| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Regular Articles |















From the Department of Pathology,*
The Johns Hopkins
Hospital, Baltimore, Maryland; the Department of
Pathology,
Childrens Medical Center, Dallas,
Texas; the Department of Pathology,
Childrens Hospital San Diego, California; the Department of
Pathology,
Baptist Medical CenterWake Forest
University, Winston-Salem, North Carolina; the Department of
Pathology,¶
Childrens Hospital and
Brigham and Womens Hospital, Boston, Massachusetts; the Department of
Pathology,||
Harvard Medical School, Boston,
Massachusetts; the Department of Pathology,**
Loma Linda
University, Loma Linda, California; Departments of Pathology,
Pediatrics, and Orthopaedic Surgery,

University of Nebraska Medical Center, Omaha, Nebraska; and the
Department of Pathology

Memorial Sloan-Kettering Cancer Center, New York, New York
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Of note, other variant translocations involving Xp11.2 have been identified in tumors reported as RCCs. These include four published reports of pediatric renal carcinomas with a balanced t(X;17)(p11.2;q25), the breakpoints of which are cytogenetically identical to the translocation now recognized to be characteristic of ASPS.5-8 Intriguingly, ASPS is well known to be capable of mimicking RCC morphologically, in that both tumors feature nested and alveolar patterns of growth bounded by prominent sinusoidal vasculature, and both contain polygonal cells with clear-eosinophilic cytoplasm and distinct borders.9-12 Given these morphological similarities and the cytogenetic findings, we hypothesized that such renal tumors might in fact be related to ASPS.
Therefore, we have reviewed several of these reported carcinomas, along with cases coded as RCC in the files of two of the authors (JBB, VER), with the aim of identifying tumors bearing the ASPL-TFE3 gene fusion characteristic of ASPS. We report herein the clinical, pathological, and genetic features of eight primary renal neoplasms in which we have identified the ASPL-TFE3 fusion.
| Materials and Methods |
|---|
|
|
|---|
We initially searched the files of the National Wilms Tumor Study
Pathology Center (NWTSPC) and the affiliated consultation files of JBB
for cases of carcinoma with available cytogenetic results. Two cases
with a documented t(X;17)(p11.2;q25) were identified; one of these
cases7
was one of four previously published cytogenetic
reports of RCC with a t(X;17), as noted above. Fresh frozen tissue
suitable for RNA extraction for reverse transcriptase-polymerase chain
reaction (RT-PCR) analysis was available from both tumors. Based on the
morphological features of these two tumors that were noted to be
distinctive and virtually identical (see Results), we reviewed all
renal carcinomas in the files of JBB (
80 cases) and all cases
classified as either clear cell RCC, papillary RCC, or unclassifiable
RCC in the files of Memorial Sloan-Kettering Cancer Center (MSKCC) from
1990 to 1998 (
400 cases, compiled by VER) with the goal of
identifying morphologically similar cases for which fresh frozen tissue
was available. Cases 3 to 7 were identified in this search. Of note,
cases 4 and 7 were initially reported as pediatric papillary renal
carcinomas with voluminous cytoplasm, with the former bearing a
translocation originally reported as der(X)t (X;7)(p11;q11) (see
Results).13
Case 8 is an additional anecdotal case
identified recently by one of the authors (AJG). Clinical follow-up was
obtained from the referring pathologist in each case.
Immunohistochemistry
After morphological identification of the cases, immunohistochemical labeling was performed on all eight cases at The Johns Hopkins Hospital on a single formalin-fixed, paraffin-embedded tissue block from each case. Briefly, 4-µm sections were deparaffinized in xylene for 30 minutes and rehydrated using graded ethanol concentrations. Antigen retrieval was performed using either protease digestion or steaming. Immunohistochemical labeling using the avidin-biotin peroxidase complex technique and 3', 3'-diaminobenzidine as chromagen was performed with the automated Biotek-1000 staining system (Ventana/Biotek Solutions, Inc., Tucson, AZ). The antibodies used, vendors, pretreatments, and dilutions were as follows: EMA (DAKO, Carpinteria, CA; steam, 1:1000), desmin (DAKO; steam, 1:20,000), S100 protein (DAKO; steam, 1:6000), cytokeratin 7 (DAKO; protease, 1:50), vimentin (Zymed, San Francisco, CA; steam, 1:100), cytokeratin AE1/AE3 (Boehringer Mannheim, Indianapolis, IN; protease, 1:2000), cytokeratin Cam5.2 (Becton Dickinson, San Jose, CA; protease, prediluted), and HMB45 (DAKO; steam, 1:125). The rationale for applying this panel of antibodies is as follows. The combination of cytokeratin cocktail AE1/AE3 (which recognizes cytokeratins 1 to 8, 10, 14/15, 16, and 19) and cytokeratin cocktail Cam5.2 (which recognizes cytokeratins 8, 18, and 19) was chosen because it is a highly sensitive and well-recognized screen for cytokeratin expression.14-16 Stains for cytokeratin 7 and EMA were performed because of their known reactivity with papillary RCC.14,17 Stains for vimentin were performed chiefly for the purpose of documenting the immunoreactivity of the tissue section used, as evidenced by strong immunoreactivity of the intratumoral capillaries. Stains for S100 protein, HMB45 and desmin were performed to exclude melanoma, angiomyolipoma, and myogenic sarcomas. Stains for EMA and cytokeratin AE1/AE3 were repeated on all cases using the DAKO Envision system to eliminate the possibility of biotin-related artifactual staining.
Electron Microscopy
Ultrastructural studies were performed at MSKCC (by CRA) on representative tumor tissue obtained from either paraffin blocks or from fresh tumor. Tissue removed from the paraffin block was cut into small pieces. The pieces were soaked in xylene, with several changes, for 1 week. After this, the pieces were placed in 100% alcohol, then rehydrated through graded alcohols (100, 95, 80, 70, to 50%) for at least one-half hour each. Tissue was then soaked in buffer for one-half hour or until the tissue was osmicated. Representative fresh tumor tissue was fixed in 2% glutaraldehyde, postfixed in 1% osmium tetroxide, and embedded in epoxy resin using standard procedures. In each case, thick sections were cut and stained with toluidine blue from four embedded tissue blocks to select blocks suitable for ultrastructural evaluation. Thin sections were stained with uranyl acetate followed by lead citrate and examined with a Philips EM401 electron microscope (Eindhoven, The Netherlands).
Molecular Analysis
Molecular studies were performed at MSKCC on snap-frozen tumor tissue in seven cases, or frozen short-term primary culture (one case). RNA extraction was performed from frozen tissue using a standard organic extraction method (Trizol; Life Technologies, Inc., Friendsworth, TX).18 To assess the adequacy of RNA for analysis, RT-PCR was performed using primers spanning an intron of the ubiquitously expressed phosphoglycerate kinase (PGK) gene, resulting in amplification of a 247-bp fragment, as described in detail elsewhere.19 RNA samples in which the PGK product could not be demonstrated were considered inadequate for ASPL-TFE3 analysis. Negative controls lacking RNA were included in all RT-PCR assays. The amplified fragments were identified by their size on agarose gel electrophoresis. The specificity of all positive results was further confirmed by negative controls containing the target RNA but lacking RT.
To detect the presence of an ASPL-TFE3 fusion transcript, we performed RT-PCR using a forward primer from ASPL (AAAGAAGTCCAAGTCGGGCCA) and a TFE3 exon 4 reverse primer (CGTTTGATGTTGGGCAGCTCA), as previously described.1 RT-PCR for the reciprocal fusion product, TFE3-ASPL, was performed using an ASPL reverse primer (CACCGTCAGCTCAAAGAACTC) and a TFE3 forward primer appropriate to the type of ASPL-TFE3 rearrangement in each case: for cases with a type 1 ASPL-TFE3 fusion, a TFE3 exon 3 forward primer (TTGATGATGTCATTGATGAGATC), and in cases with a type 2 ASPL-TFE3 fusion, a more upstream TFE3 primer (GCTCAAAAGCCAACCCTTAC). The ASPL cDNA sequence and junctional sequences of both types of ASPL-TFE3 fusion transcripts have been deposited in GenBank (accession numbers AF324219, AY034077, AY034078).
Fluorescence in Situ Hybridization (FISH)
FISH studies were performed at MSKCC on cytological touch preparations of frozen tissue of nine ASPS specimens (including cases ASPS-1 to 7, and ASPS-11, from our previous study,1 and an additional case, ASPS-13) and six renal tumors (cases 1, 2, 3, 5, 6, and 8), and on cells of a primary culture of one additional renal tumor (case 4). We used two probes in a bicolor FISH assay: the RPC11 human bacterial artificial chromosome (BAC) clone 525L23 (Research Genetics, Huntsville, AL) in combination with the centromere 17-specific alphoid sequence probe [CEP 17 (Vysis, Downers Grove, IL)]. On the current version of the human genome sequence GenBank Map (at www.ncbi.nlm.nih.gov/), BAC 525L23 maps to 17q25.3 telomeric to BAC RPC11498C9 that by our previous sequence analysis is known to contain ASPL.1 The map location of BAC 525L23 telomeric to ASPL is confirmed by our FISH results in ASPS cases (see below). One µg of each DNA probe was directly labeled with SpectrumOrange or SpectrumGreen using a nick translation kit according to the manufacturers instructions (Vysis). The labeled DNA was then co-precipitated for annealing purposes with 2 µg of Cot-1 DNA (sonicated total human DNA). The chromosomal and telomeric location of the 525L23 BAC probe was first confirmed by hybridizing to metaphase spreads of normal human lymphocytes in a bicolor assay with CEP17. Interphase FISH studies on the ASPS and renal cases were then performed with the same combination of the CEP17 and 525L23 BAC probes. Bicolor FISH studies, whether metaphase or interphase, were performed as follows. The slides to be hybridized were pretreated with collagenase H (0.01% in Krebs ringer at 37°C for 15 minutes) followed by formaldehyde postfixation [2% (v/v) in MgCl2 phosphate-buffered saline (PBS) for 10 minutes at room temperature], and followed by incubation in 2 mg/ml glycine-PBS. The slides were then prehybridized in 2x standard saline citrate (37°C for 30 minutes) and air-dried. Subsequently, the slides were denatured in 70% formamide, 2x standard saline citrate, pH 7.3, at 73 to 74°C for 6 minutes and placed immediately into cold 70% EtOH, followed by a cold ethanol series of 80, 90, and 100%. The slides were then placed on a slidewarmer for 1 minute at 45°C before hybridization. The probes were denatured at 73 to 74°C for 5 minutes. The cells and probes were sealed under an 18- x 18-mm coverslip and incubated for 16 to 18 hours at 37°C in a humidity chamber. Images were prepared using the Applied Image Analysis System (Applied Imaging, Pittsburgh, PA). The number of hybridization signals for each probe was assessed in a minimum of 200 interphase nuclei with strong and well-delineated signals. As negative controls, normal peripheral-blood lymphocytes were simultaneously hybridized with these probes.
| Results |
|---|
|
|
|---|
The features of the eight cases are summarized in Table 1
. There were five females and three
males. The patients ranged from 17 months to 17 years of age. Three of
the children with smaller tumors (cases 1, 3, and 8) presented with
hematuria, whereas another patient with a small tumor (case 4)
presented with a urinary tract infection. Two of the patients with
larger tumors (cases 2 and 5) presented with abdominal masses. Patient
7 presented with flank pain.
|
Primary tumor diameters ranged from 2.3 to 14 cm. On cut surface, the tumors appeared to be soft and well circumscribed, with four described as tan, two as yellow, and one as pink. Five tumors were noted to be necrotic, whereas three demonstrated hemorrhagic foci. Five of the eight tumors demonstrated capsular penetration. No tumor involved the renal vein grossly. One tumor (case 7) arose in a kidney bearing a duplicated collecting system. No other abnormalities of the nonneoplastic kidneys were noted.
Light Microscopic Features
The morphological features of these eight tumors were similar, and
therefore they are described together. All tumors appeared well
circumscribed but unencapsulated at low power. Their basic architecture
was organoid, with variably sized nests of tumor cells separated by
delicate, thin fibrovascular septa (Figure 1)
. In some foci, the nests were solid
and the fibrovascular septa were thin and inapparent giving rise to a
sheet-like growth pattern (Figure 2)
.
Although cells in the larger nests were focally dyscohesive, giving
rise to the alveolar pattern, the septal vessels generally did not
demonstrate the sinusoidal dilation usually associated with ASPS. In
seven of the eight cases, foci of hemorrhage within the nests yielded a
morphological appearance typically associated with clear cell
RCC.20
|
|
|
|
|
Immunohistochemical Features
Vimentin highlighted the capillaries of the fibrovascular septa of
all cases. Vimentin was negative in five of the tumors, with only focal
labeling of tumor cells in cases 4, 5, and 7. Cytokeratin antibody
Cam5.2 labeled two tumors focally, whereas cytokeratin antibody AE1/3
labeled three tumors focally. Antibody to EMA focally labeled two of
the latter tumors, and diffusely labeled another (case 6) that had
shown prominent epithelial growth patterns (Figure 4B)
. The two tumors
(cases 6 and 8) positive for EMA also labeled focally for S100 protein,
whereas none of the other tumors did. The cytokeratin and EMA stains
highlighted native renal tubules in contact with the nonreactive
tumors, which emphasized their unencapsulated nature (Figure 6, A and B)
. None of the eight tumors
labeled for desmin or HMB45.
|
Ultrastructural examination was performed on six cases, five on
glutaraldehyde-fixed tissue, and a sixth on formalin-fixed,
paraffin-embedded tissue. Four tumors demonstrated a distinctive
combination of ASPS-like and epithelial features. These tumors all
demonstrated abundant electron-dense granules that were similar in size
and shape to those seen in ASPS and are not typical of any primary
renal tumor. One of these four tumors, case 1, revealed well-formed
rhomboid crystals, 270- to 276-nm wide in cross-section, composed of
fibers with a periodicity of 10 nm and a diameter of 4.5 to 5.0 nm
(Figure 7)
. These features are
characteristic of the crystals of ASPS.21
In one other
case (case 6), partial or incipient crystallization typical of ASPS
crystals was noted (Figure 8)
. However,
each of the four cases also demonstrated abundant well-formed cell
junctions, more than are typically seen in soft tissue ASPS, and
suggestive of epithelial differentiation. Case 1 demonstrated more
definitive epithelial differentiation, as it revealed prominent
basement membrane, numerous cell junctions, and well-formed glandular
lumens with microvilli (Figure 7)
. Case 1 therefore demonstrates
features that are characteristic of ASPS and adenocarcinoma
simultaneously. The two other tumors, cases 7 and 8, demonstrated
features more typical of conventional RCC (intracellular glycogen, and
fat, well-formed glandular lumens with microvilli) without the crystals
or dense granules typical of ASPS.
|
|
The partial karyotype of case 1 is shown in Figure 9
. The karyotype of case 2 has been
previously reported.7
Cytogenetic analysis was not
performed in case 3, 5, 6, 7, or 8. Case 4 was previously reported in
brief as showing a der(X)t(X;7)(p11;p11).13
In fact, the
initial karyotype was noted to be complex, and initially described as
an
46,X,der(X)t(X;7)(p11;p12),del(1)(p34),add(1)(p34),+5,-6,add(7)(p11.2),+15,
del(16)(p11.2),-17,add(20)(q13). Re-evaluation of this karyotype
now suggests that it is better described as: 46,X,der(X)t
(X;7)(p11;p11),del(1)(p34),add(1)(p34),+5,-6,add(7)(p11),
del(16)(p11.2),add(17)(q24-25),add(20)(q13). Overall, this set of
abnormal chromosomes could be explained by a complex
t(X;17)(p11;q25), with translocation of Xp11 to 17q25, but of 17q25 to
another chromosome. Thus, although nonreciprocal, the rearrangements in
this case may nonetheless be genomically balanced in terms of
chromosomes X and 17. The further molecular and FISH analyses in this
case support this interpretation (see below).
|
RT-PCR performed on RNA extracted from frozen tumor (cases 1 to 3
and 5 to 8) or frozen short-term culture (case 4) identified a specific
ASPL-TFE3 fusion product in all eight cases, consistent with
the presence of a t(X;17)(p11.2;q25) (Figure 10)
. Two mutually exclusive types of
ASPL-TFE3 fusion transcripts were observed,
corresponding to the two previously described types of
ASPL-TFE3 fusion transcripts. Cases 2 to 8 contained the
type 1 product, a fusion of ASPL to TFE3 exon 4,
whereas case 1 showed a type 2 product, a fusion of ASPL to
TFE3 exon 3. We tested seven other unrelated renal tumors
(three clear cell carcinomas, two chromophobe carcinomas, one papillary
carcinoma, one angiomyolipoma) as well as the K562 leukemia cell line
by RT-PCR for ASPL-TFE3 and they were all negative (results
not shown).
|
Because the t(X;17) in cases 1 and 2 appeared cytogenetically
balanced, it should also lead to the formation of a
TFE3-ASPL fusion gene. Therefore, we also tested all of the
present cases for the reciprocal fusion product, TFE3-ASPL.
Using appropriate TFE3 forward and ASPL reverse
primers (see Materials and Methods), we detected a TFE3-ASPL
fusion transcript in five of eight cases (Figure 11
and Table 1
), confirming that the
rearrangement between the two genes was reciprocal in these cases. We
performed direct sequencing of the TFE3-ASPL RT-PCR products
to verify their fusion points. Cases 2, 5, and 8 showed the in-frame
TFE3 exon 3 to ASPL fusion expected from a
reciprocal type 1 rearrangement (Figure 12)
. Case 1, which showed a type 2
rearrangement, also contained an in-frame TFE3-ASPL fusion
transcript, but the TFE3 fusion point was within
TFE3 exon 2 (Figure 12)
. Finally, case 6, which had a type 1
ASPL-TFE3 fusion, contained a reciprocal fusion in which a
113-nucleotide ALU-family-repeat sequence from approximately
the midpoint of intron 3 of TFE3 was inserted between
TFE3 exon 3 and ASPL, disrupting the reading
frame (Figure 12)
, leading to premature termination within the portion
encoded by the ASPL. This unusual product was not obtained
when RT was omitted (result not shown), confirming that it was
originating from cDNA and not genomic DNA. Thus, although five of the
eight cases showed evidence of expression of a TFE3-ASPL
fusion transcript arising from a reciprocal rearrangement between
ASPL and TFE3, only four of these cases contained
in-frame TFE3-ASPL transcripts, capable of encoding
potentially functional proteins.
|
|
Although the presence of a TFE3-ASPL fusion gene could
not be confirmed by RT-PCR in three of the eight cases (see above), we
hypothesized that such cases may nonetheless contain a balanced
rearrangement that is not leading to the expression of a
TFE3-ASPL fusion RNA detectable by RT-PCR, either because
the TFE3-ASPL fusion gene is not actively transcribed, or
because they contain a more complex rearrangement (eg, three-way) that
would produce an ASPL-TFE3 fusion gene but not a
TFE3-ASPL fusion gene. To test this hypothesis, we performed
FISH to assess the copy number of the portion of 17q25.3 telomeric to
the breakpoint in ASPL, reasoning that a balanced
rearrangement (in the renal tumors) would result in retention of both
copies of this region, whereas an unbalanced translocation (as in ASPS)
would result in consistent loss of one copy. We used a bicolor FISH
assay on interphase nuclei from frozen material available in seven of
our renal cases, and in nine ASPS cases, using as a probe for 17q25.3
the BAC 525L23, known to map telomeric to ASPL (see
Materials and Methods), in combination with the centromere 17-specific
probe, CEP 17. All seven renal cases tested showed retention of both
copies of BAC 525L23 (Table 1)
, whereas eight of nine ASPS showed loss
of one copy (Figure 13)
. The seven
renal cases tested included two of the three cases above in which no
TFE3-ASPL fusion RNA was detected by RT-PCR. One of these
two cases (case 4), had been karyotyped and in fact contained a more
complex rearrangement (eg, three-way) that produced a
ASPL-TFE3 fusion gene but would not be expected to generate
a TFE3-ASPL fusion gene. Thus, the cytogenetic,
ASPL-TFE3 RT-PCR, TFE3-ASPL RT-PCR,
and FISH data in this case were entirely consistent with each other.
The second of these two cases (case 3) had no cytogenetic data
available, but the finding that both copies of BAC 525L23 were retained
in this case, as well as all other cases tested, supports our
hypothesis that the t(X;17) in these renal tumors is consistently
genomically balanced, even if not necessarily simply reciprocal.
Interestingly, the single case of ASPS without loss of BAC 525L23 was
also the only case that we previously found to contain a
TFE3-ASPL fusion transcript (case ASPS-7 from our previous
study1
), further cross-validating the different
approaches.
|
Four patients (cases 1, 3, 4, and 5) are alive with no evidence of
disease at 4 years, 7 years, 2.5 years, and 1.1 years, respectively. Of
note, patients 1 and 3 are known to have not received any adjuvant
therapy after surgery, whereas information regarding therapy is not
available for patients 4 and 5. Patient 7 developed a pulmonary
metastasis 15 months after surgery. Her unresectable retroperitoneal
tumor showed no evidence of response to interleukin-2 therapy. Patient
2 is alive with stable retroperitoneal disease 12 years after surgery.
Therapy with trimetrexate after the initial incomplete resection had
stabilized the residual tumor, whereas
-interferon therapy did not
have significant effect. Despite adjuvant chemotherapy, patient 6 died
of progressive bony and lymph node metastases 2 years after surgery. At
time of writing, patient 8 was newly diagnosed, with only 2 months of
follow-up and no evidence of disease.
| Discussion |
|---|
|
|
|---|
It is difficult to place these neoplasms within an existing well-defined category, because they demonstrate individual features characteristic of both ASPS and RCC. These features seem to be variably developed in the different cases. The presence of the ASPL-TFE3 gene fusion and the ultrastructural identification of the characteristic membrane-bound crystals in case 1 are further evidence for a relationship to ASPS. With regards to the latter, we note that, contrary to what is generally assumed, classic intracytoplasmic crystals22 are not found in most soft tissue ASPS. Rather, ASPS often contain electron-dense granules consisting of finely filamentous material (termed "precrystalline" by some).22,23 Three of the other renal tumors in this series contained dense granules of this type, some with early crystallization. Because well-formed crystals seem to be rare in these tumors, it is perhaps not surprising that they were not identified in the single section from case 1 stained with PAS-diastase. Finally, the tendency of the ASPL-TFE3 renal tumors to present at high stage is also reminiscent of the behavior of ASPS, as is the indolent clinical course experienced by patient 2.
However, aside from their renal location, these tumors demonstrate several features that are more typical of RCC than of soft tissue ASPS. First, these renal tumors frequently spread to lymph nodes, which are commonly involved by RCC only rarely involved by usual soft tissue ASPS.9-12 Second, the consistent presence of psammoma bodies, clear cell cytology, and pseudopapillary architecture give these lesions an appearance that is distinct from soft tissue ASPS and highly suggestive of carcinoma. Along these lines, only rare soft tissue ASPS have been reported to contain psammomatous calcifications,24,25 and most are composed of eosinophilic cells in well-defined nests.26 Third, a higher percentage (four of eight, or 50%) of ASPL-TFE3 renal tumors than soft tissue ASPS (4%) labeled, albeit focally, for cytokeratin, which is present in >85% of RCCs.12 Finally, three of the ASPL-TFE3 renal tumors (cases 1, 7, and 8) did show definitive evidence of epithelial differentiation on ultrastructural analysis. Interestingly, two of these cases (cases 1 and 7) showed no evidence of cytokeratin expression immunohistochemically. Despite these findings, however, we note that in the majority of these tumors, epithelial features are not fully developed. This view is supported by the finding of only abortive epithelial differentiation ultrastructurally in the form of prominent cell junctions (which alone is not conclusive proof of carcinoma) in four cases, and the relatively low percentage of cases that label for cytokeratin compared to RCC. Moreover, even the cytokeratin-positive cases demonstrated only focal labeling of individual cells despite the application of a broad panel of anti-cytokeratin reagents. Hence, we cannot consider these tumors to be typical carcinomas, particularly in light of the above features that also link them to ASPS.
We suspect that the differences between soft tissue ASPS and these
renal tumors is related to the structure of the t(X;17)(p11.2;q25).
Most chromosome translocations are usually reciprocal, resulting in two
opposite fusion genes, one on each of the two derivative chromosomes,
with no net gain or loss of genetic material.27
The
reciprocal fusion gene is sometimes also transcribed although the
encoded reciprocal fusion protein is rarely functionally significant.
The t(X;17)(p11.2;q25) of soft tissue ASPS is peculiar insofar as it
appears unbalanced in most cases analyzed cytogenetically, an
observation now supported by our recent molecular studies in which the
reciprocal TFE3-ASPL transcripts were found in only 1 of 13
cases tested1
(including case ASPS-13) and by the current
FISH study showing retention of both copies of 17q25.3 telomeric to
ASPL in only one of nine ASPS cases (the same case was the
exception by both methods). Thus, the ASPL-TFE3
fusion of soft tissue ASPS is associated in almost all cases with
allelic loss at 17q25.3 telomeric to ASPL (and gain of Xp
sequences telomeric to TFE3) (Figure 14)
. The additional chromosome X
material includes most of the short arm. The possible additional role
of these recurrent translocation-associated genomic imbalances in the
biology of soft tissue ASPS is unknown.
|
|
As previously mentioned, we note three additional renal tumors (aside
from case 2 of this series), reported as carcinomas in the literature,
that demonstrated a cytogenetically balanced t(X;17)(p11.2;q25) in each
case (Table 2)
. None of these tumors were illustrated nor were any
immunohistochemical stains reported. Two of the tumors presented with
lymph node metastasis, consistent with the trend in our series. All of
these tumors had clear cell morphology. We strongly suspect that these
represent additional examples of the presently described entity.
Interestingly, it has long been noted that pediatric renal cell
carcinomas are often nonimmunoreactive for cytokeratins, although an
explanation has not been evident. It is likely that some of those
cytokeratin-negative carcinomas are additional examples of these
ASPL-TFE3 tumors.
Although the renal tumors we report all occurred in patients younger than 20 years of age, our experience is somewhat biased toward pediatric renal tumors given the nature of the NWTSPC. We note that soft tissue ASPS affects a broader age range than the lesions we have identified in the kidney. Although ASPS is typically a tumor of children and young adults, the 0 to 20 year age range that encompasses our renal tumors accounts for only 37% of ASPS cases.12 This suggests that additional cases of primary renal ASPL-TFE3 lesions could be found among adult renal tumors, perhaps among the 6 to 7% of unclassifiable carcinomas or among tumors classified as conventional (clear cell) or papillary carcinoma, particularly those that are cytokeratin-negative.30 However, two lines of evidence suggest that the ASPL-TFE3 renal tumors preferentially affect young patients. First, the renal tumors reviewed at MSKCC were not biased toward young patients; in fact, they were predominantly from adults. The ASPL-TFE3 tumors identified within this group were identified purely on morphological grounds without knowledge of the patients ages, and they proved to be from the minority of tumors resected from young patients. Second, on review of the online Chromosomes Aberration Database (http://www.ncbi.nlm.nih.gov.), we note that of 667 renal carcinomas with published abnormal karyotypes, three have demonstrated the t(X;17)(p11.2;q25). All of these tumors were in individuals younger than 10 years of age, whereas more than 95% of the whole group were adults.
Finally, we again note the predilection of translocations that
classically are associated with soft tissue tumors to occur in primary
renal tumors31-36
(Table 3)
. With the exception of infantile
fibrosarcoma, clear cell sarcoma of soft parts, and these
ASPL-TFE3 renal tumors, all of the other tumors were
previously usually considered to be Wilms tumor variants before
molecular analysis allowed their definitive distinction. Separation of
these entities from Wilms tumor has allowed the clinical behavior of
the latter to be better understood. Distinction of primary renal
ASPL-TFE3 tumors from true pediatric RCCs should help allow
us to better understand the clinicopathological features of both, which
should lead to more appropriate management approaches.
|
| Acknowledgements |
|---|
| Footnotes |
|---|
Supported in part by the Alliance Against Alveolar Soft Part Sarcoma (ML).
Accepted for publication April 13, 2001.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
J. L. Ordonez, D. Osuna, D. Herrero, E. de Alava, and J. Madoz-Gurpide Advances in Ewing's Sarcoma Research: Where Are We Now and What Lies Ahead? Cancer Res., September 15, 2009; 69(18): 7140 - 7150. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Komai, M. Fujiwara, Y. Fujii, H. Mukai, J. Yonese, S. Kawakami, S. Yamamoto, T. Migita, Y. Ishikawa, M. Kurata, et al. Adult Xp11 Translocation Renal Cell Carcinoma Diagnosed by Cytogenetics and Immunohistochemistry Clin. Cancer Res., February 15, 2009; 15(4): 1170 - 1176. [Abstract] [Full Text] [PDF] |
||||
![]() |
Ni Wayan Winarti, P. Argani, A. M. De Marzo, J. Hicks, and K. Mulyadi Pediatric Renal Cell Carcinoma Associated With Xp11.2 Translocation/TFE3 Gene Fusion International Journal of Surgical Pathology, January 1, 2008; 16(1): 66 - 72. [Abstract] [PDF] |
||||
![]() |
A. J.F. Lazar, P. Das, D. Tuvin, B. Korchin, Q. Zhu, Z. Jin, C. L. Warneke, P. S. Zhang, V. Hernandez, D. Lopez-Terrada, et al. Angiogenesis-Promoting Gene Patterns in Alveolar Soft Part Sarcoma Clin. Cancer Res., December 15, 2007; 13(24): 7314 - 7321. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Suzigan, R. Drut, P. Faria, P. Argani, A. M. De Marzo, R. N. Barbosa, E. R. Mello Denadai, J. Martins-Filho, R. C. Martucci, and T. Bauab Jr. Xp11 Translocation Carcinoma of the Kidney Presenting With Multilocular Cystic Renal Cell Carcinoma-Like Features International Journal of Surgical Pathology, April 1, 2007; 15(2): 199 - 203. [Abstract] [PDF] |
||||
![]() |
M. Tsuda, I. J. Davis, P. Argani, N. Shukla, G. G. McGill, M. Nagai, T. Saito, M. Lae, D. E. Fisher, and M. Ladanyi TFE3 Fusions Activate MET Signaling by Transcriptional Up-regulation, Defining Another Class of Tumors as Candidates for Therapeutic MET Inhibition Cancer Res., February 1, 2007; 67(3): 919 - 929. [Abstract] [Full Text] [PDF] |
||||
![]() |
A L Folpe and A T Deyrup Alveolar soft-part sarcoma: a review and update. J. Clin. Pathol., November 1, 2006; 59(11): 1127 - 1132. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Sunde, H. Donninger, K. Wu, M. E. Johnson, R. G. Pestell, G. S. Rose, S. C. Mok, J. Brady, T. Bonome, and M. J. Birrer Expression Profiling Identifies Altered Expression of Genes That Contribute to the Inhibition of Transforming Growth Factor-{beta} Signaling in Ovarian Cancer. Cancer Res., September 1, 2006; 66(17): 8404 - 8412. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. B. Nijman, E. M. Hijmans, S. E. Messaoudi, M. M. W. van Dongen, C. Sardet, and R. Bernards A Functional Genetic Screen Identifies TFE3 as a Gene That Confers Resistance to the Anti-proliferative Effects of the Retinoblastoma Protein and Transforming Growth Factor-beta J. Biol. Chem., August 4, 2006; 281(31): 21582 - 21587. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Argani, M. Lae, E. T. Ballard, M. Amin, C. Manivel, B. Hutchinson, V. E. Reuter, and M. Ladanyi Translocation Carcinomas of the Kidney After Chemotherapy in Childhood J. Clin. Oncol., April 1, 2006; 24(10): 1529 - 1534. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Rosai Clear Cell Sarcoma and Osteoclast-Rich Clear Cell Sarcoma-Like Tumor of the Gastrointestinal Tract: One Tumor Type or Two? Melanoma or Sarcoma? International Journal of Surgical Pathology, October 1, 2005; 13(4): 309 - 311. [PDF] |
||||
![]() |
R. P. Kuiper, M. Schepens, J. Thijssen, E. F. P. M. Schoenmakers, and A. G. van Kessel Regulation of the MiTF/TFE bHLH-LZ transcription factors through restricted spatial expression and alternative splicing of functional domains Nucleic Acids Res., April 26, 2004; 32(8): 2315 - 2322. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Holzbeierlein, P. Lal, E. LaTulippe, A. Smith, J. Satagopan, L. Zhang, C. Ryan, S. Smith, H. Scher, P. Scardino, et al. Gene Expression Analysis of Human Prostate Carcinoma during Hormonal Therapy Identifies Androgen-Responsive Genes and Mechanisms of Therapy Resistance Am. J. Pathol., January 1, 2004; 164(1): 217 - 227. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Alaminos, J. Mora, N.-K. V. Cheung, A. Smith, J. Qin, L. Chen, and W. L. Gerald Genome-wide Analysis of Gene Expression Associated with MYCN in Human Neuroblastoma Cancer Res., August 1, 2003; 63(15): 4538 - 4546. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. P. Kuiper, M. Schepens, J. Thijssen, M. van Asseldonk, E. van den Berg, J. Bridge, E. Schuuring, E. F.P.M. Schoenmakers, and A. G. van Kessel Upregulation of the transcription factor TFEB in t(6;11)(p21;q13)-positive renal cell carcinomas due to promoter substitution Hum. Mol. Genet., July 15, 2003; 12(14): 1661 - 1669. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. J. Davis, B.-L. Hsi, J. D. Arroyo, S. O. Vargas, Y. A. Yeh, G. Motyckova, P. Valencia, A. R. Perez-Atayde, P. Argani, M. Ladanyi, et al. Cloning of an Alpha-TFEB fusion in renal tumors harboring the t(6;11)(p21;q13) chromosome translocation PNAS, May 13, 2003; 100(10): 6051 - 6056. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Sanders, R. Mick, J. E. Tomaszewski, and F. G. Barr Unique Patterns of Allelic Imbalance Distinguish Type 1 from Type 2 Sporadic Papillary Renal Cell Carcinoma Am. J. Pathol., September 1, 2002; 161(3): 997 - 1005. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |