| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |





From the Toronto-Sunnybrook Regional Cancer Centre,*
Toronto, Ontario, Canada; the Department of
Medicine
and the Faculty of
Dentistry,
University of Toronto, Toronto,
Ontario, Canada; the Departments of
Pathology
and Medical Biophysics and
Division of Cancer Biology Research,||
Sunnybrook and
Womens College Health Sciences Centre, Toronto, Ontario, Canada; the
WJB Dorn VA Medical Center,¶
Columbia, South
Carolina; the Research Service,**
Stratton
Veterans Affairs Medical Center, Albany, New York; and the College of
Biological Sciences,

University
of Minnesota, St. Paul, Minnesota
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
We previously reported that the nuclear expression of cell-cycle protein markers varies in an orderly and sequential manner throughout the day in the oral mucosa of diurnally active human study participants.16 Specifically, a marker of late G1 phase (p53), is maximal at 11:00 hours, whereas markers of G1 to S phase (cyclin E), G2 phase (cyclin A), and M phase (cyclin B) are maximal at 15:00 hours, 16:00 hours, and 21:00 hours, respectively. The normal physiological progression throughout time for the peak expression of these proteins is consistent with previous rodent and human data showing a circadian variation in cell proliferation in gastrointestinal tract mucosa.17-20
Thymidylate synthase (TS) catalyzes the reductive methylation of deoxyuridine-5'-monophosphate to deoxythymidine-5'-monophosphate, the only pathway for de novo synthesis of deoxythymidine-5'-monophosphate and subsequent DNA synthesis.21 TS activity is highest during S phase, and can therefore be used to mark this event in the cell cycle.22-24
We hypothesized that the human (h prefix for human) clock genes hPer1, hCry1, hBmal1, hClock, and hTim, would be expressed in human oral mucosa and skin with a circadian profile analogous to that reported for rodent peripheral tissues (relative to the activity/rest cycle). Based on the known circadian coordination of proliferation in oral mucosa, we hypothesized that TS enzyme activity in oral mucosa would have a circadian rhythm with peak activity in early afternoon. We hypothesized also that there might be a predictable association between clock gene expression and cell-cycle phases.
| Materials and Methods |
|---|
|
|
|---|
The Sunnybrook Health Science Center Ethics Review Board approved the study protocol, and all study participants signed an informed consent. All study participants were healthy males, mean age 27.3 years (range, 22 to 33 years). The average time of sleep onset was 23:30 hours (range, 22:30 to 01:00 hours) and that for awakening was 07:15 hours (range, 06:30 to 09:00 hours). No attempt was made to synchronize the sleeping habits of the study participants before the study. The study participants slept during the night of the procedure except for the 30 minutes required to perform the biopsies at midnight and at 04:00 hours. All study participants had lunch at 12:30 hours and dinner at 20:30 hours. Snacks and cold drinks were allowed at the study participants discretion at other times. The six biopsies, from each of the eight study participants, were obtained during a single 24-hour period beginning at 08:00 hours on December 5, 1998.
Buccal mucosa and skin biopsies for RNA studies were obtained under local anesthesia using a 3-mm dermatological punch at 4-hour intervals beginning at 08:00 hours. Skin biopsies were obtained from the right hip, in an area not exposed to sun. All tissues were immediately snap-frozen in liquid nitrogen and stored at -70°C. A second biopsy was taken from the oral mucosa from all study participants at the same times for a separate study of TS enzyme activity. Serum was separated from blood and stored at -70°C until assayed for cortisol (microparticle enzyme immunoassay, Abbot Diagnostics) and melatonin.25
RNA Isolation
Tissues were thawed and then minced using a homogenizer. Total RNA was extracted using Trizol (Gibco BRL) according to the manufacturers specifications. cDNA was generated by reverse transcription (Gibco BRL) of 2 µg of total RNA in a volume of 20 µl of buffer containing 2.5 mmol/L DTT, 20 U RNase inhibitor, 50 pmol random primer, 100 nmol dNTP, and 200 U of reverse transcriptase. The mix was incubated for 1 hour at 37°C, followed by three times dilution, and inactivation at 65°C for 10 minutes before storage at -20°C.
Polymerase Chain Reaction (PCR)
Primers were designed based on published data on human homologues of the clock genes in GenBank as follows: hClock: forward (f) AAGTTAGGGCTGAAAGACGACG, reverse (r) GAACTCCGAGAAGAGGCAGAAG, product size 171 bp. hPer1: f-CTGAGGAGGCCGAGAGGAAAGAA, r-AGGAGGAGGAGGCACATTTACGC, 132 bp; hBmal1: f-AAGGATGGCTGTTCAGCACATGA, r-CAAAAATCCATCTGCTGCCCTG, 132 bp; hTim: f-GGAGAAAGCTCAGCAGCATGATGA, r-TGCTCAATGAAGTGGAAGGTACGG, 138 bp; hCry1: f-ATCTAGCCAGGCATGCAGTT, r-CTCCAATCTGCATCAAGCAA, 132 bp; ß-actin: f-GGGGCTGTGCTGTGGAAGCTAA, r-GTGCCAGGGCAGTGATCTCCTT, 208 bp; TS: f-CCAAAGCTCAGGATTCTTCG, r-GCACCCTAAACAGCCATTTC, 119 bp.
Duplex PCR was performed in a 25-µl reaction mixture containing 1 µl of cDNA, 0.2 µmol/L of each primer, 200 µmol/L dNTP, 2 U of Taq polymerase (Gibco BRL), and buffer (10 mmol/L Tris-HCl, pH 8.3, 50 mmol/L potassium chloride, 1.5 mmol/L magnesium chloride, and 1% Triton X-100). Each PCR reaction consisted of one cycle at 94°C for 5 minutes, followed by 30 cycles at 94°C for 30 seconds, 60°C for 1 minute, and 72°C for 90 seconds, with an additional 7-minute cycle at 72°C at the end of the reaction. First, primers for hClock were co-amplified with ß-actin. After showing that there was no variation in the expression of hClock throughout a 24-hour period, primers for hBmal1, hTim, hPer1, hCry1, and TS were amplified together with hClock in a duplex PCR. Products were analyzed by the electrophoresis of 10 µl of PCR product through 2% agarose gel. The relative intensity of each band was compared using computer densitometry, and the results expressed as a ratio of the density for the gene of interest to that of the control gene in each sample.
TS Enzyme Activity
TS enzyme activity was studied only in oral mucosa to allow us to correlate the clock gene data with our previous data on cell-cycle progression in oral mucosa. Frozen tissues were thawed and homogenized in fixed volumes of ice-cold 200 mmol/L Tris-HCl, pH 7.4, with 100 mmol/L NaF, 20 mmol/L ß-mercaptoethanol, and a protease inhibitor cocktail (Boehringer Mannheim, Mannheim, Germany) by mechanical homogenization using 40 complete strokes with a glass Dounce homogenizer. The homogenates were centrifuged at 4°C at 12,000 x g for 10 to 20 minutes, the supernatant fluid recovered, and protein content determined by the dye-binding method of Bradford.26
TS catalytic activity was determined using a tritium release assay by the method of Armstrong and Diasio27 with modifications. TS activity was determined on 35-µl freshly prepared 12,000 x g tissue supernatants in a final volume of 50 µl in 200 mmol/L Tris-HCl, pH 7.4, 100 mmol/L NaF, 20 mmol/L ß-mercaptoethanol, protease inhibitors, 5 µl of cofactor solution (6.5 mmol/L tetrahydrofolic acid, 65 mmol/L NaHCO3, 65 mmol/L formalin, 0.25 mol/L ß-mercaptoethanol, and 40 mmol/L sodium ascorbate, pH 7.0) and 10 µl of 50 µmol/L [5-3H]-2'-deoxyuridine 5'-monophosphate (20 Ci/mmol; Moravek Biochemical, Brea, CA) and 25 mmol/L CMP. Linearity was established for the working range of protein concentrations and incubation times at 37°C. Samples were incubated in triplicate at 37°C. At one time point, the radioactivity in the acid soluble fraction, after acid charcoal treatment, was determined. Background counts were consistently <5% of total input counts and standard deviations of triplicate determinations were <15%.
Data Analysis
The single cosinor method28 was used to analyze for circadian rhythm individually and as a group, using both original data and data normalized from 0 to 1 (the six original data points for each variable throughout 24 hours divided by the largest value). This inferential method involves fitting a curve of a predefined period(s) by the method of least squares. The rhythm characteristics and their dispersions standard error (SE) and 95% confidence interval (CI)) estimated by this method include the mesor (middle value of the fitted cosine representing a rhythm-adjusted mean), the amplitude (half the difference between the minimum and maximum of the fitted cosine function), and the high point or acrophase (time of peak value in the fitted cosine function expressed as the lag in hours and minutes from midnight). The waveform of a time series may sometimes be more accurately approximated by the least squares fit of a multiple-component cosine model involving a concomitant fit of two or more components (ie, 24 hours plus 12 or 8 or 3 hours, etc). Each time series was tested for a circadian rhythm by the fit of a 24-hour single cosine and a 24- and 12-hour composite cosine model. The latter model was informative (ie, the 12-hour component significantly decreased residual error estimates beyond that of the 24-hour component alone) only for the analysis of hPer1. Detection of rhythm was achieved by rejection of the zero amplitude hypothesis with 95% certainty as reflected by the P value resulting from a comparison of residuals before and after the cosine curve fit. Rhythm characteristics (mesor, amplitude, acrophase) for each variable were compared between sites (skin versus oral mucosa) by a parameter test.29 The six sampling time-normalized means were also analyzed for time-effect by one-way analysis of variance (F and P values).
| Results |
|---|
|
|
|---|
Cortisol and melatonin rhythms were studied in each individual
during the biopsy period to further objectively document normal
circadian time keeping and complement the daily patterns of reported
sleep and activity. During the 24-hour biopsy period, all study
participants showed the expected circadian variation in serum cortisol
and melatonin (Figure 1)
with peak values
early in the day for cortisol (12:31 hours, cosinor, P
< 0.001; analysis of variance: F = 11.9,
P < 0.001) and at night for melatonin (03:08 hours,
cosinor, P < 0.001; analysis of variance:
F = 42.5, P < 0.001).
|
Circadian Pattern of Clock Gene Expression
Figure 2, A through F
, shows
representative panels for the duplex PCR with hClock
co-amplified with ß-actin, and
hPer1, hCry1, hBmal1, hTim,
and TS. There was no significant 24-hour variation in
hClock expression using ß-actin as
control (analysis of variance: F = 0.7,
P = 0.593; cosinor: P = 0.162).
Therefore, hClock was used in subsequent experiments as
control for hBmal1, hPer1, hTim, hCry1, and
TS. The data are summarized in Tables 1, 2, and 3
.
|
|
|
|
There was no significant 24-hour variation in
hClock expression (Figure 3)
in oral mucosa (analysis of variance: F = 0.7,
P = 0.593; cosinor, P = 0.162) or skin
(analysis of variance: F = 0.6, P =
0.722; cosinor, P = 0.293). The expression of
hTim (Figure 3)
throughout 24 hours was also nonrhythmic in
both oral mucosa (analysis of variance: F = 0.7,
P = 0.638; cosinor, P = 0.265) and skin
(analysis of variance: F = 0.8, P =
0.638; cosinor, P = 0.294).
|
Although there is a significant 24-hour variation in the
expression of hPer1 in both oral mucosa and skin (Tables 1 and 2)
, a 12/24-hour composite cosinor model, explains a greater amount
of the variance in the data and predicts better the times of day for
peak values than the 24-hour single cosinor model (Table 3
and Figure 4
). With the 12/24-hour composite cosine
model, two significant daily peaks in hPer1 expression were
detected in both tissues. The first and dominant peak was at 0758 hours
(95% CI, 0628 to 0928 hours; cosinor, P < 0.001) and
1051 hours (95% CI, 09:40 to 1202 hours; cosinor, P =
0.013) in oral mucosa and skin, respectively. The predicted peak times
for the major peaks in oral mucosa and skin are now much closer in time
than with the 24-hour fit, but the timing of the peaks is still
significantly different (P < 0.001 from
parameter test). The second and smaller peak in hPer1
expression was at 1958 hours (95% CI, 1828 to 2128 hours; cosinor,
P = 0.045) and 2251 hours (95% CI, 21:40 to 00:02
hours, cosinor, P = 0.01) in oral mucosa and skin,
respectively. The timing of these peaks was also significantly
different (P = 0.036 from parameter test). The
percent amplitude of the primary peak for hPer1 was
significantly lower in skin than in oral mucosa (65.5%
versus 31.1%; P = 0.0182). In the oral
mucosa, all eight study participants had peak measured (raw data)
hPer1 expression at 0800 hours. In the skin, five of eight
study participants had peak measured hPer1 expression at
1200 hours, with the remaining three peaking between 0000 and 0800
hours.
|
There was a significant 24-hour variation (Figure 4)
in the
expression of hBmal1, in both oral mucosa (analysis of
variance: F = 25.7, P < 0.001) and
skin (analysis of variance: F = 6.6, P
< 0.001). A 24-hour cosinor fit to these data demonstrates a
significant circadian rhythm with peak expression after dusk in both
oral mucosa (2140 hours; 95% CI, 2100 to 2220 hours; cosinor,
P < 0.001) and skin (2214 hours; 95% CI, 2048 to 2340
hours; cosinor, P < 0.001). The timing of the peak for
hBmal1 in oral mucosa was identical to that in skin
(P = 0.462 for difference). The percent
amplitude of the variation in hBmal1 was significantly lower
in skin than in oral mucosa (21.3% versus 53.8%;
P < 0.0001). In all eight study participants, peak
measured hBmal1 expression occurred between 2000 hours and
0000 hours both in the oral mucosa and skin.
There was a significant 24-hour variation (Figure 4)
in the expression
of hCry1 in oral mucosa with peak expression at 17:04 hours
(95% CI, 1536 to 1836 hours; cosinor, P < 0.001;
analysis of variance: F = 8.7, P <
0.001). In seven of eight study participants peak measured
hCry1 expression occurred between 1200 hours and 1600 hours,
with one study participant peaking at 2000.
Circadian Pattern of TS Activity and TS mRNA Levels in Oral Mucosa
There was a significant circadian variation in TS activity (Figure 5)
in oral mucosa with peak values in
early afternoon at 1327 hours (95% CI, 1100 to 1600 hours, cosinor,
P = 0.008; analysis of variance: F =
2.2, P = 0.076). The mean value for oral mucosal TS
activity in the eight study participants was 8.5 ± 0.73
pmol/min/mg with a range of individuals mean values of 6.7 to 16.6
pmol/minute/mg. Within individuals, oral mucosa TS activity varied 1.4-
to 5.1-fold (mean, 3.2-fold) throughout the day, with values varying
from 1.5 to 27.8 pmol/minute/mg. In all eight study participants, peak
measured TS activity occurred between 0800 hours and 1600 hours, with
six study participants having peak TS activity between the 4-hour time
span from 1200 hours to 1600 hours. Protein yields in the tissue
supernatant preparations failed to vary with time of day suggesting
that these time of day differences in TS activity are not the result of
differential dilution by variable amounts of total protein throughout
the day.
|
| Discussion |
|---|
|
|
|---|
This is the first study to show a rhythmic expression of clock genes in peripheral human tissue throughout 24 hours. Study participants had a normal circadian activity profile as documented by their reported sleep onset/awakening times and their rhythm in cortisol and melatonin. We have shown that hClock, hTim, hPer1, hCry1, and hBmal1 are expressed in human oral mucosa and skin, with a circadian profile that is consistent with that found in the SCN and peripheral tissues of mice and rats.3 hPer1, hCry1, and hBmal1 show a rhythmic expression, peaking early in the morning (early activity), in late afternoon and at night (late activity), respectively, whereas hClock and hTim are not rhythmic. In the mouse SCN, mPer1 peaks soon after subjective dawn (early activity), mCry1 peaks later in the day, and mBmal1 peaks after subjective dusk (late activity), whereas mClock and mTim expression is not rhythmic. In rodent peripheral tissues the clock gene expression follows the same pattern, but Per1, Cry1, and Bmal1 peak 4 to 6 hours later than in the SCN.10,11 These data suggest that the human clock genes may be functionally important for the molecular control of the human circadian pacemaker, thus extending the homology that exists between the clock genes in Drosophila and rodents to humans. The functional importance of the clock genes in man is further suggested by the recent finding of hClock expression in the human SCN30 and that a hClock polymorphism is associated with an inherited human diurnal preference (eveningness).31
When the data for hPer1 expression in oral mucosa and skin are analyzed using a 24/12 composite cosine model, two significant peaks (a major and a minor one) are detected in both tissues. In rodents, Per1, Per2, and Per3 expression peaks several hours apart during a 4- to 6-hour period within a given tissue.11 Previous reports of per gene expression in peripheral tissues of rodents have documented one major 24-hour peak for each per gene. Some of these studies, however, used a limited number of sampling times and analysis for multiple rhythm components were not performed. Although the two daily peaks for hPer1, seen here, could represent hybridization of the hPer1 primers with more than one variant of hPer with different times of peak expression, a truly biphasic expression of hPer1 is possible and warrants further study.
Sampling every 4 hours is used commonly in human studies and rodent studies in chronobiology. Although more frequent sampling might allow for a better detection of rhythms with a shorter period than 24 hours, it could also interfere with and distress the study participants to the extent of masking the circadian rhythm. In discussions with our ethics committee, every 4-hour sampling was seen as the most we could expect our study participants to endure. This sampling frequency proved adequate to detect the expected circadian variation in clock gene expression.
TS in Oral Mucosa
This is the first study to look at the enzyme activity of TS in
human tissue throughout 24 hours. The finding of a significant
circadian rhythm in this S-phase marker further supports our previous
finding of a circadian coordination of cell-cycle events in oral
mucosa.16
The timing of the peak of TS activity correlates
well with the timing of S phase in the previous study (Figure 6, A
and B3). A circadian variation has
been demonstrated in rodent tissue TS enzyme activity32
and rodent and in vitro studies have shown that peak TS
activity coincides with S phase.22-24
|
TS is the target for chemotherapy drugs such as 5-FU, FdUrd, and methotrexate, and also for several new folate-based TS inhibitors and multi-targeted antifolates. Studies of the circadian timing of FdUrd and 5-FU in rodents and humans show large differences in gastrointestinal toxicity and antitumor response depending on the time of day of therapy.35-37 In a prospective randomized clinical trial, optimal timing (for reduced toxicity) of 5-FU-based chemotherapy reduced fivefold (14% versus 76%, P < 0.0001) the rate of severe oral mucosal toxicity.37 Our findings of a circadian variation in both cell-cycle progression16 and TS enzyme activity in human oral mucosa may partly explain this significant time-dependent incidence of 5-FU-induced oral mucosal toxicity.
Human Cell-Cycle Progression May Be Gated by the Circadian Clock
Gating of the cell division cycle by the circadian clock has been
demonstrated in several unicellular organisms including Euglena,
Cyanobacteria, Chlamydomonas, Paramecium, Tetrahymena, and
Gonyaulax polyedra.38-43
The data on the TS
enzyme activity in oral mucosa allow timing of the peak in S phase in
relation to the peak expression of the clock genes (Figure 6
, B3). The
timing of the TS peak in early afternoon agrees well with the time of
peak S-phase markers in our previous study (Figure 6A)
of cell-cycle
progression in human oral mucosa.16
In oral mucosa, the
major peak in hPer1 expression coincides with the peak in a
G1 phase marker (p53) but precedes the peak in
markers of S phase (cyclin E and TS). The peak for hBmal1
coincides with an M-phase marker (cyclin B1).
The information on human skin proliferation (Figure 6D)
is based on our
cosinor analysis of pooled data from 14 studies looking at the timing
of S phase (peak, 16:06 hours; 95% CI, 14:04 to 18:08 hours), and 12
studies looking at the timing of M phase (peak, 22:54 hours; 95% CI,
22:12 to 23:36 hours).44
Although we have not measured
proliferation markers in the skin samples in this study, the
coincidence of peaks in specific cell-cycle stages in skin compared to
the oral mucosa is striking. With these limitations in mind, the major
peak in hPer1 expression in skin may also coincide with the
peak in G1 phase, whereas the peak in
hBmal1 may coincide with the peak in M phase (Figure 6, C and D)
.
Our correlation of the timing of clock gene expression in oral mucosa
with the timing of S phase (TS activity), suggests that the circadian
clock may, in part, control the timing of cell-cycle events in tissues
undergoing continuous circadian rhythms in proliferation
(gastrointestinal mucosa, skin, and bone marrow). That the cell cycle
may be influenced by the circadian rhythm, is supported by the
observation that phase-shifting of mice leads to a corresponding shift
(throughout 3 to 4 weeks) in the timing of cell-cycle events both in
gut and bone marrow.45,46
Such phase-shifting has recently
been shown to be associated with a corresponding rapid shift (1 day) in
the circadian expression of Per1 in rat SCN and a delayed
shift (
6 days) in the Per1 rhythm in peripheral
tissues.47
Per1 peak expression has been found
to coincide with the peak expression of clock-controlled genes that
control downstream circadian processes.48,49
In our study,
the hPer1 peak coincides with the peak in oral mucosa
G1 phase, where the main restriction point
controlling progression through the cell cycle resides.50
Although no cause and effect relationships between clock gene
expression and cell proliferation can be claimed by our results, these
data set the stage for a testable hypothesis to relate these two
fundamental processes.
Many mouse and rat organs that are not actively proliferating (muscle, kidney, etc) have been shown to have a circadian expression of Per, Bmal1, and Cry.10,11,13,14 Active tissue proliferation is therefore not a requisite for synchronous clock gene expression. In these tissues the clock genes may provide clock control of nonproliferative metabolic and physiological processes via the expression of clock-controlled genes.51
| Footnotes |
|---|
Supported by the Pharmaceutical Manufacturers Association of Canada Health Research Foundation/Medical Research Council of Canada (to G. A. B.), The Medical Research Council of Canada (to R. C. K. J. and Y. B.-D.), the National Cancer Institute of Canada (to G. A. B., R. C. K. J., and Y. B.-D.), the Office of Research and Development, Medical Research Service, Department of Veterans Affairs (to P. A. W. and W. J. M. H.), the Robison Family Foundation (to W. J. M. H.), and the National Institutes of Health (grants RO1 CA31635 to W. J. M. H. and RO1 CA50749 to W. J. M. H.).
Accepted for publication February 5, 2001.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A. Grechez-Cassiau, B. Rayet, F. Guillaumond, M. Teboul, and F. Delaunay The Circadian Clock Component BMAL1 Is a Critical Regulator of p21WAF1/CIP1 Expression and Hepatocyte Proliferation J. Biol. Chem., February 22, 2008; 283(8): 4535 - 4542. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zamborszky, C. I. Hong, and A. Csikasz Nagy Computational Analysis of Mammalian Cell Division Gated by a Circadian Clock: Quantized Cell Cycles and Cell Size Control J Biol Rhythms, December 1, 2007; 22(6): 542 - 553. [Abstract] [PDF] |
||||
![]() |
M. Hastings, J. S O'Neill, and E. S Maywood Circadian clocks: regulators of endocrine and metabolic rhythms J. Endocrinol., November 1, 2007; 195(2): 187 - 198. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Krugluger, A. Brandstaetter, E. Kallay, J. Schueller, E. Krexner, S. Kriwanek, E. Bonner, and H. S. Cross Regulation of Genes of the Circadian Clock in Human Colon Cancer: Reduced Period-1 and Dihydropyrimidine Dehydrogenase Transcription Correlates in High-Grade Tumors Cancer Res., August 15, 2007; 67(16): 7917 - 7922. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Tsinkalovsky, R. Smaaland, B. Rosenlund, R. B. Sothern, A. Hirt, S. Steine, A. Badiee, J. Foss Abrahamsen, H. G. Eiken, and O. D. Laerum Circadian Variations in Clock Gene Expression of Human Bone Marrow CD34+ Cells J Biol Rhythms, April 1, 2007; 22(2): 140 - 150. [Abstract] [PDF] |
||||
![]() |
D. Gholam, S. Giacchetti, C. Brezault-Bonnet, M. Bouchahda, D. Hauteville, R. Adam, B. Ducot, O. Ghemard, F. Kustlinger, C. Jasmin, et al. Chronomodulated Irinotecan, Oxaliplatin, and Leucovorin-Modulated 5-Fluorouracil as Ambulatory Salvage Therapy in Patients with Irinotecan- and Oxaliplatin-Resistant Metastatic Colorectal Cancer Oncologist, November 1, 2006; 11(10): 1072 - 1080. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Reed, H. F. Nijhout, M. L. Neuhouser, J. F. Gregory III, B. Shane, S. J. James, A. Boynton, and C. M. Ulrich A Mathematical Model Gives Insights into Nutritional and Genetic Aspects of Folate-Mediated One-Carbon Metabolism J. Nutr., October 1, 2006; 136(10): 2653 - 2661. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Wood, J. Du-Quiton, S. You, and W. J.M. Hrushesky Circadian clock coordinates cancer cell cycle progression, thymidylate synthase, and 5-fluorouracil therapeutic index. Mol. Cancer Ther., August 1, 2006; 5(8): 2023 - 2033. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Lemos, J. L. Downs, and H. F. Urbanski Twenty-Four-Hour Rhythmic Gene Expression in the Rhesus Macaque Adrenal Gland Mol. Endocrinol., May 1, 2006; 20(5): 1164 - 1176. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-M. Li, S. Kanekal, D. Crepin, C. Guettier, J. Carriere, G. Elliott, and F. Levi Circadian pharmacology of L-alanosine (SDX-102) in mice. Mol. Cancer Ther., February 1, 2006; 5(2): 337 - 346. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Fukuoka, N. Burioka, M. Takata, S. Ohdo, M. Miyata, M. Endo, and E. Shimizu Glucocorticoid Administration Increases hPer1 mRNA Levels in Human Peripheral Blood Mononuclear Cells In Vitro or In Vivo J Biol Rhythms, December 1, 2005; 20(6): 550 - 553. [PDF] |
||||
![]() |
M. Takimoto, A. Hamada, A. Tomoda, S. Ohdo, T. Ohmura, H. Sakato, J. Kawatani, T. Jodoi, H. Nakagawa, H. Terazono, et al. Daily expression of clock genes in whole blood cells in healthy subjects and a patient with circadian rhythm sleep disorder Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2005; 289(5): R1273 - R1279. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. M. Leclerc and F. R. Boockfor Pulses of Prolactin Promoter Activity Depend on a Noncanonical E-Box that Can Bind the Circadian Proteins CLOCK and BMAL1 Endocrinology, June 1, 2005; 146(6): 2782 - 2790. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. F. Nijhout, M. C. Reed, P. Budu, and C. M. Ulrich A Mathematical Model of the Folate Cycle: NEW INSIGHTS INTO FOLATE HOMEOSTASIS J. Biol. Chem., December 31, 2004; 279(53): 55008 - 55016. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. R. Ueda, W. Chen, Y. Minami, S. Honma, K. Honma, M. Iino, and S. Hashimoto Molecular-timetable methods for detection of body time and rhythm disorders from single-time-point genome-wide expression profiles PNAS, August 3, 2004; 101(31): 11227 - 11232. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Rich, R. C. Shepard, and S. T. Mosley Four Decades of Continuing Innovation With Fluorouracil: Current and Future Approaches to Fluorouracil Chemoradiation Therapy J. Clin. Oncol., June 1, 2004; 22(11): 2214 - 2232. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. B. Boivin, F. O. James, A. Wu, P. F. Cho-Park, H. Xiong, and Z. S. Sun Circadian clock genes oscillate in human peripheral blood mononuclear cells Blood, December 1, 2003; 102(12): 4143 - 4145. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Canaple, T. Kakizawa, and V. Laudet The Days and Nights of Cancer Cells Cancer Res., November 15, 2003; 63(22): 7545 - 7552. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Magne, J.-L. Fischel, A. Dubreuil, P. Formento, J. Ciccolini, J.-L. Formento, C. Tiffon, N. Renee, S. Marchetti, M.-C. Etienne, et al. ZD1839 (Iressa) Modifies the Activity of Key Enzymes Linked to Fluoropyrimidine Activity: Rational Basis for a New Combination Therapy with Capecitabine Clin. Cancer Res., October 15, 2003; 9(13): 4735 - 4742. [Abstract] [Full Text] [PDF] |
||||