| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Animal Model |
From the Department of Carcinogenesis, The University of Texas M. D. Anderson Cancer Center, Smithville, Texas
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Initially, several reports assigned redundant roles to the three members of the D-type cyclin family, but in the last few years, it has become evident that each member plays specific roles and has differential tissue expression.3 In fact, different tissues are affected in cyclin D1 and cyclin D2 knockout mice.13-15 Whether these specific roles are dependent on regulatory subunits (cyclins), catalytic subunits (CDKs), or other accessory proteins remain unknown. D-type cyclins have been described as putative oncogenes in different tissues and more recently, CDK-independent functions of D-type cyclins were described.16-19 On the other hand, less is known about the involvement of CDKs in the tumorigenesis process. The importance of the interaction between CDK4 and p16INK4a became apparent with the identification of a CDK4 mutation in patients with familial melanoma,20-22 and by reports showing that mutually exclusive mutations of p16INK4a or CDK4 occur in glioblastomas.23,24
In previous work, we have demonstrated that the kinetics of CDK4-cyclin D1 complex formation followed a pattern similar to cyclin D1 expression25 in mouse keratinocytes induced by phorbol esters and in chemically induced mouse skin tumors.26 These results and the fact that the CDK4 protein level remains constant showed that CDK4 is not the rate-limiting factor in this model. In concordance with these data, cyclin D1, cyclin D2, and cyclin D3 transgenic mice showed a hyperproliferative epidermis and increased CDK4 and CDK6 kinase activities.27-29 To study the involvement of CDK4 in keratinocyte proliferation and differentiation, we generated transgenic mice overexpressing CDK4 in the epidermis. For this purpose we used a keratin 5 promoter that was used previously in our laboratory for the generation of cyclin D1, cyclin D2, and cyclin D3 transgenic mice. Here, we described the phenotypic consequences of overexpression of CDK4 in vivo. The transgenic mice developed severe epidermal hyperplasia and hypertrophy in basal and suprabasal cell layers. In addition to epidermal changes, transgenic mice developed dermal fibrosis with marked atrophy of the panniculum adiposum (subcutaneous adipose tissue). Protein expression in epidermal tissue of the transgenic mice showed that none of the D-type cyclins were overexpressed. Therefore, forced expression of CDK4 resulted in a hyperproliferative phenotype independent of D-type cyclin regulation. Increased binding of p27Kip1 to CDK4 in transgenic mice was associated with an elevated kinase activity of CDK2. Taken together, these results show that CDK4 overexpression has dramatic consequences in mouse skin compared with D-type cyclin transgenic mice. The strong effect in the dermal tissue suggests that an indirect mechanism, more likely through growth factor secretion, is associated with CDK4 deregulation.
| Materials and Methods |
|---|
|
|
|---|
An EcoRV/XbaI fragment containing the human
cyclin-dependent kinase 4 cDNA was excised from the plasmid pBluescript
II and inserted into the polylinker of the vector pBK5 that contained
the 5.2-kb bovine keratin 5 (K5) regulatory sequences, ß-globin
intron 2 and the 3' polyadenylation sequences. This construct was
designated as pK5-CDK4 (Figure 1)
. The
transgene was excised from the plasmid vector by digestion with
BssHII, separated by low-melting-point agarose
electrophoresis, and purified using a Geneclean II Kit (BIO101;
Geneclean, Vista, CA). This transgene was microinjected into the FVB
mouse strain by the Transgenic Mouse Development Facility at Science
Park, M. D. Anderson Cancer Center. Transgenic mice were crossed
for two generations with SSIN strain to generate 75% SSIN background
mice. All of the experiments were performed in this background.
|
Genomic DNA was extracted from mouse tail clips and used for PCR detection of the transgene. We used an upstream primer (TTCAGGGTGTTGTTTAGAATGG) and a downstream primer (CAATAAGAATATTTCCACGCCA) specific for the ß-globin intron 2 sequence. With this process, we screened all of the transgenic mouse lines. The DNA amplification renders a 450-bp PCR product. PCR was performed by denaturation at 95°C for 1 minute, followed by 32 cycles of amplification as follows: denaturation at 95°C for 30 seconds, annealing at 55°C for 40 seconds, and extension at 72°C for 45 seconds, with a final extension at 72°C for 10 minutes.
CDK4 Immunohistochemical Stains
Immunohistochemical staining of formalin-fixed paraffin-embedded tissues was performed with polyclonal mouse anti-CDK4 (C-22; Santa Cruz Biotechnology, Inc., Santa Cruz, CA). Epithelial cell proliferation was measured by intraperitoneal injection of 60 µg/g of 5-bromodeoxyuridine (BrdU) 30 minutes before the mice were killed. BrdU incorporation was detected by immunohistochemical staining of paraffin-embedded sections using mouse anti-BrdU monoclonal antibody (Becton Dickinson immunocytometry system; Becton Dickinson, San Jose, CA). The reaction was visualized with a biotin-conjugated anti-mouse antibody (Vector Laboratories, Inc. Burlingame, CA) and avidin-biotin-peroxidase kit (Vectastain Elite, Vector Laboratories, Inc.) with diaminobenzidine as the chromogen.
Western Blotting Analysis
The dorsal sides of the mice were shaved. After they were sacrificed, the dorsal skins were treated with a depilatory agent for 1 minute and then washed off. The epidermal tissue was scraped off with a razor blade, placed into homogenization buffer (50 mmol/L HEPES, pH 7.5, 150 mmol/L NaCl, 2.5 mmol/L EGTA, 1 mmol/L ethylenediaminetetraacetic acid, 0.1% Tween-20, 1 mmol/L dithiothreitol, 0.1 mmol/L phenylmethyl sulfonyl fluoride, 0.2 U/ml aprotinin, 10 mmol/L ß-glycerophosphate, 0.1 mmol/L sodium vanadate, and 1 mmol/L NaF) and homogenized using a manual homogenizer. The epidermal homogenate was centrifuged at 11,000 x g to collect the supernatant, which was used directly for Western blotting analysis or stored at -80°C. The protein concentration was measured with the Bio-Rad protein assay system (Bio-Rad Laboratories, Richmond, CA). Protein lysates (25 µg from each sample) were electrophoresed through 12% acrylamide gels and electrophoretically transferred onto nitrocellulose membranes. After being blocked with 5% nonfat powdered milk in Dulbeccos phosphate-buffered saline (Sigma Chemical Co.), the membranes were incubated with 1 µg/ml specific antibodies. The following antibodies were used: polyclonal antibodies against CDK4 (C22), CDK2 (M2), CDK6 (C21), p107 (C18), p130 (C20) (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) and mouse monoclonal antibody against pRb (14001A) (BD Pharmingen, San Diego, CA). Horseradish peroxidase-conjugated secondary antibody (Amersham Corp., Arlington Heights, IL), followed by enhanced chemiluminescence (ECL detection kit; Amersham Corp.) were used for immunoblotting detection. Bio-image analysis was used to quantitate the expression levels of those proteins.
To study p27Kip1/CDK complex formations and kinase activities, we used polyclonal antibodies against CDK4, CDK2, and p27Kip1 conjugated with protein A-Sepharose beads (Life Technologies Inc., Grand Island, NY) to immunoprecipitate fresh protein lysates for 1 hour at 4°C with constant rotation. After washing three times with extraction buffer, Western blot analysis was performed as described above. To study the kinase activities of CDK4 and CDK2, protein lysates were obtained as described above, but the homogenate was frozen on powdered dry ice, thawed in ice water, incubated on ice for 15 minutes, and centrifuged at 10,000 x g for 10 minutes at 4°C. The supernatant was collected and used for a kinase assay. Five hundred µg of protein lysate were immunoprecipitated with antibodies against CDK4 or CDK2. Thirty µl of precoated antibody beads were incubated with the lysate for 1 hour at 4°C. The beads were washed twice with Nonidet P-40 buffer (Tris, pH 7.5, 150 mmol/L NaCl, Nonidet P-40 0.5%, 50 mmol/L NaF, 1 mmol/L Na3VO4, 1 mmol/L dithiothreitol, 1 mmol/L phenylmethyl sulfonyl fluoride) and twice with kinase buffer (50 mmol/L HEPES, pH 7.0, 10 mmol/L MgCl2, 5 mmol/L MnCl2). Then, 30 µl of kinase buffer, 0.5 µg of pRb substrate (Santa Cruz Biotechnology, Inc.); 5 µCi 32P-ATP (6000 Ci/mmol), 1 mmol/L dithiothreitol, 5 µmol/L ATP) was added to the bead pellet and incubated for 30 minutes at 30°C. Sodium dodecyl sulfate sample buffer was added, and each sample was boiled for 5 minutes and electrophoresed through an 8% acrylamide gel.
| Results |
|---|
|
|
|---|
To determine the function of cyclin-dependent kinase 4 (CDK4) in
the epidermis, we generated transgenic mice that overexpressed CDK4
under the regulation of the keratin 5 promoter. The K5CDK4 construct
was made by subcloning the human CDK4 cDNA into a vector containing a
5.2-kb fragment of the bovine K5 promoter, the rabbit ß-globin intron
2, and the SV40 polyadenylation signal (Figure 1A)
. The K5 promoter
fragment was previously shown to direct transgene expression to the
basal cell compartment of stratified squamous epithelia.30
All of the transgenic mice were generated in the genetic background
FVB. Transgenic mice were identified by PCR analysis of tail DNA using
primers specific for the ß-globin sequence (Figure 1B)
. Based on
those results, five integration-positive mice were selected as founders
and crossed with SSIN inbred mice. A second screening to verify
transgene expression was performed by immunohistochemical staining for
CDK4. Because CDK4 was poorly detected in normal epidermis by
immunohistochemistry (Figure 2F)
,
positive CDK4 staining was used as an indication of transgene
expression (Figure 2E)
. These data are consistent with the expected
activity of the K5 promoter. We selected two transgenic lines with high
CDK4 expression (2303 and 2305), which were backcrossed with SSIN
inbred mice to produce animals with 75% SSIN background that were used
in all of the experiments presented here.
|
The newborn CDK4 transgenic mice did not demonstrate any obvious
developmental abnormalities and there were no differences in size
compared to wild-type littermates. To determine whether the expression
of transgene influenced the rate of proliferation and/or the
architecture of mouse skin, we analyzed the interfollicular epidermis
of transgenic and normal sibling mice. Immunohistochemical staining for
CDK4 expression in paraffin-embedded sections showed that both
transgenic lines expressed high levels of CDK4 protein compared with
normal sibling littermates (Figure 2, E and F)
. This result correlated
well with the CDK4 protein levels determined by Western blot (see
Figure 6
) and showed that expression of CDK4 by the keratin 5 promoter
was occurring in the epidermal basal cell layer. Paraffin-embedded
hematoxylin and eosin-stained sections were analyzed to determine
modifications in the skin architecture of transgenic mice. The
epidermis of wild-type mice consists of one to two nucleated cell
layers (basal and suprabasal cell layers) and the hair follicles are
regularly distributed (Figure 2, B and D)
. Both transgenic lines show
an increased proliferation rate and hyperplasia in areas of the
interfollicular epidermis (Figure 2
and Figure 3
). No obvious
modifications in the morphology or in the pattern of distribution of
hair follicles were observed in transgenic mice compared with wild-type
littermates. The proliferation status of keratinocytes was determined
by BrdU incorporation in DNA of cells in S phase. In the transgenic
mice as well as in the wild-type littermates, proliferation of the
epidermis was restricted to the basal layer (see Figure 4, A and B
). However, the number of proliferating
cells was fourfold higher in the epidermis of transgenic mice
(n = 7) compared with control mice
(n = 9), demonstrating that overexpression of
CDK4 stimulates proliferation of basal keratinocytes (Figure 4C)
. The
epidermis of transgenic mice was hyperplastic, presenting an increased
number of nucleated cells (Figure 2 and 3)
. The average thickness of transgenic
epidermis was 21.36 µm compared to 10.60 µm in normal littermates
(Figure 3B)
. The spinous and granular layers were greatly increased as
compared with the normal epidermis. A mild keratosis (accumulation of
keratinized cells in the epidermal surface) with areas of parakeratosis
were also observed in transgenic epidermis (Figure 2C)
. In addition to
epidermal changes, we observed dermal fibrosis with severe hypoplasia
of the subcutaneous adipose tissue (panniculum adiposum) (Figure 2A)
.
The average thickness of the dermal tissue increased 2.8-fold in
transgenic compared with normal sibling mice (Figure 2, A and B)
. These
data show that forced expression of cdk4 in epidermis results in an
essential increase of both epidermis and dermis.
|
|
|
Keratin Expression in Transgenic Mice
During epidermal differentiation there are sequential changes in
the expression of the keratins. Keratin 5 and keratin 14 are the major
products of basal epidermal cells, the proliferative compartment of the
epidermis.31
One of the earliest changes associated with
the commitment to differentiation and migration into the spinous layer
is the induction of the differentiation-specific keratin pair,
K1/K10,31-33
and decreased expression of the keratin
pair, K5/K14. In addition, mouse skin tumors and hyperproliferative
epidermis express keratins 6 and 16.34-36
To study
whether CDK4 expression affected the normal pattern of keratin
expression, the expression of K5, K1, and K6 was analyzed by
immunohistochemistry. The expression of K5 was observed in the basal
and suprabasal layers in both wild-type and transgenic mice (Figure 5, A and B)
. Keratin 1 was restricted to
terminally differentiated cells as is seen in wild-type adult mice
(Figure 5, C and D)
. As expected, the wild-type mice showed no
expression of keratin 6 (Figure 5E)
, but interestingly the transgenic
mice showed a very high level of expression of this keratin in the
interfollicular epidermis (Figure 5F)
. This result indicated that CDK4
overexpression in vivo induces cell proliferation and the
expression of a marker associated with hyperproliferative changes and
tumorigenesis.
|
To quantify the level of CDK4 protein expression, we isolated the
epidermis of transgenic and normal sibling mice. Protein lysates were
used for immunoblotting analysis as was previously
described.25
The CDK4 transgene is expressed at high
levels in both K5CDK4 lines compared to their normal siblings. CDK4
protein levels were elevated 7.5-fold in 2303 and 2.5-fold in 2305
transgenic lines (Figure 6)
. Although
line 2303 showed a higher level of CDK4 expression (Figure 6)
, similar
hyperproliferative changes were observed in both transgenic lines. As
regulatory subunits of CDKs, D-type cyclins are rate-limiting
controllers of G1 phase progression in mammalian
cells.2,3
CDK4 and CDK6 are the major catalytic partners
of D-type cyclins, assembling them into holoenzymes.37,38
To test whether the hyperproliferative phenotype of transgenic mice was
because of an increased activity of CDK4 caused by elevated expression
of the regulatory subunit, we analyzed the D-type cyclin protein
levels. No differences in the protein levels of cyclin D1, cyclin D2,
or cyclin D3 were observed between transgenic and wild-type animals
(Figure 6)
.
Because CDK4 and CDK6 have common functional and biochemical properties
as pRb kinases,39
we examined whether the CDK6 protein
level in the epidermis of transgenic mice was affected as a
compensatory mechanism. Western blotting analysis showed that the level
of CDK6 protein was not affected in either of the transgenic lines
(Figure 6)
. Thus, there was no apparent compensatory reduction of CDK6
expression in the epidermis. No changes in the protein levels of CDK2,
a protein kinase that is sequentially activated after CDK4,6 during
G1/S interphase7
were found in the
two transgenic lines compared with the normal siblings (Figure 6)
.
It is accepted that pRb is a negative regulator that acts in the
G1 phase of the cell cycle1,3,4,40
and it is a substrate of CDK4,6/D-type cyclins. p130 and p107 are
pRb-related proteins that may have similar functions and also have been
described as substrates of CDK4,6.40-42
Therefore the
phosphorylation status and protein level of the pRb family from
epidermal lysates of transgenic and normal sibling mice were also
analyzed. No evident changes in mobility that would be consistent with
phosphorylation were detected in pRb, p107, or p130 (Figure 6)
.
Moreover, p130 and p107 protein levels did not increase in transgenic
animals compared with the wild-type animals. On the other hand, pRb
protein levels increased in both transgenic lines compared to normal
siblings. This result is consistent with elevated pRb protein levels
detected after proliferation induced by phorbol ester in mouse
epidermis.25
Taken together, these results showed that
overexpression of CDK4 did not influence the protein level of its
regulatory subunits (D-type cyclins) and did not increase the
phosphorylation pattern of the pRb family, although, an increase in the
level of pRb protein was detected.
CDK Activities and Complex Formation in Epidermal Tissue
To study whether CDK4 overexpression resulted in functional
changes in the CDKs, we analyzed the kinase activity of CDK4 and CDK2
in the epidermis of transgenic and wild-type mice using pRb as a
substrate. Figure 7A
shows elevated CDK4
and CDK2 activity in K5CDK4 transgenics compared with normal sibling
mice. No modification in the level of CDK6 activity was observed (data
not shown). CDK4 and CDK2 activity increased 7- and 2.5-fold,
respectively, in transgenic lines. The CDKs activities of wild-type
epidermis were almost undetectable (Figure 7A)
, therefore the increased
activity in transgenic mice was easily observed.
|
| Discussion |
|---|
|
|
|---|
Epidermal and Dermal Phenotype
Previously, we reported on the generation of cyclin D1, cyclin D2, and cyclin D3 transgenic mice that expressed each of the D-type cyclins under the bovine keratin 5 promoter.27,29 These transgenic mice exhibited epidermal hyperplasia and, in some cases, thymic hyperplasia. These phenotypes are consistent with a positive regulator role of D-type cyclins in CDK4,6/cyclin complexes. The data shown here indicate that forced expression of CDK4 in mouse epidermal tissue results in strong skin abnormalities, specifically, interfollicular epidermal hyperplasia and hypertrophy, and severe dermal fibrosis. The stronger K5CDK4 phenotype compared with K5D1, K5D2, or K5D3 mice was not expected because D-type cyclins are rate-limiting factors in CDK complex formation in mouse epidermis.25,26 In this sense, the protein level of cyclin D1 governs the CDK4/cyclin D1 complex formation in normal epidermis and murine skin tumors.25,26 The epidermis thickness of the K5CDK4 animals was increased twofold whereas in the K5-D-type cyclin mice it increased an average of 0.25-fold.29 Moreover, no development of dermal fibrosis was detected in any K5-D-type cyclin transgenic animals.
The hyperplastic epidermal phenotype of K5CDK4 mice seems to be very similar to that observed in hyperproliferative skin generated by chemical treatment. In these cases, an increase in the rate of proliferation is follow by a mild expansion of the proliferative compartment that is compensated by a concomitant expansion of the differentiated compartments.46 However, the K5CDK4 transgenic epidermis also showed areas of parakeratosis (nucleated cells in the stratified layer), basal and suprabasal cells loosely packed, and increased cellular size (hypertrophy). Interestingly, this phenotype was unique for K5CDK4 mice because hyperplasia, but not hypertrophy was observed in the three D-type cyclin transgenic mice.27,29 In fact, overexpression of CDK4 in mouse astrocytes also results in a unique phenotype that includes an increase in cell size as well as hyperploidy.47 In support of these events, Cdk4/cyclin D overexpression in Drosophila caused hyperplasia in wing imaginal cells and hypertrophy in salivary glands and differentiating eyes.11,12 Thereafter, future studies will be directed toward investigating whether the hypertrophy observed in K5CDK4 mouse keratinocytes is associated with hyperploidy. Another interesting hypothesis to be tested is whether members of the HDAC family are involved in the increase in nuclear size. The role of HDAC is to remove acetyl groups from the amino-terminal regions of histone octamers, thereby promoting nucleosome assembly48 and inhibition of gene expression. Recent studies indicate that HDAC interacts with pRb; phosphorylation of pRb by CDK4 releases HDAC from this complex.5,49,50 Whether CDK4 overexpression, phosphorylation of pRb, and HDAC release have any role in the nuclear structure observed in K5CDK4 transgenic mice requires further investigation.
Although the transgene is expressed in the epidermis and in hair follicles, we have also observed gross abnormalities in the dermis, which is characterized by replacement of adipose tissue with connective tissue. In addition, the dermal thickness increased 2.8-fold in transgenic compared with normal sibling mice. Munz and colleagues51 reported on a similar phenotype in activin A (a member of transforming growth factor-ß family) transgenic mice, which affects keratinocyte proliferation and also produces dermal fibrosis. This might be because of the diffusion of cytokines from the keratinocytes into the underlying dermis as has been reported.51 This data demonstrated that dermal fibrosis could be produced by secretion of growth factors from the epidermis. Thus, whether expression of CDK4 in epidermis results in modifications in the expression of cytokines requires further investigation. If this is the case, up-regulation of a positive regulator of cell cycle (CDK4) could have important consequences in fibrotic diseases such as fibrotic kidneys and cirrhotic livers.
Modifications in Keratin Expression
Here, we showed that K5CDK4 transgenic mice express keratin 6 in the interfollicular epidermis and this event correlates well with the hyperproliferative phenotype. Keratin 6 is expressed in cell culture, benign and malignant epidermal tumors, and hyperplasia induced by the tumor promoter TPA, or wounding,36,52 but not in normal mouse epidermis. Also, transgenic mice that overexpressed keratin 16 (the partner of keratin 6) in the basal-cell layer showed keratinocyte hypertrophy and hyperplasia with a significant increase in epidermal thickness.53
One of the earliest changes associated with commitment to differentiation and migration into the spinous layer is induction of the differentiation-specific pair of keratins, K1/K10.31,32 Keratin 1 was detected in the suprabasal cell layers, demonstrating that the cells entered into the differentiation program and that the additional layers seen in the epidermis of the transgenic mice consist, at least partially, of differentiated cells. Keratin 5 is normally expressed in the basal layer of wild-type and transgenic mice. Histological section staining with anti-loricrin antibody showed that this marker of terminal differentiation was normally distributed in the granular layer (data not shown). Taken together, these results demonstrate that CDK4 overexpression induced a marker of proliferation (K6), but did not influence the pattern of terminal differentiation.
Model of Cell Proliferation
We can postulate several mechanisms that could be responsible for the hyperproliferative phenotype of the mouse epidermis of K5CDK4 transgenic mice. First, CDK4 expression can act in a catalytic fashion and bind to D-type cyclins and/or other G1/S cyclins (cyclin E, cyclin A), and further increase the level of phosphorylation of the pRb family. This classic model suggests that overexpression of CDK4 can displace other CDKs and be activated by different types of cyclins. However, we were unable to detect CDK4 binding to other G1 cyclins. In support of these results, a recent report showed that cyclin E, in the knock-in cyclin D1/cyclin E mice, does not bind to CDK4.54 Second, CDK4-D-type cyclins can also function in a noncatalytic fashion. As was demonstrated, CDK4 binds and sequesters CKI p27Kip1. Thus the CDK2-cyclin E and/or CDK2-cyclin A complexes are not inhibited by p27Kip1, and remain activated.55 Likewise, transforming growth factor-ß growth arrest depends on the inhibition of CDK4 synthesis and further inhibition of CDK2 activity by CKIs.56 Also, CDK4 disruption was associated with increased binding of p27Kip1 to cyclin E/CDK2 and diminished activation of CDK2 was accompanied by impaired pRb phosphorylation.44 Third, p16Ink4a and D-type cyclins bind to the same site on CDK4.57 Thus, CDK4 protein is normally distributed in complexes with D-type cyclins or with the product of the tumor suppressor gene p16Ink4a. Thus, the excess of CDK4 protein in transgenic epidermis could result in sequestration of p16Ink4a and further formation of more CDK4-D-type cyclins complexes. In fact, the opposite effect was observed when p16Ink4a expression was induced in U2-OS cells. In this case, both CDK4- and CDK2-associated kinase activities were inhibited by redistribution of cyclin-CDK inhibitor complexes.43,58 All of these models require phosphorylation of pRb by CDKs. The in vitro kinase assays showed that both CDK4 and CDK2 activities increased in the transgenic epidermis. Our assays of CDK4-CKI complex formation demonstrated that at least one CKI (p27Kip1) is sequestered by the increased levels of CDK4 and this event may be responsible for the elevated CDK2 activity and, in part, for the epidermis proliferation.
The fact that the level of D-type cyclin remained constant in transgenic mice compared with wild-type mice suggests that no elevations in the regulatory subunit levels are required to produce the hyperproliferative phenotype. Thus, the increased activity of CDK4 is not because of activation of D-type cyclins, so, the mechanism responsible for CDK4 activation must involve events other than simple binding to D-type cyclins. In accordance with these data, amplification of CDK4 in glioblastomas or glioma cell lines is not followed by amplification or elevated expression of cyclin D1.23,45
Previously, we have reported that in murine skin tumors, p16Ink4a is overexpressed without changes in CDK4 expression.26 On the other hand, in glioma cell lines, CDK4 amplification is an alternative mechanism to p16Ink4a deletion.23 Thus, overexpression of CDK4 could overcome the increased level of p16Ink4a and play an important role in tumor development.
Together, our results showed that the noncatalytic or stoichiometric function of CDK4 sequestering p27Kip1 plays an important role in epidermal proliferation in vivo. Finally, biochemical studies and detailed analysis of CDK complex formation in the epidermis of transgenic and knockout mice should help in understanding how the absence or overexpression of CDK4 can affect the constitution of these complexes and how they affect cell growth and cell-cycle progression.
| Acknowledgements |
|---|
| Footnotes |
|---|
Supported by National Institutes of Health grants CA 42157 and CA 57596; Center grant CA 16672 to M. D. Anderson Cancer Center; National Institute of Environmental Health Sciences grant P30-E507784-01; and funds from the University Cancer Foundation at the University of Texas M. D. Anderson Cancer Center.
Accepted for publication April 11, 2001.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
E. Macias, P. L. Miliani de Marval, A. De Siervi, C. J. Conti, A. M. Senderowicz, and M. L. Rodriguez-Puebla CDK2 Activation in Mouse Epidermis Induces Keratinocyte Proliferation but Does Not Affect Skin Tumor Development Am. J. Pathol., August 1, 2008; 173(2): 526 - 535. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Macias, P. L. Miliani de Marval, A. Senderowicz, J. Cullen, and M. L. Rodriguez-Puebla Expression of CDK4 or CDK2 in Mouse Oral Cavity Is Retained in Adult Pituitary with Distinct Effects on Tumorigenesis Cancer Res., January 1, 2008; 68(1): 162 - 171. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Macias, Y. Kim, P. L. Miliani de Marval, A. Klein-Szanto, and M. L. Rodriguez-Puebla Cdk2 Deficiency Decreases ras/CDK4-Dependent Malignant Progression, but Not myc-Induced Tumorigenesis Cancer Res., October 15, 2007; 67(20): 9713 - 9720. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-M. Chien, S. Rabin, E. Macias, P. L. Miliani de Marval, K. Garrison, J. Orthel, M. Rodriguez-Puebla, and M. L. Fero Genetic mosaics reveal both cell-autonomous and cell-nonautonomous function of murine p27Kip1. PNAS, March 14, 2006; 103(11): 4122 - 4127. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. L. Miliani de Marval, E. Macias, R. Rounbehler, P. Sicinski, H. Kiyokawa, D. G. Johnson, C. J. Conti, and M. L. Rodriguez-Puebla Lack of Cyclin-Dependent Kinase 4 Inhibits c-myc Tumorigenic Activities in Epithelial Tissues Mol. Cell. Biol., September 1, 2004; 24(17): 7538 - 7547. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Richard-Parpaillon, R. A. Cosgrove, C. Devine, A. E. Vernon, and A. Philpott G1/S phase cyclin-dependent kinase overexpression perturbs early development and delays tissue-specific differentiation in Xenopus Development, June 1, 2004; 131(11): 2577 - 2586. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. D. Yu, M. Becker-Hapak, E. L. Snyder, M. Vooijs, C. Denicourt, and S. F. Dowdy Distinct and nonoverlapping roles for pRB and cyclin D:cyclin-dependent kinases 4/6 activity in melanocyte survival PNAS, December 9, 2003; 100(25): 14881 - 14886. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Rodriguez-Puebla, P. L. Miliani de Marval, M. LaCava, D. S. Moons, H. Kiyokawa, and C. J. Conti cdk4 Deficiency Inhibits Skin Tumor Development but Does Not Affect Normal Keratinocyte Proliferation Am. J. Pathol., August 1, 2002; 161(2): 405 - 411. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Benavides, M. F. Starost, M. Flores, I. B. Gimenez-Conti, J.-L. Guenet, and C. J. Conti Impaired Hair Follicle Morphogenesis and Cycling with Abnormal Epidermal Differentiation in nackt Mice, a Cathepsin L-Deficient Mutation Am. J. Pathol., August 1, 2002; 161(2): 693 - 703. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |