 reagent (Roche) according to the manufacturers instructions. Forty-eight hours after transfection, 850 µg/ml of geneticin (G418) was added to the culture medium and the colonies were stained and counted after 10 days of selection. In addition, several G418-resistant colonies with the caveolin-1 expression plasmid and the pLNHX vector were expanded and analyzed for caveolin-1 expression by Western blot as described above.
Statistical Analyses
Statistical analysis were made using Fisher’s exact test. Differences between two populations were considered significant when confidence intervals were >95% (P < 0.05).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
.
The semiquantitative expression results for benign mesenchymal tumors
and sarcomas are summarized in Table 1
.
High levels of caveolin-1 expression, comparable to normal mesenchymal
cells, were retained in all benign mesenchymal tumors, including five
of five fibromatoses (Figure 1A)
, seven of seven leiomyomas (Figure 1B)
, four of four lipomas (Figure 1C)
, and six of six hemangiomas.
Caveolin-1 expression was found to be absent or strongly reduced in
three of three fibrosarcomas (Figure 1D)
, 17 of 20 leiomyosarcomas
(Figure 1E)
, five of eight angiosarcomas, 15 of 18 malignant fibrous
histiocytomas (Figure 1G)
, and eight of eight synovial sarcomas. Most
of these sarcomas show a weak staining in distinct areas of the tumor.
|
|
, three
leiomyosarcomas, and three angiosarcomas high levels of caveolin-1
protein expression (immunoreactivity scores ranging from 8 to 12) were
detected. Although expression of caveolin-1 in leiomyosarcomas,
angiosarcomas, and malignant fibrous histiocytomas displayed some
correlation with the histological grade, these differences were not
significant.
Regarding malignant lipogenic tumors, a marginally reduced expression
of caveolin-1 was observed in four of six well-differentiated
liposarcomas, whereas in myxoid/round cell and pleomorphic liposarcomas
the caveolin-1 expression was strongly reduced or absent in all 16
tumors. In these forms of liposarcomas, only some scattered
multivacuolar and univacuolar lipoblasts stained positive for
caveolin-1 (Figure 1F
, arrow).
The immunohistochemical findings were confirmed by Western blot
analysis of normal mesenchymal tissues and tumors with high and low
expression of caveolin-1, where snap-frozen tissue was available (Table 2
and Figure 2
). In two samples derived from normal
mesenchymal tissue and three tumors with a high expression of
caveolin-1 in immunohistochemistry (Table 2
; cases 1, 3, and 5), the
24-kd []- and the 21-kd [ß]-isoforms of caveolin-1 were
detectable by Western blot analysis (Figure 2
; lanes 1, 2, 3, 5, and
7). In two tumors with a reduced expression of caveolin-1 in
immunohistochemistry (Table 2
, cases 2 and 4) no caveolin-1 protein was
detected by Western blot analysis (Figure 2
, lanes 4 and 6).
|
|
,
IMR-90 cells express high levels of the 24-kd []- and the 21-kd
[ß]-isoform of caveolin-1. In contrast, caveolin-1 expression is
strongly down-regulated in HT-1080 fibrosarcoma cells (Figure 3A
, lanes
1 and 2). Treatment of HT-1080 cells with the well-characterized MEK
inhibitor PD 98059 (50 µmol/L) potently up-regulates the expression
of the 24-kd []-isoform of caveolin-1, whereas treatment with the
inhibitor of DNA methylation, 5-aza-2'-deoxycytidine (1 µmol/L), only
marginally up-regulates caveolin-1 (Figure 3A
, lanes 3 and 4).
|
. Additionally, G418-resistant colonies transfected with the
caveolin-1 expression vector and the empty vector were expanded and
caveolin-1 expression was analyzed by Western blot analysis (Figure 3C)
. In these experiments, however, it was not possible to obtain
HT-1080 clones stably overexpressing caveolin-1. |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Caveolin-1 was first identified as a major v-Src substrate in Rous sarcoma virus-transformed cells. It was proposed that caveolin-1 may represent a critical target during cell transformation.17 In support of this notion, caveolin-1 expression is reduced in NIH 3T3 cells transformed by a variety of activated oncogenes, such as v-Abl, Bcr-Abl, and H-Ras [G12V].8 Targeted down-regulation of caveolin-1 in NIH 3T3 cells by expression of an antisense RNA induces cell transformation and activation of the p42/44 MAP kinase cascade.18 Most importantly, heterologous expression of caveolin-1 in transformed NIH 3T3 cells and breast cancer cells inhibits their anchorage-independent growth capabilities.10,11
The genes encoding caveolin-1 and -2 were previously mapped to the D7S522 locus (7q31.1), a known fragile site that shows deletions using loss of heterozygosity analysis in a variety of human malignancies such as cancers of the breast,19 prostate,20 kidney,21 and colon.22 Therefore it was suggested that caveolin-1 may represent a tumor suppressor gene at the D7S522 (7q31.1) locus.6 However, in a variety of human tumor cell lines, including ovarian, breast and prostate cancer, osteosarcoma and HT-1080 fibrosarcoma cell lines, no mutations of the caveolin-1 gene were detected and some of these cell lines express caveolin-1.23
The exons 1 and 2 of the caveolin-1 gene are embedded within CpG islands7 and it was proposed that the expression of caveolin-1 may be down-regulated by methylation of these CpG regions. It was recently shown that in two human breast cancer cell lines, that fail to express the protein, the 5' promoter region of the caveolin-1 gene is methylated,7 however, others did not detect methylation of the caveolin-1 gene promoter in a variety of human tumor cell lines and human ovarian cancers.23 We did observe only a marginal up-regulation of caveolin-1 protein expression in HT-1080 fibrosarcoma cells after treatment with the DNA methylation inhibitor 5-aza-2'-deoxycytidine. This indicates that in HT-1080 cells, suppression of caveolin-1 by methylation does not play a significant role, which complements with previous findings for this cell line.23
It was shown that activation of the Ras-p42/44 MAP kinase and PKA
cascades transcriptionally down-regulate caveolin-1 promoter activity
in NIH 3T3 fibroblasts.9
The transformed phenotype of
HT-1080 fibrosarcoma cells is controlled by an activating mutation of
the N-RAS gene24
and we observed a re-expression of
caveolin-1 by inhibition of the p42/44 MAP kinase pathway by treatment
with the MEK inhibitor PD 98059 in this cell line. This effect was
selective for the 24-kd []-isoform of caveolin-1, indicating a
different regulation of the caveolin-1 isoforms. Caveolin-1 isoforms
are encoded by distinct mRNAs generated by alternative transcription
initiation.25
We found both []- and [ß]-isoforms
co-expressed in mesenchymal tissues and IMR-90 fibroblasts. It was
recently shown that re-expression of the [ß]-isoform but not the
[]-isoform of caveolin-1 up-regulates volume-regulated anion
channels in colon and breast cancer cell lines.26
Therefore it would be of interest to analyze whether separate
re-expression of the caveolin-1 isoforms exerts different biological
effects in mesenchymal tumor cells.
To summarize, our expression data obtained from benign and malignant tissues and cells and from colony formation experiments, suggests that caveolin-1 may act as a class II tumor suppressor in human sarcomas. Class II tumor suppressor genes,27 as defined by their reversible down-regulation, may be useful because their re-expression may be inducible by drugs and may improve treatment of human tumors.
In contrast to these findings, Thompson and co-workers28 recently reported elevated caveolin-1 levels in prostate cancer and they show that caveolin-1 suppresses c-myc-induced apoptosis in prostate cancer cell lines.29 We have analyzed the expression of caveolin-1 in human carcinomas of various sites and found that caveolin-1 is down-regulated in several human cancers but elevated in some other tumors, including prostate cancer (Wiechen K, Diatchenko L, Agoulnik A, Zhumabayeva B, Desai S, Atun S, Scharff KM, Hydes K, Siebert PD, Dietel M, Schafer R, Sers C, submitted for publication). Therefore, caveolin-1 is likely to act as a tumor suppressor in some human malignancies such as sarcomas and may have other functions in prostate cancer.
Further studies are necessary to characterize the mechanism of down-regulation of caveolin-1 in sarcomas. It will be of interest to analyze whether the expression of caveolin-1 in distinct tumor areas of leiomyosarcomas, angiosarcomas, and malignant fibrous histiocytomas and single lipoblasts in myxoid/round cell and pleomorphic liposarcomas reflects a higher differentiation. In addition, it will be important to examine the possible relationship between loss or preservation of caveolin-1 expression and clinical outcome in patients with sarcomas.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
The research was performed at the Institute of Pathology, Universitätsklinikum Charité, Medizinische Fakultät der Humboldt-Universität Berlin, 10117 Berlin, Germany and at the Clinic of Surgery and Surgical Oncology, Robert-Rössle Klinik, 13122 Berlin-Buch, Germany.
Accepted for publication November 22, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  V. A. Torres, J. C. Tapia, D. A. Rodriguez, A. Lladser, C. Arredondo, L. Leyton, and A. F. G. Quest E-Cadherin Is Required for Caveolin-1-Mediated Down-Regulation of the Inhibitor of Apoptosis Protein Survivin via Reduced {beta}-Catenin-Tcf/Lef-Dependent Transcription Mol. Cell. Biol., November 1, 2007; 27(21): 7703 - 7717. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Burgermeister, X. Xing, C. Rocken, M. Juhasz, J. Chen, M. Hiber, K. Mair, M. Shatz, M. Liscovitch, R. M. Schmid, et al. Differential Expression and Function of Caveolin-1 in Human Gastric Cancer Progression Cancer Res., September 15, 2007; 67(18): 8519 - 8526. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Cantiani, M. C. Manara, C. Zucchini, P. De Sanctis, M. Zuntini, L. Valvassori, M. Serra, M. Olivero, M. F. Di Renzo, M. P. Colombo, et al. Caveolin-1 Reduces Osteosarcoma Metastases by Inhibiting c-Src Activity and Met Signaling Cancer Res., August 15, 2007; 67(16): 7675 - 7685. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. M. Tirado, S. Mateo-Lozano, J. Villar, L. E. Dettin, A. Llort, S. Gallego, J. Ban, H. Kovar, and V. Notario Caveolin-1 (CAV1) Is a Target of EWS/FLI-1 and a Key Determinant of the Oncogenic Phenotype and Tumorigenicity of Ewing's Sarcoma Cells. Cancer Res., October 15, 2006; 66(20): 9937 - 9947. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. A. Torres, J. C. Tapia, D. A. Rodriguez, M. Parraga, P. Lisboa, M. Montoya, L. Leyton, and A. F. G. Quest Caveolin-1 controls cell proliferation and cell death by suppressing expression of the inhibitor of apoptosis protein survivin J. Cell Sci., May 1, 2006; 119(9): 1812 - 1823. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. C. Manara, G. Bernard, P.-L. Lollini, P. Nanni, M. Zuntini, L. Landuzzi, S. Benini, G. Lattanzi, M. Sciandra, M. Serra, et al. CD99 Acts as an Oncosuppressor in Osteosarcoma Mol. Biol. Cell, April 1, 2006; 17(4): 1910 - 1921. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Schwencke, R. C. Braun-Dullaeus, C. Wunderlich, and R. H. Strasser Caveolae and caveolin in transmembrane signaling: Implications for human disease Cardiovasc Res, April 1, 2006; 70(1): 42 - 49. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Rennebeck, M. Martelli, and N. Kyprianou Anoikis and Survival Connections in the Tumor Microenvironment: Is There a Role in Prostate Cancer Metastasis? Cancer Res., December 15, 2005; 65(24): 11230 - 11235. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Miotti, A. Tomassetti, I. Facetti, E. Sanna, V. Berno, and S. Canevari Simultaneous Expression of Caveolin-1 and E-Cadherin in Ovarian Carcinoma Cells Stabilizes Adherens Junctions through Inhibition of src-Related Kinases Am. J. Pathol., November 1, 2005; 167(5): 1411 - 1427. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. M. Williams and M. P. Lisanti Caveolin-1 in oncogenic transformation, cancer, and metastasis Am J Physiol Cell Physiol, March 1, 2005; 288(3): C494 - C506. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Aldred, Y. Huang, S. Liyanarachchi, N. S. Pellegata, O. Gimm, S. Jhiang, R. V. Davuluri, A. de La Chapelle, and C. Eng Papillary and Follicular Thyroid Carcinomas Show Distinctly Different Microarray Expression Profiles and Can Be Distinguished by a Minimum of Five Genes J. Clin. Oncol., September 1, 2004; 22(17): 3531 - 3539. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Aldred, M. E. Ginn-Pease, C. D. Morrison, A. P. Popkie, O. Gimm, C. Hoang-Vu, U. Krause, H. Dralle, S. M. Jhiang, C. Plass, et al. Caveolin-1 and Caveolin-2,Together with Three Bone Morphogenetic Protein-related Genes, May Encode Novel Tumor Suppressors Down-Regulated in Sporadic Follicular Thyroid Carcinogenesis Cancer Res., June 1, 2003; 63(11): 2864 - 2871. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Labrecque, I. Royal, D. S. Surprenant, C. Patterson, D. Gingras, and R. Beliveau Regulation of Vascular Endothelial Growth Factor Receptor-2 Activity by Caveolin-1 and Plasma Membrane Cholesterol Mol. Biol. Cell, January 1, 2003; 14(1): 334 - 347. [Abstract] [Full Text]
|
|
|
|
|
|
H. Lee, D. S. Park, B. Razani, R. G. Russell, R. G. Pestell, and M. P. Lisanti Caveolin-1 Mutations (P132L and Null) and the Pathogenesis of Breast Cancer : Caveolin-1 (P132L) Behaves in a Dominant-Negative Manner and Caveolin-1 (-/-) Null Mice Show Mammary Epithelial Cell Hyperplasia Am. J. Pathol., October 1, 2002; 161(4): 1357 - 1369. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Wiechen, L. Diatchenko, A. Agoulnik, K. M. Scharff, H. Schober, K. Arlt, B. Zhumabayeva, P. D. Siebert, M. Dietel, R. Schafer, et al. Caveolin-1 Is Down-Regulated in Human Ovarian Carcinoma and Acts as a Candidate Tumor Suppressor Gene Am. J. Pathol., November 1, 2001; 159(5): 1635 - 1643. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
