| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Article |
From the Division of Morphology and Molecular
Pathology,*
Catholic University Leuven, Leuven; and the
Center for Human Genetics,
Flanders
Interuniversity Institute for Biotechnology, Flanders, Belgium
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In 1990,6 the association between ALCL and t(2;5)(p23;q35) was established and confirmed in a number of studies, with frequencies ranging from 15 to 75%.7 The breakpoint involved in this translocation was cloned by Morris and colleagues,8 demonstrating that the nucleophosmin (NPM) gene on chromosome 5q35 is fused to the previously unidentified anaplastic lymphoma kinase (ALK) gene on chromosome 2p23. The resulting chimeric NPM-ALK protein is thought to play a key role in the pathogenesis of t(2;5)-positive ALCL. Subsequently, antibodies (Abs) reacting with the ALK kinase became available, which allowed the immunohistochemical identification of ALCL cases with a 2p23/ALK- rearrangement, as the ALK protein is absent in normal lymphoid cells.9 Importantly, expression studies with ALK Abs resulted in the description of a distinct ALK-positive ALCL subgroup, the so-called ALKomas. This particular subgroup of ALCL was shown to be associated with the presence of characteristic hallmark cells, and to have a much more favorable prognosis as compared to the ALK-negative group.10-13
Recently, it has been demonstrated that ALK protein expression in ALCL may occasionally be the result of ALK rearrangements other than NPM-ALK. An indirect estimate of the frequency of these other rearrangements can be made based on the number of reported ALKoma cases without t(2;5) or on the number of cases without nuclear staining. The cases without nuclear staining are unlikely to be associated with the NPM-ALK rearrangement, as it results in both cytoplasmic and nuclear staining of the neoplastic cells attributable to dimerization of NPM-ALK fusion protein with wild-type NPM, which carries nuclear localization motifs.14 Ten to twenty percent of ALKomas may thus carry ALK rearrangements other than NPM-ALK.15 Examples already described are t(1;2)(q25;p23) resulting in a newly identified TPM3-ALK fusion gene,16 t(2;3)(p23;q21) fusing the TFG and ALK genes,17 inv(2)(p23q35) creating the ATIC-ALK fusion gene,18-21 the CLTCL-ALK fusion gene22 and the not further characterized t(1;2)(q21;p23).23
Interestingly, NPM-ALK transcripts have been detected in Hodgkin’s disease (HD) cases24-26 suggesting it to be not as specific as previously assumed. Alternatively, these findings may indicate a common pathogenesis of ALCL and HD.24 However, other investigators failed to detect t(2;5) in HD and considered the studies demonstrating t(2;5) in HD as controversial.24,27-29 Finally, the detection of t(2;5) in peripheral blood of healthy individuals has also been reported.30
The present study was aimed at investigating the presence of ALK gene rearrangements in various lymphoid tissues including ALCL cases, HD cases and reactive lymphoid tissue. Results obtained by a real-time 5' exonuclease-based reverse transcription-polymerase chain reaction (RT-PCR) to detect NPM-ALK and ATIC-ALK fusion genes were compared to those obtained by ALK protein immunostaining, cytogenetics and fluorescence in situ hybridization (FISH).
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Thirty-three ALCL cases (cases 1 to 33), 22 HD cases (cases 34 to
55) (Table 1
), and 31 cases of reactive
lymphoid tissue without evidence of lymphoma (cases 56 to 86, not
listed in Table 1
), were selected from the database of the Department
of Pathology of the University Hospitals of the Catholic University
of Leuven, Belgium. All cases were documented by a freshly
frozen tissue block. The reactive lymphoid tissue samples included
lymph nodes (n = 29) and spleens
(n = 2).
|
All cases were reviewed on hematoxylin and eosin-stained paraffin-embedded tissue sections. Immunophenotyping was performed on fixed paraffin-embedded sections or on frozen tissue sections. Monoclonal Abs reacting to CD30 (BerH2), CD15 (LeuM1), CD20 (L26) and CD3 (Leu4) were applied, using a streptavidin-biotin-peroxidase three-stage technique. The peroxidase reaction was developed using 3,3'-diaminobenzidine tetrahydrochloride (Dako, Glostrup, Denmark) and hydrogen peroxide, 0.01% v/v. Antibodies were purchased from Becton Dickinson (San Jose, CA) and from Dako. The tetrahydrochloride immunohistochemical labeling with the monoclonal ALK1 antibody was performed as previously described.12
The diagnosis of ALCL and HD was made according to the REAL classification2 and according to the recommendations of the World Health Organization advisory committee.31
Real-Time Detection of the NPM-ALK and the ATIC-ALK Fusion Transcripts
All cases were analyzed using a newly-developed real-time PCR assay. In short, total RNA was extracted from 5 to 8 sections of 25 µm thickness from freshly frozen tissue blocks using Trizol reagent (Life Technologies, Merelbeke, Belgium). One microgram of total RNA was converted into cDNA using Superscript reverse transcriptase according to the manufacturer’s recommendations (Life Technologies). Five microliters of the RT reaction (20 µl) were then used as template for a 50-µl reaction for the real-time detection of the NPM-ALK and ATIC-ALK fusion transcripts using the TaqMan Universal Master Mix and an ABI Prism 7700 Sequence Detection System (PE Corporation, Foster City, CA). Two sets of primers (15 pmol each) combined with a TaqMan probe (20 pmol) were used for the respective transcripts. The primer directed to the ALK portion of the transcripts was the same for both transcripts (primer ALKr: 5'-TGTACTCAGGGCTCTGCAGCT). Forward primers used were NPMf: 5'-GGGCCAGTGCATATTAGTGGA and ATICf: 5'-CTGTACACACTGCAGCCCAAG. The TaqMan probes were 6-carboxy-fluorescein (FAM)-labeled and bridged the breakpoints (N/A: 5'-AGCACTTAGT AGTGTACCGCCGGAAGCACC and A/A: 5'-CCATCACAGTGTACCGCCGGAAGC).
The quality of the synthesized cDNA was verified during the same run by amplification of a 101-bp fragment of the GAPDH gene, which is constitutively expressed in all cells (primers 5'-AGCCTCAAGATCATCAGCAATG and 5'-ATGGACTGTGGTCATGAGTCCTT. TaqMan probe: 5'-JOE-CCAACTGCTTAGCACCCCTGGCC). Amplification conditions were 2 minutes at 50°C (allowing AmpEraseUNG treatment) and 10 minutes at 95°C, followed by 43 cycles of denaturation (95°C, 15 seconds), extension (60°C, 1 minute). Results of this real-time PCR method are expressed as the CT value, that represents the cycle at which fluorescence raises above a threshold value. CT values below 40 are considered positive. The lower the CT value, the higher the positivity of the sample, suggesting the higher concentration of the target sequence in the starting material.
The sensitivity of the assay was determined by amplification of a
NPM-ALK-positive and an ATIC-ALK-positive control
sample, diluted 10 to 108
times in diethyl
pyrocarbonate water, and was 10-7 for
both. The sensitivity study is illustrated in Figure 1
.
|
A limited number (n = 3) (cases 59, 61, and 65) of NPM-ALK PCR products were sequenced to verify the specificity of the PCR. Cloning was performed using the pGEM-T easy vector system (Promega, Leiden, the Netherlands). In short, the PCR products were gel-purified and inserted in the pGEM-T vector. Blue-white screening with X-gal and IPTG (Life Technologies, Merelbeke, Belgium) was used to pick the appropriate colonies for sequencing. Six white colonies were checked for the presence of the insert and were sequenced over the full length in both directions.
Quantitative Real-Time RT-PCR for NPM-ALK
Quantification was performed in a representative part of the cases namely four ALK-positive ALCL cases (cases 1, 2, 3, and 6), four ALK negative ALCL cases (cases 17–19 and 21), eight HD cases (cases 34–37, 39, 40, 45, and 48) and eight reactive tissues (cases 56, 59–62, 66, 77, and 79). The NPM-ALK fusion gene in the samples was quantified by measuring CT and by using a standard curve to determine the starting target quantity. As the precise amount of total cDNA added to each reaction mix and its quality are both difficult to assess, the GAPDH transcripts were also quantified as an endogenous reference and each sample was normalized by dividing the NPM-ALK target amount by the GAPDH target amount. Each of the normalized target values was divided by a designated calibrator-normalized target value. Final results are expressed as N-fold differences in NPM-ALK level relative to the GAPDH transcript amount and the calibrator.
The standard curves for both NPM-ALK and GAPDH were constructed with 10-fold serial dilutions in diethyl pyrocarbonate water of cDNA prepared from total RNA extracted from case 1. The series of diluted cDNA’s were aliquoted and stored at -20°C until use. Each PCR run was performed with triplicates, of which results were averaged, and included no template controls, 7 points of the standard curves and 8 unknowns. Amplification conditions were similar to those used for the qualitative RT-PCR (see above).
Prevention of Carryover Contamination
Carryover of PCR product was avoided by using the real-time RT-PCR method as it is a closed tube assay that requires no post-PCR handling. Three tubes had to be opened for sequencing, but this was performed in a separate room, preventing contact of products with the PCR setup area. Moreover, the master mix that was used contains dUTP instead of dTTP, and the enzyme AmpEraseUNG (uracil-N-glycosylase). UNG treatment removes dUTP containing carryover PCR products32 and is followed by thermal inactivation of UNG before the actual PCR. In our laboratory neither NPM-ALK nor ATIC-ALK detection, was performed with a conventional RT-PCR lacking the dUTP-AmpEraseUNG system.
Apart from these specific characteristics of the real-time RT-PCR, general recommendations were taken in account to prevent carryover of RNA/cDNA during handling before the real-time PCR, such as regularly changing gloves, maintaining separate areas, and using positive-displacement pipets and sterile filter tips. In addition, cutting and collecting of the frozen tissue sections was performed with specific care to prevent carryover of small fragments of tissue. The knife of the cryostat was thoroughly cleaned after the cutting of each sample.
Numerous no-template controls (dH2O) were included at the beginning of the extraction procedures and remained consistently negative.
Cytogenetics and FISH
Chromosome analysis was performed according to standard protocols. Cells from lymph nodes were cultured for one day without stimulation. Three to 10 G-banded metaphases were analyzed. Chromosome abnormalities are presented in accordance with the International System for Human Cytogenetic Nomenclature (1995).33
FISH was performed as previously described.34 The ALK and NPM loci were investigated using an ALK P1 clone (designated ALK-DMPC-HFF#1–1111H1) and three cosmid clones (13, 15–2, and 47C12) from the 5q35 region located immediately centromeric to the NPM locus.35 In t(2;5)-negative but ALK+ cases, rearrangement of ALK was analyzed with the Vysis LSI ALK probe assay (Vysis, Inc., Downer’s Grove, IL) that contains two differently labeled probes located either 3' telomeric (spanning 250 kb and labeled with SpectrumOrange) or 5' centromeric (spanning 300 kb and labeled with SpectrumGreen) of the t(2;5) breakpoint of the ALK gene at 2p23. The FISH data were collected on a Leitz DMRB fluorescence microscope equipped with a cooled black and white CCD camera (Photometrics, Tuscon, AZ) run by SmartCapture software (Vysis, Stuttgart, Germany).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
. ALK Immunohistochemical Staining
ALK staining was positive in the tumor cells of 13 ALCL cases. In 9 of the latter cases (cases 1–9), cytoplasmic as well as nuclear staining was found, whereas the remaining 4 cases (cases 10–13) showed only cytoplasmic staining. None of the HD cases and none of the reactive tissue samples showed obvious ALK protein expression.
RT-PCR Results
Control of RNA Quality
All RNA samples were of sufficient quality as verified by the RT-PCR detection of a fragment of the GAPDH gene. The CT values resulting from this control RT-PCR ranged from 15 to 24 for the ALCL and the HD cases and from 14 to 26 for the reactive lymphoid tissues.
ALK Fusion Transcripts in the 33 ALCL Cases
Of the 13 ALK-positive ALCL cases, 12 cases showed positive
signals for NPM-ALK. Of these 12 cases, 8 cases were
strongly positive (CT range, 17
to 23) and 4 were only weakly positive
(CT range, 33–37) (Figure 2)
. Of the latter 4 cases, 3 were also
strongly positive for the ATIC-ALK fusion (cases 10–12)
(CT range, 20 to 25). These
three cases showed only cytoplasmic ALK staining, suggesting that the
ATIC-ALK rearrangement was responsible for the ALK
overexpression. Case 9, which showed massive involvement with
cytoplasmic and nuclear ALK staining on the paraffin section, was only
weakly positive for NPM-ALK. This finding might be explained
by the fact that the frozen material only contained very small areas of
tumor, which might have largely disappeared in subsequent sections cut
for RNA extraction. One ALK-positive case with cytoplasmic and nuclear
ALK staining that was strongly positive for NPM-ALK was also
positive for ATIC-ALK, although weakly (case 1)
(CT 37). Another ALK-positive
ALCL case was negative for both ALK fusions (case 13).
|
, of which 5 cases were also positive for
ATIC-ALK. However, the signals resulting from all of these
cases were weak (CT range,
30–38). ALK Fusion Transcripts in the 22 Hodgkin’s Disease Cases
Eleven of 22 Hodgkin’s disease cases showed positive signals for
NPM-ALK. CT values for these cases
ranged from 31 to 39 (Figure 2)
. Four of these cases (cases 34, 35, 37,
and 42) also showed weak positive signals (range, 34–38) for the
ATIC-ALK fusion. One additional case showed a positive
signal for the ATIC-ALK fusion, but was negative for the
NPM-ALK fusion.
ALK Fusion Transcripts in Reactive Tissues
Twenty of 31 reactive tissues (cases 56 to 75) showed positive
results for the presence of NPM-ALK fusion transcripts with
CT values ranging from 33 to 38
(Figure 2)
. Sequencing of the products of three cases (cases 59, 61 and
65) (CT range, 34–36)
confirmed that these weak fluorescent signals represented true
amplification of the NPM-ALK fusion. Another case (case 76)
showed a weak positivity (CT =
38) for the presence of the ATIC-ALK fusion.
Relative Quantification of NPM-ALK Fusion Transcripts
Results of real-time relative quantitative RT-PCR are
summarized in Table 2
, showing the
NPM-ALK target amounts detected in 24 samples, normalized to
the GAPDH target amount
(NPM-ALKN) and relative to the
result of case 35 (resulting in the
NPM-ALKN/C value). The latter result was
designated as the calibrator as it was the strongest positive of all
low-level samples. Based on the NPM-ALKN/C
values, there was an obvious distinction between high-level and
low-level detection in respectively ALK-positive ALCL cases (cases 1 to
3 and 6) on the one hand and ALK-negative ALCL cases, HD cases and
reactive tissue cases (all other cases) on the other hand. More
specifically, the presence of NPM-ALK in the high-level
samples was 165-fold to 124,571-fold higher than that in the low-level
samples.
|
Cytogenetic studies and/or FISH analysis detected 2p23 abnormalities in all ALK-positive ALCL cases but in none in any of the ALK-negative ALCL cases or HD cases analyzed.
Cytogenetic studies were performed in 15 ALCL and in 10 HD cases. In
the former group, 2p23 abnormalities were identified in 8 cases (cases
1, 2, 5, and 9–13) including four with a t(2;5)(p23;q35), three with
the inv(2)(p23q35) and one with a t(2;17)(p23;q25). The latter case was
the one ALK-positive ALCL case in which both analyzed ALK
fusion genes were not detected (case 13). Six ALCL cases revealed an
abnormal karyotype, but without structural aberrations of the short arm
of chromosome 2. A normal karyotype was found in one ALCL case. In the
HD group, seven cases showed clonal chromosomal abnormalities without
2p aberrations, and normal karyotype was observed in three cases (Table 1)
.
FISH detection of the ALK/2p23 rearrangement was performed in 14 cases. In 7 of cases, FISH assay for a t(2;5) was used and a fusion signal indicating the NPM-ALK rearrangement was found either in available abnormal metaphases (cases 5 and 9) or in interphase cells (cases 3, 4, 6–8). Three ALK-positive ALCL cases (cases 10–12) lacking the NPM-ALK fusion in abnormal metaphases, showed a variant ALK rearrangement namely the inv(2)(p23q35) using the 5'/3' end ALK FISH assay (Vysis).21 The same set of probes was used to demonstrate the ALK rearrangement in t(2;17)(p23;q25) found in case 13. FISH performed in cases 15, 24, and 32 did not reveal the 2p23 abnormalities.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
For the ALCL cases, the difference between ALK staining and RT-PCR results might be explained by the higher sensitivity of the real-time RT-PCR method, which was 10-7, compared to conventional RT-PCR methods. The TaqMan technology also accounts for the high specificity through the obligate binding of the fluorescent probe spanning the breakpoints. The reliability of the method for NPM-ALK detection was confirmed by sequencing of three amplification products showing weak positivity (cases 59, 61, and 65). Carryover contamination should be considered as another possible explanation for our RT-PCR results. However, in our opinion, contamination is very unlikely due to the specific characteristics of the real-time method (closed tube assay and dUTP/UNG technique) and the general PCR recommendations that were conscientiously followed during all procedures.
Discrepancies among immunohistochemical staining results, cytogenetical analysis, and RT-PCR results were also observed by Ott and colleagues,36 who found two ALCL cases showing the presence of the NPM-ALK fusion transcript by RT-PCR without cytogenetic positivity and without positive immunostaining with anti-p80. The authors suggested false positivity to be a possible explanation. Alternatively, two other explanations were proposed, the presence of only a minor fraction of tumor cells carrying the translocation and the existence of rearrangements in a non-neoplastic bystander cell.
The latter explanation may now be supported by our results showing the presence at a low level of the NPM-ALK fusion transcripts in almost two-thirds of the non-neoplastic tissues analyzed. The level at which the fusion transcript is detected in these non-neoplastic tissues is comparable to the level observed in the ALCL cases lacking ALK protein expression suggesting indeed the presence of NPM-ALK fusion transcripts in the background reactive cells and not in the tumor cells. In addition, a weak positivity was also observed for the ATIC-ALK fusion transcript, although in only one reactive tissue sample. This much lower frequency of ATIC-ALK fusion transcript detection in reactive tissue biopsies might reflect its lower frequency in ALCL cases, thus supporting our findings.
The possible presence of NPM-ALK in non-neoplastic cells may also explain its detection in HD cases, as shown by us in both the present study and previously by others.24-26 Orscheschek and colleagues24 found 11 of 13 cases to be positive by RT-PCR, concluding that HD and ALCL might be pathogenetically related and that detection of t(2;5) may be used as an indicator for clonality in HD. However, Trümper and colleagues25 also found NPM-ALK in HD but acknowledged that the t(2;5) should not be considered as important in terms of pathogenesis of HD, based on its very low detection rate in RS single cells (<5% of RS cells in 2 of 9 HD cases). Moreover, in their subsequent study they demonstrated the existence of NPM-ALK in normal peripheral blood samples of 14 of 29 healthy individuals,30 suggesting that the detection of NPM-ALK in HD is coincidental.
Our study may also support the findings of Beylot-Barry and colleagues,37 who found that CD30+ cutaneous lymphoproliferative diseases may contain NPM-ALK transcripts in the absence of ALK expression.
The presence of tumor-specific fusion genes in non-neoplastic cells is not new. Earlier, the fusion genes resulting from t(14;18) and t(9;22) were also shown not to be restricted to malignant cells.38-39 Such genes may constitute abnormalities that, by themselves, are not able to generate a neoplastic proliferation without the interaction with as yet unidentified tumorogenic events. Experiments with a retroviral NPM-ALK gene transfer mouse model have indeed suggested that NPM-ALK expression alone may not be sufficient to produce lymphoma, as the latency period was relatively long and no cell lines could be established from the mouse tumors.40 The c-myc proto-oncogene appears to be frequently altered in ALCL41 and might thus represent a candidate gene required for co-operating with NPM-ALK in malignant transformation. Alternatively, tumor specific fusion genes may be expressed in hematopoietic cells that have entered an apoptotic pathway before acquiring a characteristic leukemic karyotype.42
Not only the presence of so-called tumor-specific fusion genes in normal tissue but also the high frequency of this finding in our study is remarkable. This indicates that an ALK rearrangement might be very easily acquired, which may be supported by the numerous partner genes hitherto identified16-23 or remaining to be identified such as the one on chromosome 17q25 in case 13 of the present study. Moreover, recently, Lawrence and colleagues43,44 demonstrated the presence of TPM3-ALK and TPM4-ALK fusion genes in inflammatory myofibroblastic tumors, indicating that ALK rearrangement is not restricted to lymphocytes but may affect different cell lineages.
Based on our findings, one may question the reliability of real-time RT-PCR as a tool to be used in the diagnosis and follow up of lymphomas, in particular of ALCL cases. Firstly, the application of high sensitivity real-time RT-PCR may overestimate the presence of the t(2;5) in the ALCL cases investigated, thereby preventing the exact evaluation of prognosis at the time of diagnosis. Immunohistochemical demonstration of ALK expression within the tumor cells should always be accomplished to make the diagnosis of ALK-positive ALCL. Alternatively, for diagnostic purposes, it may be considered either to score as positive only those samples with CT values below a certain threshold value (eg, 30) or to rely only on results obtained by routine low to moderate sensitivity RT-PCR. Secondly, our findings demonstrate that quantitative followup of minimal residual disease using the TaqMan technology may be problematic due to the presence of the target sequence in apparently normal bystander cells. When used for monitoring minimal residual disease in ALCL, the high sensitivity of this technique may be considered not only a big advantage but also a major drawback. Quantitative real-time RT-PCR has already been used to monitor minimal residual disease in chronic myeloid leukemia, showing, however, confusing results; for instance, a positive PCR reaction does not always equal relapse. This might be explained by the "too high sensitivity" of the technique, as it may detect BCR-ABL transcripts in normal cells.39,42 Extensive studies using real- time PCR should be performed to evaluate the significance of low levels of fusion transcripts and their relevance for the prognosis of patients.
In summary, our findings demonstrate that NPM-ALK and ATIC-ALK fusion transcripts, which result in ALCL from t(2;5) and inv(2), respectively, may also be detected in nonmalignant cells. These results question whether both fusion transcripts are sufficient to induce tumor formation and whether real-time RT-PCR monitoring of minimal residual disease is of prognostic significance.
|
Acknowledgements |
|---|
|
Footnotes |
|---|
Supported by a grant from the Belgian Cancer Association to C. D. W.-P.
Accepted for publication March 13, 2001.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  H. M. Amin and R. Lai Pathobiology of ALK+ anaplastic large-cell lymphoma Blood, October 1, 2007; 110(7): 2259 - 2267. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Qiu, R. Lai, Q. Lin, E. Lau, D. M. Thomazy, D. Calame, R. J. Ford, L. W. Kwak, R. A. Kirken, and H. M. Amin Autocrine release of interleukin-9 promotes Jak3-dependent survival of ALK+ anaplastic large-cell lymphoma cells Blood, October 1, 2006; 108(7): 2407 - 2415. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Debiec-Rychter, R. Croes, R. De Vos, P. Marynen, T. Roskams, A. Hagemeijer, R. Lombaerts, and R. Sciot Complex Genomic Rearrangement of ALK Loci Associated with Integrated Human Epstein-Barr Virus in a Post-Transplant Myogenic Liver Tumor Am. J. Pathol., September 1, 2003; 163(3): 913 - 922. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Chiarle, J. Z. Gong, I. Guasparri, A. Pesci, J. Cai, J. Liu, W. J. Simmons, G. Dhall, J. Howes, R. Piva, et al. NPM-ALK transgenic mice spontaneously develop T-cell lymphomas and plasma cell tumors Blood, March 1, 2003; 101(5): 1919 - 1927. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. L. Kutok and J. C. Aster Molecular Biology of Anaplastic Lymphoma Kinase-Positive Anaplastic Large-Cell Lymphoma J. Clin. Oncol., September 1, 2002; 20(17): 3691 - 3702. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Falini and D. Y. Mason Proteins encoded by genes involved in chromosomal alterations in lymphoma and leukemia: clinical value of their detection by immunocytochemistry Blood, January 15, 2002; 99(2): 409 - 426. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q. Zhang, P. N. Raghunath, L. Xue, M. Majewski, D. F. Carpentieri, N. Odum, S. Morris, T. Skorski, and M. A. Wasik Multilevel Dysregulation of STAT3 Activation in Anaplastic Lymphoma Kinase-Positive T/Null-Cell Lymphoma J. Immunol., January 1, 2002; 168(1): 466 - 474. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Rn = normalized signal generated from
the sample minus the baseline signal established in the first few
cycles of the PCR. The horizontal line indicates the threshold