| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |

From the Department of Pathology,*
Yale University
School of Medicine, New Haven, Connecticut; and the Department of
Pathology,
Oviedo University School of
Medicine, Asturias, Spain
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
| Materials and Methods |
|---|
|
|
|---|
We analyzed 145 tumor samples: 133 from a cohort of 115 patients
who underwent surgery for thyroid carcinoma and, for comparison with
the malignant cases, 12 samples of thyroid follicular adenoma.
Formalin-fixed paraffin-embedded specimens were obtained from the files
of the Pathology Departments at Yale New Haven Hospital, Yale
University, and the Covadonga Hospital, University of Oviedo, Spain.
Thyroid carcinomas were chosen to cover the entire spectrum of
differentiation for tumors of follicular cell derivation and based on
the availability of detailed clinical and follow-up information. The
pathological and clinical features of the tumors are summarized in
Table 1
. All histological
diagnoses were reviewed according to established histological
criteria11
and, similar to what was previously
described,12
the carcinomas were divided into three groups
based on their degree of differentiation (Table 1)
. Group 1 consisted
of well-differentiated thyroid tumors of either papillary (27 classical
papillary carcinomas, nine follicular variants, 10 microcarcinomas) or
follicular type. Group 2 consisted of poorly differentiated tumors
exhibiting the features of insular carcinoma13
or
consisting of neoplasms with a trabecular or solid (comedo-type) growth
pattern with nuclear hyperchromasia, high mitotic activity, and
necrosis (poorly differentiated thyroid carcinoma not otherwise
specified).11
Group 3 included a series of
undifferentiated (anaplastic) carcinomas that had been previously
investigated for ß-catenin dysregulation.10
Patients
were staged following the recommendations of the American Joint
Committee on Cancer14
and managed according to standard
clinical protocols. Follow-up information was previously available for
45 patients.12
The follow-up status in the remaining
patients was determined by clinical examination, analysis of serum TG
values, and radiographic and/or 131I-uptake
studies. Patients were followed for 1 to 17 years (5.5 years median
follow-up time) or until death. Processing of samples and clinical
information proceeded in agreement with review board approved
protocols. Histological classification of thyroid carcinoma in three
groups according to their degree of differentiation successfully
stratified the mortality risk for thyroid carcinoma in the cohort of
patients selected for the study (P = 0.0001),
thus justifying the validity of this approach.
|
Representative paraffin-embedded blocks were selected from each tumor sample and sections cut for fluorescence immunohistochemistry. This was performed as previously described.10 Briefly, after antigen retrieval sections were incubated overnight with anti-ß-catenin monoclonal antibodies (Transduction Labs., Lexington, KY) diluted to 2 to 7 µg/ml. Sections were then washed and incubated for 1 hour with Cy3-conjugated goat anti-mouse immunoglobulin antibodies (Amersham Pharmacia Biotech, Piscataway, NJ) at a 1:500 dilution. Fluorescent Cy3-conjugated secondary antibodies were used instead of conventional chromogens to increase sensitivity and to better define the subcellular localization of ß-catenin. Immunoreactivity was expressed as the percentage of positively stained target cells in each of four intensity categories (0, no staining; 1+, weak but detectable above control; 2+, distinct; 3+, intense). For each tissue section, a numerical value (the H or histology score) was derived by summing the percentages of cells staining at each intensity multiplied by the weighted intensity of staining15 after random high-power field observations (x400) corresponding to at least 4,000 tumor cells. The intense membranous staining of normal thyroid follicles adjacent to the tumor was used as internal standard for the scoring of ß-catenin expression. Negative controls were performed by omitting the primary antibody. Membranous, cytoplasmic, and nuclear immunoreactivity were evaluated by separate H scores but, given the relative paucity of tumor cells with nuclear or cytoplasmic immunostaining and the resulting low H scores, nuclear and cytoplasmic immunoreactivity patterns were simply recorded as positive or negative with no cut-off values for statistical analysis. H score values were independently estimated by two of the authors (GGR and GT) without knowledge of the clinicopathological parameters and a consensus was reached on all values used for computation. In 15 cases (11.3% of the total) the discrepancy among the authors was >10% of the individual values but in none of them did the definitive scores cross the cutoffs chosen for statistical analysis.
DNA Isolation and Mutational Analysis
DNA was isolated from 91 formalin-fixed tumor specimens corresponding to the paraffin blocks analyzed immunohistochemically. These were obtained from 66 patients with thyroid carcinoma and seven patients with follicular adenoma. Nine of the patients with carcinoma had well-differentiated tumors, (four follicular and five papillary carcinomas), 28 had poorly differentiated, and 29 had undifferentiated carcinomas. To perform mutational analysis in areas with different histological appearance, tumor differentiation and/or tumor recurrences multiple DNA samples were studied in eight cases of poorly differentiated carcinoma and in six cases of undifferentiated carcinoma. When necessary tumor material was manually microdissected to increase the proportion of neoplastic cells that always represented at least 80% of the total. DNA extraction was performed accordingly to standard procedures. Tumor DNA was evaluated for mutations in the GSK3ß phosphorylation consensus motif of the ß-catenin gene (CTNNB1 exon 3) by polymerase chain reaction-single strand conformational polymorphism (PCR-SSCP) using primers specific for the third coding exon of the ß-catenin gene (forward: 5'-primer GCTGATTTGATGGAGTTGGAA; reverse: 3'-primer GCTACTTGTTCTTGAGTGA). PCR-SSCP was conducted as previously described.10 Briefly, PCR was performed in a 30-µl reaction mixture containing 20 to 100 ng of genomic DNA, 20 pmol of each primer, 250 µmol/L of each dNTP, 2 mmol/L MgCl2, 10x Perkin Elmer buffer II, and 2.5 U of AmpliTaq Gold (Perkin Elmer Applied Biosystems Division, Foster City, CA). The mixture was heated for 10 minutes at 94°C for initial DNA denaturation, followed by 35 cycles of denaturation (94°C for 1 minute), annealing (55°C for 2 minutes), and extension (72°C for 3 minutes), on the GeneAmp PCR system 9600 (Perkin Elmer Applied Biosystems Division). For SSCP, aliquots of the PCR products were denatured, loaded onto a 40% mutation detection enhancement gel, and run in a SE 600 vertical gel apparatus (Hoefer Scientific, San Francisco, CA) at 400 V. All samples exhibiting mobility shifts by SSCP were excised from the gel, eluted, and re-amplified with the same set of primers and PCR conditions described above. The products were separated, purified, and sequenced using an Applied Biosystems 377 DNA sequencer (Perkin Elmer Applied Biosystems Division). Nucleotide sequencing from both the sense and antisense orientation was performed for confirmation. All mutated cases were verified by repeated PCR-SSCP.
Statistical Analysis
CTNNB1 exon 3 mutations, ß-catenin nuclear, or
cytoplasmic immunoreactivity were coded as "yes" or "no" for
categorical data analysis (chi-square and Fishers exact tests),
whereas the mean ß-catenin H score values were compared
using one-way analysis of variance with a Bonferroni correction made
for multiple comparisons across groups. All of the patients
investigated were studied according to: 1) histological type and degree
of differentiation of the tumor, 2) age, 3) sex, 4) tumor size, 5)
vascular invasion, 6) extrathyroidal extension (confirmed
histologically on all cases), 7) lymph node metastases, 8) distant
metastases, and 9) pathological stage (AJCC14
).
ß-catenin membrane immunoreactivity as well as CTNNB1 exon
3 mutations or ß-catenin nuclear expression were compared with the
presence of H-, K-, or N-Ras mutations and proliferative activity
(Ki67/MIB1 labeling index) in subsets of the cases analyzed. Logistic
regression statistics was performed using CTNNB1 exon 3
mutation, ß-catenin nuclear localization, and low or high membrane
ß-catenin immunoreactivity as dependent variables. Survival was
evaluated on all 115 patients with carcinoma using Kaplan-Meier plots
and log-rank tests. Prognostic models containing the accepted
clinicopathological indicators of poor outcome listed in Table 2
as independent covariates were devised
using Coxs proportional hazards analysis. The 25th percentile of
membranous ß -catenin H scores that provided optimal
stratification of data were chosen as cutoff for comparison with the
Ki67/MIB1 labeling index, logistic regression, and survival analyses.
Computing was performed using Statview (SAS Institute Inc., Cary, NC)
and GraphPad Prism (GraphPad, San Diego, CA) software.
|
| Results |
|---|
|
|
|---|
Normal thyroid follicular cells from perilesional tissue showed
strong membrane ß-catenin immunoreactivity with no nuclear or
cytoplasmic localization. This strong membranous staining of normal
tissue provided an internal control for staining distribution and
intensity. Three patterns of immunoreactivity were observed in the
thyroid tumors: 1) membranous, 2) nuclear, and 3) cytoplasmic (Figure 1)
. Membrane ß-catenin expression was
decreased in eight of 12 (66%) follicular adenomas (331 ± 68,
mean H score ± SD) and in all of the thyroid
carcinomas analyzed (131 ± 109, mean H score ±
SD) (Figure 2)
. Analysis of variance
comparison of the means of the raw ß -catenin H scores
demonstrated a significant difference between follicular adenomas and
all carcinomas (P < 0.0001) or the
well-differentiated follicular carcinoma group
(P = 0.0001). Membrane ß-catenin reduction
correlated with progressive loss of tumor differentiation
(P < 0.0001, analysis of variance) (Table 2)
.
Nuclear ß-catenin expression was observed only in poorly
differentiated (6 of 28 cases, 21.4%) or undifferentiated carcinomas
(14 of 29 cases, 48.3%) indicating that also aberrant nuclear
localization of ß-catenin is a marker for loss of tumor
differentiation (P < 0.0001, chi-square test
for trend). Nuclear expression was associated with marked reduction or
complete loss of membrane immunoreactivity among thyroid carcinomas
(P < 0.0001, analysis of variance). In eight
cases there was focal but distinct cytoplasmic immunoreactivity. Except
for one papillary carcinoma, these cases were poorly differentiated or
undifferentiated tumors. There was no significant difference in
ß-catenin expression among different histological types of thyroid
carcinoma such as well-differentiated papillary versus
follicular carcinoma (Table 2)
. Although oncocytic tumors usually
featured relatively low membrane H scores, the correlation
with ß-catenin expression patterns was not statistically significant.
|
|
SSCP analysis displayed characteristic mobility shifts (Figure 3)
and nucleotide sequencing of
individual aberrant bands revealed somatic alterations only in poorly
differentiated (7 of 28 or 25.0%) or undifferentiated (19 of 29 or
65.5%) carcinomas. The presence of CTNNB1
exon 3 mutations correlated with a diagnosis of carcinoma
(P = 0.0456, Fishers exact test) and among the
carcinomas with progressive loss of tumor differentiation
(P < 0.0001, chi-square test for trend). Figure 4
shows a schematic summary of the
location of all mutations detected and the corresponding ß-catenin
immunoreactivity patterns in thyroid cancer. The number as well as the
type of mutation or the specific amino acid substitutions did not
correlate with clinicopathological parameters other than the degree of
tumor differentiation.
|
|
In the whole cohort of cases analyzed CTNNB1 exon 3 mutations were associated with aberrant ß-catenin nuclear immunoreactivity (P = 0.0020, Fishers exact test) and with low membrane expression (P < 0.0001, analysis of variance). Although cytoplasmic ß-catenin immunoreactivity was commonly detectable in tumors with CTNNB1 exon 3 mutations, the correlation was not statistically significant.
Mutational analysis was performed on multiple samples microdissected from the same tumor or its recurrences on all cases in which a better differentiated component could be demonstrated histologically. ß-catenin mutations were identified in the anaplastic but not in the well-differentiated component associated with two undifferentiated carcinomas. Similarly, SSCP analysis of seven separate samples from three different tumors in which a well-differentiated component was associated with areas featuring poorly differentiated histological appearance revealed ß-catenin exon 3 mutations only in the less differentiated portions of the tumor. In all three cases, ß-catenin mutation was associated with markedly decreased membrane immunoreactivity and aberrant nuclear localization that were detected only in the poorly differentiated areas, whereas the better differentiated components did not exhibit nuclear staining and expressed significantly higher levels of membrane ß-catenin.
ß-Catenin Dysregulation, Clinicopathological Parameters, and Survival
Given the association (P = 0.0020,
Fishers exact test) between aberrant nuclear immunoreactivity and
CTNNB1 exon 3 mutations and because both reflect Wnt
activation, these two variables were combined for comparison with the
clinicopathological parameters and survival. Aberrant nuclear
localization/CTNNB1 exon 3 mutations and decreased membrane
ß-catenin immunoreactivity correlated with unfavorable prognostic
factors (Table 2)
. Well-differentiated papillary or follicular
carcinomas did not show aberrant nuclear localization/CTNNB1
exon 3 mutations but low membrane ß-catenin expression was in general
associated with unfavorable prognostic factors in this tumor group. The
correlation was independent and significant for old age
(P = 0.0402, analysis of variance), high tumor
stage (P = 0.0380, analysis of variance), and
distant metastases (P = 0.0304, analysis of
variance). Within the poorly differentiated carcinoma group,
unfavorable prognostic factors were commonly associated with tumors
showing low membrane ß -catenin H scores or aberrant
nuclear localization/CTNNB1 exon 3 mutations but only the
correlation between aberrant ß-catenin nuclear localization and lymph
node metastases reached statistical significance
(P = 0.0221, Fishers exact test). The lack of
statistical correlation between unfavorable prognostic indicators and
ß-catenin expression patterns or CTNNB1 mutations within
the undifferentiated carcinoma group was consistent with the uniformly
poor prognosis of anaplastic carcinomas in this series.
Survival analysis performed using the Kaplan-Meier survival estimates
method, revealed a significant correlation between low membrane ß
-catenin H score (log-rank, P < 0.0001) or
aberrant ß-catenin nuclear localization/CTNNB1 exon 3
mutations (log-rank, P = 0.0069) and patient survival
(Figure 5)
. Univariate and multivariate
analysis were performed to assess the relative risk of disease-related
death and to establish whether ß-catenin dysregulation was an
independent predictor of tumor-related death. Both low membrane ß
-catenin H score and the finding of aberrant ß-catenin
nuclear localization/CTNNB1 exon 3 mutations predicted
survival independently of the clinicopathological indicators of poor
outcome for thyroid cancer listed in Table 2
, with the exception of
tumor differentiation.
|
Cellular proliferation was previously analyzed in a subset of the thyroid carcinomas studied in this report to include 31 well-differentiated, 18 poorly differentiated, and 20 undifferentiated tumors.12 Proliferative activity was evaluated immunohistochemically after computation of the Ki67/MIB1 labeling index (ie, the percentage of tumor cell nuclei positive for the proliferation marker Ki67/MIB1)12 on sections cut from the same paraffin blocks used for the analysis of ß-catenin. Carcinomas with low membrane immunostaining for ß-catenin had higher Ki67/MIB1 labeling index (16.43 ± 22, mean ± SD) compared with those featuring high membrane immunoreactivity (5.48 ± 5, mean ± SD) (P = 0.0025, analysis of variance). Tumors with CTNNB1 exon 3 mutations or ß-catenin nuclear localization also featured higher Ki67/MIB1 labeling index (12.65 ± 12 compared with 7.245 ± 14, mean ± SD) although the difference did not reach statistical significance (P = 0.1515, analysis of variance).
Correlation of ß-Catenin Dysregulation with Oncogenic Ras
Thirty of the well-differentiated as well as all of the poorly-differentiated and all of the undifferentiated tumors have been analyzed for activating H-, K-, and N-Ras mutations at codons 12, 13, and 61.16 Ras genotyping was performed by PCR/SSCP using DNA extracted from the same paraffin blocks also analyzed for ß-catenin. Tumors with mutated H-, K-, or N-Ras had lower membrane ß-catenin H score values (70.80 ± 81, mean H score ± SD) compared with those without Ras mutations (133.80 ± 115, mean H score ± SD) (P = 0.0068, analysis of variance). H-, K-, or N-Ras mutations often coexisted with CTNNB1 exon 3 mutations or ß-catenin nuclear localization but the association did not reach statistical significance (P = 0.1113, Fishers exact test). Interestingly, H-, K-, or N-Ras mutations were detected in four of the six cases with aberrant ß-catenin nuclear localization without CTNNB1 exon 3 mutation (samples 8, 20, 22, and 98).
No statistical effects were obtained by adding H-, K-, and N-Ras
mutations to the analysis of the relationship between ß-catenin
dysregulation, clinicopathological parameters, and survival beyond what
already shown above for membrane ß -catenin H score
values, aberrant nuclear ß-catenin expression, and CTNNB1
exon 3 mutations. However, after the exclusion of the undifferentiated
carcinomas, all of which were invariably fatal, statistical analysis
demonstrated decreased survival for patients with tumors featuring
activated Ras or aberrant nuclear ß-catenin
expression/CTNNB1 exon 3 mutations (log-rank test,
P = 0.0001) (Figure 6)
.
In the same group of patients, univariate analysis revealed a high
likelihood of tumor-related death if activating Ras mutations or
ß-catenin nuclear localization/CTNNB1 exon 3 mutations
were detected (P = 0.0010; relative risk, 6.53;
95% confidence interval, 2.12 to 20). Activating Ras mutations or
aberrant ß-catenin nuclear localization/CTNNB1 exon 3
mutations represented an independent and better predictor of
tumor-related death than loss of tumor differentiation, large tumor
size, extrathyroidal extension, vascular invasion, lymph node
metastases, and advanced age.
|
| Discussion |
|---|
|
|
|---|
The observation that ß-catenin is the nodal point of the Wnt pathway has enlarged the perspective in the analysis of E-cadherin/catenin adhesion complexes in tumor progression. We show that aberrant Wnt signaling is restricted to aggressive phenotypes of thyroid neoplasms and analysis of multiple samples from several tumors with areas featuring a distinct well-differentiated component clearly demonstrates Wnt activation only in the foci with poorly or undifferentiated morphology. Although Wnt activation is not a necessary event, it may be sufficient for neoplastic progression. In fact, in at least two of the undifferentiated carcinomas in this series (samples 21 and 119, data not shown) we identified mutations in the CTNNB1 coding region (exon 3) of the ß-catenin gene but did not identify alterations of other genes relevant for tyroid tumorigenesis (Ras, RET, p53).
The overall features of ß-catenin mutations identified in this series are comparable with those reported for other cancers, although the prevalence of CTNNB1 exon 3 mutations in poorly and particularly in undifferentiated thyroid carcinomas is generally higher.2 Comparison of the pattern of CTNNB1 exon 3 mutations shows interesting differences between poorly and undifferentiated tumors some of which may find useful diagnostic applications. Undifferentiated carcinomas have a significantly higher prevalence of ß-catenin mutations, with mutations to nonphosphorylatable amino acids exceeding those found in serine or threonine. Poorly differentiated carcinomas, on the other hand, exhibit a lower prevalence of ß-catenin mutations. These involve putative Ser and Thr phosphorylation residues and often result in Thr to Ile amino acid substitutions.
Activation of Wnt signaling may occur because of different molecular events in different tumor types.2 This study demonstrates that aberrant nuclear localization of ß-catenin is significantly associated with CTNNB1 exon 3 mutations. Although the correlation is not perfect, particularly among undifferentiated carcinomas, the finding indicates that Wnt signaling in thyroid neoplasms is primarily due to of ß-catenin mutations and is compatible with the finding that APC is active in sporadic thyroid tumors.22 Our study also shows that activation of Wnt is statistically associated with loss of membrane ß-catenin expression. This is consistent with interrelated but functionally independent roles for ß-catenin in adherens junctions and in the Wnt pathway23 in thyroid cancer. In fact, laboratory models indicate that mutant ß-catenin forms active in Wnt signaling show little accumulation in the cell junctions or in the cytoplasm23 and that a reduction of E-cadherin enhances ß-catenins role in Wnt activation.24 Interestingly, decreased E-cadherin expression in thyroid tumors is also associated with loss of tumor differentiation25 and its reduction may therefore facilitate the aberrant Wnt signaling in poorly and undifferentiated thyroid cancers. Although the consequences of E-cadherin inactivation are conceivably distinct from those of ß-catenin mutation,26 a similar relationship between reduced ß-catenin expression and nuclear localization has been demonstrated for colorectal carcinomas.27
Consistent with their putative role in tumor growth, cellular proliferation is associated with both aberrant Wnt signaling and decreased membrane ß-catenin in thyroid carcinomas. However, and despite similar results in other tumor types,28 the relationships between ß-catenin mutations, tumor size, cellular proliferation, and ß-catenin expression patterns appear far from linear and requires further investigation.29,30 Several oncogenes are known to influence the development and progression of thyroid tumors and the important role played by activating Ras mutations in thyroid tumorigenesis has long been recognized.31 Tumors with activated Ras feature significantly lower membrane ß-catenin expression. This validates the in vitro observation that Ras influences localization and activity of ß-catenin by dismantling cadherin-catenin complexes, stabilizing ß-catenin and promoting its nuclear accumulation.32 The finding that Ras oncogenes facilitate aberrant Wnt signaling in thyroid cancer seems further supported by the detection of mutated Ras in the majority of cases with aberrant nuclear ß-catenin in the absence of CTNNB1 exon 3 mutation. The possible cooperation of Ras with Wnt signaling may have important clinical implications as indicated by their seemingly complementary role in determining the behavior of thyroid carcinoma subset.
Pathologists have often pointed out how many types of cancer, including poorly differentiated thyroid neoplasms,33 bear morphological similarities to the corresponding developing tissues. Alterations of the Wnt signaling pathway seem to provide a paradigm for the connection between embryogenesis and cancer because activating ß-catenin mutations have also been shown in medulloblastoma,34 hepatoblastoma,35 and Wilms tumor36 that are closely reminiscent of differentiating embryonal tissues. The close parallel between dysregulation of ß-catenin and neoplastic progression is consistent with the recent concept of a continuum in the spectrum of thyroid tumor differentiation. In contrast with neoplasms of most other epithelial organs, thyroid carcinomas of follicular cell origin have traditionally been viewed in terms of extremes, ie, well-differentiated carcinomas with papillary or follicular morphology and undifferentiated carcinomas and this approach is still reflected in the current staging system for thyroid cancer.14 The term poorly differentiated carcinoma was introduced only in the 1980s.13 Although the validity of the notion of a poorly differentiated neoplasm occupying an intermediate position in the pathological spectrum of thyroid tumors has subsequently been supported by additional studies,11 the morphological criteria used in the different case series are not always comparable. The correlations shown in this study between loss of tumor differentiation and ß-catenin dysregulation suggest this marker may prove an objective and useful adjunct to the diagnosis of these thyroid tumors.
In summary, this study identifies ß-catenin dysregulation as a pathway in the progression of thyroid tumors. Altered ß-catenin is a marker for aggressive tumor phenotypes among neoplasms of thyroid follicular cell derivation because both reduction of ß-catenin membrane immunoreactivity as well as its aberrant nuclear localization closely parallel loss of tumor differentiation and poor prognosis. The analysis of ß-catenin expression or mutation status may ultimately be very useful to objectively subtype thyroid neoplasms and more accurately predict outcomes.
| Footnotes |
|---|
Supported in part by FIS grant no. 98/5022 (to G.G.-R.).
M.L.C.s current adress: Department of Pathology, Instituto Nazionale dei Tumori, Milan, Italy.
Accepted for publication November 7, 2000.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
R. C Smallridge, L. A Marlow, and J. A Copland Anaplastic thyroid cancer: molecular pathogenesis and emerging therapies Endocr. Relat. Cancer, March 1, 2009; 16(1): 17 - 44. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. S. Gujral, W. van Veelen, D. S. Richardson, S. M. Myers, J. A. Meens, D. S. Acton, M. Dunach, B. E. Elliott, J. W.M. Hoppener, and L. M. Mulligan A Novel RET Kinase-{beta}-Catenin Signaling Pathway Contributes to Tumorigenesis in Thyroid Carcinoma Cancer Res., March 1, 2008; 68(5): 1338 - 1346. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. B. Kim, C. J Lewis, K. D McCall, R. Malgor, A. D Kohn, R. T Moon, and L. D Kohn Overexpression of Wnt-1 in thyrocytes enhances cellular growth but suppresses transcription of the thyroperoxidase gene via different signaling mechanisms J. Endocrinol., April 1, 2007; 193(1): 93 - 106. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Rao, N. Kremenevskaja, R. von Wasielewski, V. Jakubcakova, S. Kant, J. Resch, and G. Brabant Wnt/{beta}-Catenin Signaling Mediates Antineoplastic Effects of Imatinib Mesylate (Gleevec) in Anaplastic Thyroid Cancer J. Clin. Endocrinol. Metab., January 1, 2006; 91(1): 159 - 168. [Abstract] [Full Text] [PDF] |
||||
![]() |
A S Rao, N Kremenevskaja, J Resch, and G Brabant Lithium stimulates proliferation in cultured thyrocytes by activating Wnt/{beta}-catenin signalling Eur. J. Endocrinol., December 1, 2005; 153(6): 929 - 938. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Liu, S. L. Asa, and S. Ezzat 1{alpha},25-Dihydroxyvitamin D3 Targets PTEN-Dependent Fibronectin Expression to Restore Thyroid Cancer Cell Adhesiveness Mol. Endocrinol., September 1, 2005; 19(9): 2349 - 2357. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Marx and W. F. Simonds Hereditary Hormone Excess: Genes, Molecular Pathways, and Syndromes Endocr. Rev., August 1, 2005; 26(5): 615 - 661. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Yu, P. M. Weinberger, E. Provost, B. G. Haffty, C. Sasaki, J. Joe, R.L. Camp, D.L. Rimm, and A. Psyrri {beta}-Catenin Functions Mainly as an Adhesion Molecule in Patients with Squamous Cell Cancer of the Head and Neck Clin. Cancer Res., April 1, 2005; 11(7): 2471 - 2477. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chevillard, N. Ugolin, P. Vielh, K. Ory, C. Levalois, D. Elliott, G. L. Clayman, and A. K. El-Naggar Gene Expression Profiling of Differentiated Thyroid Neoplasms: Diagnostic and Clinical Implications Clin. Cancer Res., October 1, 2004; 10(19): 6586 - 6597. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Imai, J.-I. Onose, M. Hasumura, M. Ueda, T. Takizawa, and M. Hirose Sequential Analysis of Development of Invasive Thyroid Follicular Cell Carcinomas in Inflamed Capsular Regions of Rats Treated with Sulfadimethoxine after N-bis(2-hydroxypropyl)nitrosamine-initiation Toxicol Pathol, February 1, 2004; 32(2): 229 - 236. [Abstract] [PDF] |
||||
![]() |
O. Marin, V. H. Bustos, L. Cesaro, F. Meggio, M. A. Pagano, M. Antonelli, C. C. Allende, L. A. Pinna, and J. E. Allende Inaugural Article: A noncanonical sequence phosphorylated by casein kinase 1 in {beta}-catenin may play a role in casein kinase 1 targeting of important signaling proteins PNAS, September 2, 2003; 100(18): 10193 - 10200. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Garcia-Rostan, H. Zhao, R. L. Camp, M. Pollan, A. Herrero, J. Pardo, R. Wu, M. L. Carcangiu, J. Costa, and G. Tallini ras Mutations Are Associated With Aggressive Tumor Phenotypes and Poor Prognosis in Thyroid Cancer J. Clin. Oncol., September 1, 2003; 21(17): 3226 - 3235. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Xu, R. M. Quiros, P. Gattuso, K. B. Ain, and R. A. Prinz High Prevalence of BRAF Gene Mutation in Papillary Thyroid Carcinomas and Thyroid Tumor Cell Lines Cancer Res., August 1, 2003; 63(15): 4561 - 4567. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. B. Wreesmann, R. A. Ghossein, S. G. Patel, C. P. Harris, E. A. Schnaser, A. R. Shaha, R. M. Tuttle, J. P. Shah, P. H. Rao, and B. Singh Genome-Wide Appraisal of Thyroid Cancer Progression Am. J. Pathol., November 1, 2002; 161(5): 1549 - 1556. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ishigaki, H. Namba, M. Nakashima, T. Nakayama, N. Mitsutake, T. Hayashi, S. Maeda, M. Ichinose, T. Kanematsu, and S. Yamashita Aberrant Localization of {beta}-Catenin Correlates with Overexpression of Its Target Gene in Human Papillary Thyroid Cancer J. Clin. Endocrinol. Metab., July 1, 2002; 87(7): 3433 - 3440. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sobrinho-Simoes, C. Sambade, E. Fonseca, and P. Soares Poorly Differentiated Carcinomas of the Thyroid Gland: A Review of the Clinicopathologic Features of a Series of 28 Cases of a Heterogeneous, Clinically Aggressive Group of Thyroid Tumors International Journal of Surgical Pathology, April 1, 2002; 10(2): 123 - 131. [Abstract] [PDF] |
||||
![]() |
M. Santoro, M. Papotti, G. Chiappetta, G. Garcia-Rostan, M. Volante, C. Johnson, R. L. Camp, F. Pentimalli, C. Monaco, A. Herrero, et al. RET Activation and Clinicopathologic Features in Poorly Differentiated Thyroid Tumors J. Clin. Endocrinol. Metab., January 1, 2002; 87(1): 370 - 379. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Helmbrecht, A. Kispert, R. von Wasielewski, and G. Brabant Identification of a Wnt/{beta}-Catenin Signaling Pathway in Human Thyroid Cells Endocrinology, December 1, 2001; 142(12): 5261 - 5266. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |