| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Animal Models |
and Interleukin-10 in a Murine Model of Human Granulocytic Ehrlichiosis
From the Division of Comparative Medicine*
and
the Department of Pathology,
Division of
Medical Microbiology, The Johns Hopkins University School of
Medicine, Baltimore, Maryland
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
allows tissue injury that is suppressed by interleukin
(IL)-10 after initiation by ehrlichia infection. Thus, parental
C57BL/6, IL-10-/-, and IFN--/- strains of mice
were infected and then assayed for hepatic histopathological
lesions, ehrlichial burden, and cytokine responses to
ehrlichial antigen in primary splenic cultures during the first 21 days
after infection. Histopathological severity in C57/BL6 and IL-10-/-
mice rose in parallel through day 7, but then diverged as
pathology in IL-10-/- mice continued to increase and remained high
throughout the course of the study. The histopathological rank of
C57BL/6 of mice decreased at day 10 and returned to baseline levels at
days 14 and 21. In contrast, the IFN--/- strain had
baseline pathology scores throughout the course of the
infection, yet had significantly higher ehrlichial burden both
in the blood and tissues than C57BL/6 or IL-10-/- mice. This suggests
that histopathological lesions in the HGE murine model do not result
from direct ehrlichia-mediated injury but from immunopathological
mechanisms initiated by ehrlichial infection. The similarities with
lesions in humans suggest an immunopathological basis for
HGE.
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
peak before maximal pathological injury when
ehrlichiae are absent in tissues, supporting a role for host immunity
in the pathogenesis of HGE.3
The purpose of this study was
to examine the roles of proinflammatory and anti-inflammatory cytokines
and ehrlichial quantity on host pathology in a murine model using
IFN-- and interleukin (IL)-10-deficient mice. |
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Pathogen-free male mice (3 to 6 weeks of age) were obtained from
Jackson Labs (Bar Harbor, ME) and maintained in microisolator cages in
accordance with institutional guidelines. 48 mice of each of the
following strains were obtained:
C57BL/6-Ifng-tm1Ts (IFN--/-),
C57BL/6-IL10-tm1Cgn (IL-10-/-), and
parental C57BL/6 (hereafter referred to as C57BL/6). They were allowed
to acclimate for 5 days before manipulation.
Inoculum
Webster strain HGE agent E. phagocytophila was grown in HL-60 cells, a human promyelocytic cell line, until 100% of the cells contained morulae. On the day of inoculation, infected and uninfected cells were centrifuged, then resuspended in serum-free RPMI 1640 medium to a concentration of 2 x 106 cells/ml . Twenty-four mice of each strain were inoculated intraperitoneally with 0.5 ml (1 x 106) uninfected HL-60 cells (sham-inoculum), or HL-60 cells infected with E. phagocytophila (passage 4). Mice were observed daily for evidence of clinical illness, such as fur ruffling, hunched posture, depression, anorexia, or tachypnea.
Necropsy
Eight mice of each strain (four inoculated with E. phagocytophila-infected cells and four with uninfected HL-60 cells) were necropsied at six time points: days 0 (4 hours after inoculation), 4, 7, 10, 14, and 21. The mice were sedated with methoxyflurane, then exsanguinated by cardiac puncture, followed by cervical dislocation. The spleen was sterilely harvested, followed by collection of lung, liver, sublumbar lymph nodes, and brain. Bone marrow was obtained by flushing the femur with 1 ml of sterile phosphate-buffered saline (PBS). Half of the spleen was placed in sterile culture medium (RPMI 1640 and 2% fetal bovine serum), a quarter fixed in 10% formalin, and a quarter was frozen at -80°C. The remainder of the tissues were formalin-fixed and paraffin-embedded for hematoxylin and eosin (H&E) staining and immunohistological examination. Tissues were examined for lymphohistiocytic cell aggregates, necrosis, and apoptosis. The degree of liver pathological changes observed on H&E-stained tissue sections was first ranked from 1 to 72 (1 having the least pathology and 72 having the most severe pathology) among the infected mice based on the number, intensity, and size of lesions. The rankings were then grouped consecutively into six 12-member scoring groups, with a score of 0 corresponding to the absence of pathological findings and a score of 5 corresponding to the most severe changes. The sham-inoculated mice were also examined and scored by the same criteria from 0 to 5 with side-by-side comparisons with infected mice for accuracy of scoring. All slides were reviewed by two individuals (JSD, MEM) for consensus. For each group and time point, the mean score of sham-inoculated mice was subtracted from the score of E. phagocytophila-inoculated mice to normalize for differences in strain pathological response.
Splenic Cultures
The splenic tissues that had been placed in sterile culture medium were immediately pooled into groups of four by mouse strain and inoculum, the tissue finely minced with a sterile scissors, and dispersed into a single cell suspension. Cells were washed twice in sterile culture medium, red blood cells were lysed in a hypotonic salt solution, and remaining cells were washed and resuspended in RPMI 1640 medium with 10% fetal bovine serum and gentamicin (50 µg/ml) at a concentration of 2 x 106 cells/ml. One ml of the cell suspension was added to each well of a 24-well culture plate. After 24 hours of incubation the cell suspension was stimulated in duplicate wells by adding either sterile medium (control), or the following (final concentrations): ConA (1 µg/ml), lipopolysaccharide (5 µg/ml), or three different concentrations of renografin-purified E. phagocytophila Webster strain (50, 5, 0.5 µg/ml). Seventy-two hours later (determined optimal for E. phagocytophila stimulation in pilot studies) the supernatant was harvested from each well and frozen at -80°C until analyzed.
Cytokine Assays
Levels of IFN- and IL-10 were assayed in the supernatant of the
splenic cultures by sandwich enzyme-linked immunosorbent assay. Capture
and detection monoclonal antibodies and recombinant antigen for IFN-
and IL-10 were obtained from Pharmingen (San Diego, CA). Briefly,
96-well plates were coated with capture antibody and incubated
overnight at 4°C. The wells were blocked with PBS with 3% bovine
serum albumin for 2 hours, and then washed with PBS/Tween. Doubling
dilutions of recombinant antigen (diluted in PBS with 3% bovine serum
albumin) were used for a standard curve. Then recombinant antigen
standards or supernatants were added to duplicate wells and incubated
overnight at 4°C. Plates were washed and reacted with biotinylated
secondary antibody, and developed at room temperature for 45 minutes.
After washing, plates were reacted with streptavidin alkaline
phosphatase (DAKO, Carpinteria, CA) at room temperature for 30 minutes,
and washed again with PBS/Tween. Color was developed with the TMB
peroxidase system (KPL, Gaithersburg, MD) and the optical density
measured at 630 nm on an enzyme-linked immunosorbent assay
plate-reader.
Serology
Plasma was assayed for E. phagocytophila group antibodies by indirect immunofluorescence assay, as described elsewhere,2,3 using E. phagocytophila-infected HL-60 cells (Webster strain) as antigen. Plasma samples reactive at a 1:80 dilution were titrated to endpoint.
Measurement of Ehrlichial DNA Quantity
Plasma was separated from packed blood cells, and nucleic acids
were prepared from the cellular fraction (
200 to 400 µl)
using the Gentra PureGene kit (Gentra Systems, Minneapolis, MN). The
samples obtained from mice inoculated with uninfected HL-60 cells were
tested for E. phagocytophila DNA by polymerase chain
reaction (PCR) using the primers ge9f and ge10r.2
DNA
extracted from the blood of mice inoculated with infected cells was
tested with a quantitative PCR method using an ABI TaqMan 7700
instrument (PE Biosystems, Foster City, CA). The TaqMan reporter probe
and primer sequences were modified from Pusterla and
colleagues.10
The fluorescent reporter dye at the 5' end
of the TaqMan probe (ehr 80p, CCTATGCATTACTCACCCGTCTGCCACT) was
6-carboxy-fluorescein (FAM); the quencher at the 3' end was
6-carboxy-tetramethyl-rhodamine (TAMRA). Primers were amplified from a
106-bp fragment of the 16S rRNA gene (ehr 50r,
5'-TTCGAACGGATTATTCTTTATAGCTTG-3', and ehr 145f,
5'-CCATTTCTAGTGGCTATCCCCATACTAC-3'). The standard curve was developed
using DNA prepared from a known quantity of E.
phagocytophila-infected HL-60 cells added to
ethylenediaminetetraacetic acid-anti-coagulated mouse blood from which
10-fold dilutions were made in sterile water. The 50-µl PCR mixture
contained 900 nmol/L each of forward and reverse primers, 150 nmol/L
probe, 25 µl TaqMan Universal PCR Master Mix (Roche, Branchburg, NJ),
and 50 ng (range, 25 to 65 ng) of DNA. After target denaturation for
3 minutes at 95°C, amplification conditions were five cycles of 30
seconds at 95°C and 20 seconds at 62°C, followed by 45 cycles of 40
seconds at 85°C and 60 seconds at 62°C. Results were expressed as
quantity of infected cells per µl host DNA template where 1 µl was
determined to represent 105
host cells.
Immunohistochemistry
Five-µm thick paraffin-embedded tissue sections were prepared and examined by immunohistological techniques with rabbit anti-E. phagocytophila Webster strain as the primary antibody, as described elsewhere.2 Slides were examined by light microscopy for the presence of intracytoplasmic morulae stained red in color. The total number of infected cells per volume of tissue was calculated.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Consistent with previous studies, none of the mice exhibited any
clinical signs of illness. C57BL/6 mice had mild to moderate
histopathological lesions (lymphohistiocytic aggregates, apoptotic
cells, mild hepatitis) evident at 7 to 14 days, which were resolving by
day 21. In the IL-10-/- mice, hepatic histopathological lesions were
much more severe at each time point and included marked
lymphohistiocytic accumulations, severe hepatitis with numerous
apoptoses, and necrosis. The IFN--/- mice had minimal hepatic
pathology throughout the course of the experiment (Figure 1)
. The quantitative and kinetic results
of histopathological examinations are summarized in Figure 2
. Mice of the C57BL/6 and IL-10-/-
strains had mildly elevated histopathology scores as compared to the
IFN--/- strain at day 0 (P = 0.011,
P = 0.21, respectively, t-test).
Histopathological severity in C57/BL6 and IL-10-/- mice rose in
parallel through day 7, but then diverged as histopathological lesions
in IL-10-/- mice continued to increase and remained high throughout
the course of the study (P = 0.023,
t-test). The histopathology rank of C57BL/6 strain of mice
decreased at day 10 and returned to baseline levels at days 14 and 21.
In contrast, the IFN--/- strain had baseline pathology scores
throughout the course of the infection.
|
|
All sham-inoculated mice remained seronegative throughout
the course of the study, whereas all mice inoculated with E.
phagocytophila-infected HL-60 cells seroconverted. Serum titers of
the E. phagocytophila-infected mice are shown in Figure 3
, and confirm results obtained in pilot
studies. At day 7, the serological titer of the IFN--/- mice was
significantly, or near significantly, higher than the C57BL/6
(P = 0.063) or IL-10-/-
(P = 0.024) mice. At day 10, the serum titer of
the IL-10-/- mice continued to increase, so that by days 14 and 21 it
was not significantly different from the IFN--/- mice. In
contrast, the C57BL/6 mice had a significantly lower serum titer than
either of the other two strains at days 10 and 14
(P = 0.002, P = 0.024). By day
21, the C57BL/6 mice had a marked increase in serological titer,
approaching that of the other two strains (P =
0.060).
|
To control for endogenous cytokine production by the cells in the
splenic cultures, the cytokine measurements from the sham-inoculated
mice were subtracted from that of the E.
phagocytophila-inoculated mice. This adjusted value was plotted by
averaging the duplicate cytokine measurements of each mouse strain per
day in duplicate cultures (Figure 4)
.
Splenic cultures stimulated with 50 µg/ml and 5 µg/ml of E.
phagocytophila antigen produced nearly identical quantities and
kinetics of IFN- and IL-10 whereas those stimulated with 0.5 µg/ml
had little cytokine production greater than baseline levels. Day 7
results were eliminated from the calculations as the splenic cultures
from that day did not respond to either ConA or lipopolysaccharide
(control) stimulation. The reason for the lack of splenic culture
stimulation on that day is unclear; however, the results suggest a
technical problem with culture on that day alone. For the IFN--/-
mice, no IFN- was produced during the 21-day trial. The IL-10-/-
and C57BL/6 strains both had IFN- production by days 4 to 10, which
later became undetectable. IL-10 was undetectable in IL-10-/- mice
throughout the study. In both IFN--/- and C57BL/6 mice, IL-10 was
detected early in the infection (day 0 to 4) and in the IFN--/-
mice again at day 21.
|
All sham-inoculated mice were negative by qualitative PCR. The
E. phagocytophila-inoculated mice were tested in triplicate
by quantitative PCR (Figure 5)
. Both
C57BL/6 and IL-10-/- strains had very low quantities of E.
phagocytophila DNA detected. The IFN--/- mice on average had
ehrlichial DNA detected at every time point except days 10 and 21, but
not all inoculated mice had E. phagocytophila DNA detected
at each time point. When IFN--/- strain values were compared to
the combined grouping of C57BL/6 and IL-10-/- strains, there were
significant, or near significant, differences at days 0, 4, and 7
(P < 0.025, <0.100, and 0.010, respectively;
Wilcoxon rank sum).
|
Ehrlichial tissue infection detected by immunohistochemistry is
summarized in Table 1
. For both the
C57BL/6 and IL-10-/- mice, small numbers of infected cells were
detected only in the lung, and at only one time point. The IFN--/-
mice had ehrlichia-infected cells detected in the lungs at days 4 and 7
and in the spleen at days 7 and 14. No infected cells were detected in
the liver in any strain, at any time point.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
plays a crucial role in the
clearance of the organism, and is a major determinant of histopathology
associated with HGE. Mice that were deficient in IFN- developed
minimal hepatic pathology, but demonstrated a significantly higher
quantity of ehrlichiae in the blood and tissues than either of the
other two strains examined. In contrast, IL-10-/- and C57BL/6 mice
had a significantly greater degree of hepatic pathology, despite often
undetectable levels of ehrlichiae in the blood at the same time point.
The mechanisms of tissue injury with E. phagocytophila
infection are poorly understood. Unlike the situation with
vasculotropic rickettsioses,11,12
vasculitis because of
rickettsia-mediated endothelial injury does not occur with the
ehrlichioses. Although in vitro propagation of E.
phagocytophila strains clearly leads to significant host cell
cytolysis, necrosis, and changes in apoptotic
activity,13-15
it is unclear whether these
bacteria-driven mechanisms have a role in vivo. Previous
studies in humans and other animals with granulocytic ehrlichiosis have
shown a stark disparity in tissue localization and quantities of
ehrlichiae as opposed to the degree of pathological
injury.1
Moreover, certain aspects of the clinical course
including toxic shock-like manifestations and acute respiratory
distress syndrome9,16-18
and pathological findings such
as hepatic apoptoses and erythrophagocytosis1
suggest
a role for host and immune factors in the pathogenesis. The studies
here provide strong evidence of a host-mediated mechanism for
pathological injury with HGE. Although pathology closely follows the
rising and falling levels of IFN- in mice, it is clear that such
responses are initiated by the ehrlichial infection. In fact, Bunnell
and colleagues2
showed that pathological lesions in
C3H-SCID mice may co-localize with ehrlichiae-infected neutrophils,
further confirming the role of the bacterium as the trigger for the
ensuing inflammatory response. However, as in humans, the mouse model
shows a disparity between ehrlichial quantity and tissue location with
regard to pathology, focusing attention on the host immune response and
not the bacterium as the critical effector of pathological lesions.
The niche occupied by obligate intracellular bacteria presents a
significant challenge to host immunity. Typically these infections
elicit a cell-mediated immune response that results in the production
of IFN- and up-regulation of other proinflammatory and cytotoxic
responses effective at intracellular killing.3,19-22
In
contrast, IL-10 is an anti-inflammatory cytokine known to down-regulate
IFN-, potentially allowing decreased clearance or increased
propagation of the pathogen, as is seen with Brucella
abortus and Salmonella typhimurium.23,24
IL-10 may further modulate pathology by counterbalancing the effects of
proinflammatory cytokines, especially IFN-, as demonstrated in
studies with Toxoplasma gondii25
and
Schistosoma mansoni.26
In humans with HGE,
IFN--dominated cell-mediated immunity with moderate IL-10 levels is
temporally associated with clinical manifestations and recovery from
infection.27
Despite the lack of IFN-, mice deficient in this cytokine did clear
the infection by 21 days. The nature of the IFN--independent
mechanism is uncertain, but may involve other cellular components
(cytotoxic T cells, natural killer cells), other cytokine-driven
effectors, or humoral immunity, which peaks at this time. These results
concur with earlier studies looking at the importance of IFN-, and
other possible mechanisms of host response.3,19
Although
humoral immunity may be important in protecting against infection or in
clearance of organisms,19,28
there is no correlation with
histopathological injury. Serum titers were low at days 4 and 7 in
IL-10-/- and C57BL/6 mice when pathological scores were already
increasing; furthermore, at peak serological response (days 14 to 21),
the pathological score had decreased to baseline levels. In addition,
the IFN--/- mice had minimal pathological scores throughout the
study, yet seroconverted earlier in the course of infection and
maintained high titers compared with the other two strains. It is
possible that the increased antigenic load in these mice during the
acute phase of infection triggered a more robust, immediate antibody
response, or the response may have been compensatory for the lack of
typical Th1-type immunity.
Unique in this study was the relationship between pro- and
anti-inflammatory cytokines and the effect on histopathological
lesions. IFN- was essential to the development of pathology, even
while suppressing ehrlichial replication. In contrast, loss of
IL-10-mediated anti-inflammatory mechanisms were associated with severe
inflammatory reactions and tissue injury, even in the absence of a
significant ehrlichial burden. However, differences in IFN- levels
between C57BL/6 and IL-10-/- mice were not readily demonstrated.
Thus, the mechanisms that control ehrlichial propagation in
vivo must be more complex than can be explained by these data
alone. It was observed that C57BL/6 mice had relatively high levels of
IFN- and restricted ehrlichial quantities at day 0 (4 hours after
inoculation), whereas IL-10-/- mice had a similar level of ehrlichial
growth restriction, but no IFN- detected at the same time point.
This suggests that ehrlichial infection induces nonspecific mechanisms
responding to ehrlichial components early in infection. To what degree
these responses result from biological variations and sampling
intervals is uncertain. Further investigation is needed to elucidate
which other components of early intrinsic Th1 immunity are important in
restricting ehrlichial growth.
It is interesting to note that no ehrlichial DNA or morulae were
detected at day 10 in the IFN--/- mice by quantitative PCR or
immunohistochemistry, yet at day 14 low levels of ehrlichiae were
detected by both techniques. Whether this is within biological
variation, or is the result of biologically meaningful change is not
known. E. phagocytophila strains are known to be
antigenically diverse29-31
and it is possible that the
second peak in ehrlichial quantity on day 14 represents the emergence
of E. phagocytophila antigenic variants. In other
rickettsial species, such as Anaplasma marginale, Ehrlichia
risticii, Ehrlichia canis, and Ehrlichia
chaffeensis32-35
antigenic variation results from
the differential expression of one or more major surface proteins
encoded by a family of paralogous genes. It is speculated that the
ability of ehrlichiae to modify major surface protein profiles may
allow immune evasion and persistence of infection. This observation
needs further investigation, but may explain some disparity in
ehrlichial quantity at different time points.
In summary, IFN--related mechanisms are important in clearance of
the organism in the early phases of HGE. However, IFN- also plays an
essential role in pathology associated with the infection. IL-10
moderates the pathology, perhaps through down-regulatory effects on
IFN- or through other anti-inflammatory mechanisms. Further studies
are needed to determine what components of the ehrlichial organism
stimulate the inflammatory response and drive the IFN- production,
as well as the mechanisms of disease resolution and control of
immunopathology. Whether results derived from murine models have
relevance to human and veterinary granulocytic ehrlichiosis has yet to
be proven. However, the mouse model that implicates immunopathological
responses in the pathogenesis of HGE does provide a good pathological
and experimental mimic of infection and should provide insights that
can be extrapolated to humans and tested in other infection models.
|
Footnotes |
|---|
Supported by National Institute of Allergy and Infectious Diseases grant no. RO1-AI-41213 and an Institutional Research Grant from The Johns Hopkins University School of Medicine.
Accepted for publication January 17, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  D. G. Scorpio, C. Leutenegger, J. Berger, N. Barat, J. E. Madigan, and J. S. Dumler Sequential Analysis of Anaplasma phagocytophilum msp2 Transcription in Murine and Equine Models of Human Granulocytic Anaplasmosis Clin. Vaccine Immunol., March 1, 2008; 15(3): 418 - 424. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.-S. Choi and J. S. Dumler Mitogenic Component in Polar Lipid-Enriched Anaplasma phagocytophilum Membranes Clin. Vaccine Immunol., October 1, 2007; 14(10): 1260 - 1265. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. H. F. Pedra, F. S. Sutterwala, B. Sukumaran, Y. Ogura, F. Qian, R. R. Montgomery, R. A. Flavell, and E. Fikrig ASC/PYCARD and Caspase-1 Regulate the IL-18/IFN-{gamma} Axis during Anaplasma phagocytophilum Infection J. Immunol., October 1, 2007; 179(7): 4783 - 4791. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. E. Foley, N. C. Nieto, S. B. Clueit, P. Foley, W. N. Nicholson, and R. N. Brown SURVEY FOR ZOONOTIC RICKETTSIAL PATHOGENS IN NORTHERN FLYING SQUIRRELS, GLAUCOMYS SABRINUS, IN CALIFORNIA J. Wildl. Dis., October 1, 2007; 43(4): 684 - 689. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K.-S. Choi, T. Webb, M. Oelke, D. G. Scorpio, and J. S. Dumler Differential Innate Immune Cell Activation and Proinflammatory Response in Anaplasma phagocytophilum Infection Infect. Immun., June 1, 2007; 75(6): 3124 - 3130. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U. Blas-Machado, J. de la Fuente, E. F. Blouin, C. Almazan, K. M. Kocan, and J. V. Mysore Experimental Infection of C3H/HeJ Mice with the NY18 Isolate of Anaplasma phagocytophilum Vet. Pathol., January 1, 2007; 44(1): 64 - 73. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. L. Stevenson, J. M. Jordan, Z. Peerwani, H.-Q. Wang, D. H. Walker, and N. Ismail An Intradermal Environment Promotes a Protective Type-1 Response against Lethal Systemic Monocytotropic Ehrlichial Infection. Infect. Immun., August 1, 2006; 74(8): 4856 - 4864. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. G. Scorpio, F. D. von Loewenich, H. Gobel, C. Bogdan, and J. S. Dumler Innate Immune Response to Anaplasma phagocytophilum Contributes to Hepatic Injury. Clin. Vaccine Immunol., July 1, 2006; 13(7): 806 - 809. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Ismail, H. L. Stevenson, and D. H. Walker Role of Tumor Necrosis Factor Alpha (TNF-{alpha}) and Interleukin-10 in the Pathogenesis of Severe Murine Monocytotropic Ehrlichiosis: Increased Resistance of TNF Receptor p55- and p75-Deficient Mice to Fatal Ehrlichial Infection Infect. Immun., March 1, 2006; 74(3): 1846 - 1856. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. E. Lopez, W. F. Siems, G. H. Palmer, K. A. Brayton, T. C. McGuire, J. Norimine, and W. C. Brown Identification of Novel Antigenic Proteins in a Complex Anaplasma marginale Outer Membrane Immunogen by Mass Spectrometry and Genomic Mapping Infect. Immun., December 1, 2005; 73(12): 8109 - 8118. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. K. Lahmers, J. Norimine, M. S. Abrahamsen, G. H. Palmer, and W. C. Brown The CD4+ T cell immunodominant Anaplasma marginale major surface protein 2 stimulates {gamma}{delta} T cell clones that express unique T cell receptors J. Leukoc. Biol., February 1, 2005; 77(2): 199 - 208. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. R. Abbott, G. H. Palmer, C. J. Howard, J. C. Hope, and W. C. Brown Anaplasma marginale Major Surface Protein 2 CD4+-T-Cell Epitopes Are Evenly Distributed in Conserved and Hypervariable Regions (HVR), Whereas Linear B-Cell Epitopes Are Predominantly Located in the HVR Infect. Immun., December 1, 2004; 72(12): 7360 - 7366. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. G. Scorpio, M. Akkoyunlu, E. Fikrig, and J. S. Dumler CXCR2 Blockade Influences Anaplasma phagocytophilum Propagation but Not Histopathology in the Mouse Model of Human Granulocytic Anaplasmosis Clin. Vaccine Immunol., September 1, 2004; 11(5): 963 - 968. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. P. Olano, G. Wen, H.-M. Feng, J. W. McBride, and D. H. Walker Histologic, Serologic, and Molecular Analysis of Persistent Ehrlichiosis in a Murine Model Am. J. Pathol., September 1, 2004; 165(3): 997 - 1006. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A. Carlyon, M. Akkoyunlu, L. Xia, T. Yago, T. Wang, R. D. Cummings, R. P. McEver, and E. Fikrig Murine neutrophils require {alpha}1,3-fucosylation but not PSGL-1 for productive infection with Anaplasma phagocytophilum Blood, November 1, 2003; 102(9): 3387 - 3395. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K.-S. Choi, J. Garyu, J. Park, and J. S. Dumler Diminished Adhesion of Anaplasma phagocytophilum-Infected Neutrophils to Endothelial Cells Is Associated with Reduced Expression of Leukocyte Surface Selectin Infect. Immun., August 1, 2003; 71(8): 4586 - 4594. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Stuen, K. Bergstrom, M. Petrovec, I. Van de Pol, and L. M. Schouls Differences in Clinical Manifestations and Hematological and Serological Responses after Experimental Infection with Genetic Variants of Anaplasma phagocytophilum in Sheep Clin. Vaccine Immunol., July 1, 2003; 10(4): 692 - 695. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. L. Borjesson, S. I. Simon, E. Hodzic, H. E. V. DeCock, C. M. Ballantyne, and S. W. Barthold Roles of neutrophil beta 2 integrins in kinetics of bacteremia, extravasation, and tick acquisition of Anaplasma phagocytophila in mice Blood, April 15, 2003; 101(8): 3257 - 3264. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. C. Brown, T. C. McGuire, W. Mwangi, K. A. Kegerreis, H. Macmillan, H. A. Lewin, and G. H. Palmer Major Histocompatibility Complex Class II DR-Restricted Memory CD4+ T Lymphocytes Recognize Conserved Immunodominant Epitopes of Anaplasma marginale Major Surface Protein 1a Infect. Immun., October 1, 2002; 70(10): 5521 - 5532. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Caspersen, J.-H. Park, S. Patil, and J. S. Dumler Genetic Variability and Stability of Anaplasma phagocytophila msp2 (p44) Infect. Immun., March 1, 2002; 70(3): 1230 - 1234. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
